![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: ZNF517 |
Gene summary for ZNF517 |
![]() |
Gene information | Species | Human | Gene symbol | ZNF517 | Gene ID | 340385 |
Gene name | zinc finger protein 517 | |
Gene Alias | ZNF517 | |
Cytomap | 8q24.3 | |
Gene Type | protein-coding | GO ID | GO:0006139 | UniProtAcc | B7ZLN6 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
340385 | ZNF517 | HCC1 | Human | Liver | HCC | 2.09e-06 | 2.09e+00 | 0.5336 |
340385 | ZNF517 | HCC2 | Human | Liver | HCC | 1.59e-10 | 1.18e+00 | 0.5341 |
340385 | ZNF517 | HCC5 | Human | Liver | HCC | 5.44e-09 | 6.80e-01 | 0.4932 |
340385 | ZNF517 | S014 | Human | Liver | HCC | 9.23e-03 | 1.33e-01 | 0.2254 |
340385 | ZNF517 | S028 | Human | Liver | HCC | 2.29e-03 | 2.29e-01 | 0.2503 |
340385 | ZNF517 | S029 | Human | Liver | HCC | 1.03e-02 | 2.15e-01 | 0.2581 |
Page: 1 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Liver | ![]() | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Thyroid | PTC | ![]() |
Thyroid | goiters | ![]() |
Thyroid | ATC | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
ZNF517 | insertion | Nonsense_Mutation | novel | c.471_472insACCGCACACAGATAATTTTTGTATTTTTAGTAGAGATG | p.Ala158ThrfsTer5 | p.A158Tfs*5 | Q6ZMY9 | protein_coding | TCGA-AN-A0FX-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
ZNF517 | insertion | In_Frame_Ins | novel | c.137_138insATGCAAGAATGTTTT | p.Asn46delinsLysCysLysAsnValPhe | p.N46delinsKCKNVF | Q6ZMY9 | protein_coding | TCGA-BH-A0BJ-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | SD | ||
ZNF517 | insertion | Nonsense_Mutation | novel | c.139_140insGATGTTCCC | p.Tyr47delinsTer | p.Y47delins* | Q6ZMY9 | protein_coding | TCGA-BH-A0BJ-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | SD | ||
ZNF517 | SNV | Missense_Mutation | novel | c.902N>T | p.Arg301Met | p.R301M | Q6ZMY9 | protein_coding | tolerated(0.09) | possibly_damaging(0.524) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
ZNF517 | deletion | Frame_Shift_Del | novel | c.984_1018delAGGGTCCTCGCTCCTGAAGCACCACCGGCTGCACG | p.Gly329AlafsTer183 | p.G329Afs*183 | Q6ZMY9 | protein_coding | TCGA-R2-A69V-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | SD | ||
ZNF517 | SNV | Missense_Mutation | rs866431601 | c.706N>A | p.Gly236Ser | p.G236S | Q6ZMY9 | protein_coding | tolerated(0.78) | benign(0.001) | TCGA-A6-6649-01 | Colorectum | colon adenocarcinoma | Male | >=65 | III/IV | Chemotherapy | fluorouracil | SD |
ZNF517 | SNV | Missense_Mutation | c.583N>T | p.His195Tyr | p.H195Y | Q6ZMY9 | protein_coding | deleterious(0.04) | probably_damaging(0.934) | TCGA-AA-A01R-01 | Colorectum | colon adenocarcinoma | Male | <65 | III/IV | Chemotherapy | 5-fluorouracil | PD | |
ZNF517 | SNV | Missense_Mutation | rs772832393 | c.601N>A | p.Gly201Ser | p.G201S | Q6ZMY9 | protein_coding | deleterious(0.01) | probably_damaging(0.996) | TCGA-AZ-6601-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
ZNF517 | SNV | Missense_Mutation | rs528684607 | c.1331N>A | p.Arg444Gln | p.R444Q | Q6ZMY9 | protein_coding | deleterious(0.05) | possibly_damaging(0.531) | TCGA-CK-4951-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | PD |
ZNF517 | SNV | Missense_Mutation | c.1451N>A | p.Gly484Asp | p.G484D | Q6ZMY9 | protein_coding | tolerated(0.92) | benign(0) | TCGA-D5-6928-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |