Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: EXOSC8

Gene summary for EXOSC8

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

EXOSC8

Gene ID

11340

Gene nameexosome component 8
Gene AliasCIP3
Cytomap13q13.3
Gene Typeprotein-coding
GO ID

GO:0000288

UniProtAcc

Q96B26


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
11340EXOSC8LZE4THumanEsophagusESCC1.06e-071.02e-010.0811
11340EXOSC8LZE5THumanEsophagusESCC4.39e-032.49e-010.0514
11340EXOSC8LZE7THumanEsophagusESCC1.01e-042.27e-010.0667
11340EXOSC8LZE8THumanEsophagusESCC3.66e-031.67e-010.067
11340EXOSC8LZE24THumanEsophagusESCC4.52e-163.10e-010.0596
11340EXOSC8LZE6THumanEsophagusESCC2.85e-022.00e-010.0845
11340EXOSC8P1T-EHumanEsophagusESCC1.61e-072.08e-010.0875
11340EXOSC8P2T-EHumanEsophagusESCC4.22e-346.57e-010.1177
11340EXOSC8P4T-EHumanEsophagusESCC1.37e-247.75e-010.1323
11340EXOSC8P5T-EHumanEsophagusESCC3.25e-214.10e-010.1327
11340EXOSC8P8T-EHumanEsophagusESCC9.63e-274.77e-010.0889
11340EXOSC8P9T-EHumanEsophagusESCC1.20e-123.66e-010.1131
11340EXOSC8P10T-EHumanEsophagusESCC1.82e-265.45e-010.116
11340EXOSC8P11T-EHumanEsophagusESCC3.10e-153.99e-010.1426
11340EXOSC8P12T-EHumanEsophagusESCC4.73e-142.78e-010.1122
11340EXOSC8P15T-EHumanEsophagusESCC1.22e-112.85e-010.1149
11340EXOSC8P16T-EHumanEsophagusESCC1.19e-224.38e-010.1153
11340EXOSC8P17T-EHumanEsophagusESCC2.78e-095.41e-010.1278
11340EXOSC8P19T-EHumanEsophagusESCC3.88e-033.23e-010.1662
11340EXOSC8P20T-EHumanEsophagusESCC2.83e-164.82e-010.1124
Page: 1 2 3 4 5 6 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
SkinThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AK: Actinic keratosis
cSCC: Cutaneous squamous cell carcinoma
SCCIS:squamous cell carcinoma in situ
ThyroidThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ATC: Anaplastic thyroid cancer
HT: Hashimoto's thyroiditis
PTC: Papillary thyroid cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
EsophagusESCCGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
SkinAKGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
SkinSCCISGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
SkincSCCGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
ThyroidHTGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:0022613111EsophagusESCCribonucleoprotein complex biogenesis365/8552463/187231.74e-491.11e-45365
GO:0042254111EsophagusESCCribosome biogenesis252/8552299/187233.27e-441.04e-40252
GO:003447015EsophagusESCCncRNA processing300/8552395/187233.09e-353.26e-32300
GO:0016072110EsophagusESCCrRNA metabolic process197/8552236/187231.31e-331.18e-30197
GO:0006364110EsophagusESCCrRNA processing189/8552225/187234.88e-333.87e-30189
GO:003466012EsophagusESCCncRNA metabolic process346/8552485/187234.35e-312.51e-28346
GO:0009896111EsophagusESCCpositive regulation of catabolic process332/8552492/187234.36e-239.22e-21332
GO:0031331111EsophagusESCCpositive regulation of cellular catabolic process292/8552427/187238.67e-221.53e-19292
GO:1903311110EsophagusESCCregulation of mRNA metabolic process210/8552288/187233.25e-215.56e-19210
GO:0006401110EsophagusESCCRNA catabolic process204/8552278/187233.39e-215.66e-19204
GO:0034655110EsophagusESCCnucleobase-containing compound catabolic process272/8552407/187232.92e-182.90e-16272
GO:0006402110EsophagusESCCmRNA catabolic process170/8552232/187238.70e-188.00e-16170
GO:0006417111EsophagusESCCregulation of translation304/8552468/187231.53e-171.33e-15304
GO:004670018EsophagusESCCheterocycle catabolic process286/8552445/187231.12e-157.47e-14286
GO:004427019EsophagusESCCcellular nitrogen compound catabolic process288/8552451/187233.03e-151.79e-13288
GO:001943918EsophagusESCCaromatic compound catabolic process295/8552467/187231.09e-145.98e-13295
GO:190136118EsophagusESCCorganic cyclic compound catabolic process307/8552495/187239.99e-144.80e-12307
GO:000095618EsophagusESCCnuclear-transcribed mRNA catabolic process88/8552112/187239.41e-134.14e-1188
GO:00905013EsophagusESCCRNA phosphodiester bond hydrolysis110/8552152/187231.95e-116.81e-10110
GO:190331316EsophagusESCCpositive regulation of mRNA metabolic process87/8552118/187235.10e-101.32e-0887
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa0301824EsophagusESCCRNA degradation62/420579/84651.18e-079.39e-074.81e-0762
hsa0301834EsophagusESCCRNA degradation62/420579/84651.18e-079.39e-074.81e-0762
hsa03018LiverCirrhoticRNA degradation44/253079/84651.43e-061.65e-051.02e-0544
hsa030181LiverCirrhoticRNA degradation44/253079/84651.43e-061.65e-051.02e-0544
hsa030182LiverHCCRNA degradation58/402079/84652.29e-062.19e-051.22e-0558
hsa030183LiverHCCRNA degradation58/402079/84652.29e-062.19e-051.22e-0558
hsa030189Oral cavityOSCCRNA degradation59/370479/84652.05e-081.91e-079.70e-0859
hsa0301814Oral cavityOSCCRNA degradation59/370479/84652.05e-081.91e-079.70e-0859
hsa0301823Oral cavityLPRNA degradation39/241879/84656.98e-054.38e-042.83e-0439
hsa0301833Oral cavityLPRNA degradation39/241879/84656.98e-054.38e-042.83e-0439
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
EXOSC8SNVMissense_Mutationc.133N>Ap.Ala45Thrp.A45TQ96B26protein_codingdeleterious(0)probably_damaging(0.998)TCGA-BH-A18G-01Breastbreast invasive carcinomaFemale>=65I/IIUnknownUnknownSD
EXOSC8SNVMissense_Mutationnovelc.329N>Ap.Ala110Glup.A110EQ96B26protein_codingtolerated(0.73)benign(0.181)TCGA-EW-A1P8-01Breastbreast invasive carcinomaFemale<65III/IVChemotherapyfluorouracilPD
EXOSC8SNVMissense_Mutationrs757011310c.139N>Ap.Gly47Serp.G47SQ96B26protein_codingtolerated(0.15)probably_damaging(0.965)TCGA-CK-4951-01Colorectumcolon adenocarcinomaFemale>=65I/IIUnknownUnknownPD
EXOSC8SNVMissense_Mutationc.473N>Tp.Ala158Valp.A158VQ96B26protein_codingdeleterious(0)probably_damaging(0.981)TCGA-CK-6751-01Colorectumcolon adenocarcinomaFemale>=65I/IIUnknownUnknownSD
EXOSC8SNVMissense_Mutationc.578C>Tp.Pro193Leup.P193LQ96B26protein_codingtolerated(0.12)probably_damaging(0.93)TCGA-CM-6677-01Colorectumcolon adenocarcinomaFemale>=65I/IIUnknownUnknownSD
EXOSC8SNVMissense_Mutationc.698N>Ap.Cys233Tyrp.C233YQ96B26protein_codingdeleterious(0)probably_damaging(0.982)TCGA-G4-6588-01Colorectumcolon adenocarcinomaFemale<65I/IIUnknownUnknownSD
EXOSC8SNVMissense_Mutationnovelc.60N>Tp.Glu20Aspp.E20DQ96B26protein_codingdeleterious(0.02)benign(0.067)TCGA-EI-6917-01Colorectumrectum adenocarcinomaMale<65III/IVChemotherapy5fluorouracil+oxaciplatina+l-folinianSD
EXOSC8deletionFrame_Shift_Delnovelc.480delNp.Asn162MetfsTer9p.N162Mfs*9Q96B26protein_codingTCGA-AA-3947-01Colorectumcolon adenocarcinomaFemale<65I/IIUnknownUnknownSD
EXOSC8insertionFrame_Shift_Insnovelc.234_238+50dupCGTTGGTAAGTTAAATGGTTTTGTAATTTTAATACAAATACTTTTAACACATTTAQ96B26protein_codingTCGA-CI-6624-01Colorectumrectum adenocarcinomaFemale<65I/IIUnknownUnknownSD
EXOSC8SNVMissense_Mutationnovelc.635N>Ap.Gly212Glup.G212EQ96B26protein_codingtolerated(1)benign(0.011)TCGA-A5-A0G2-01Endometriumuterine corpus endometrioid carcinomaFemale<65III/IVUnknownUnknownSD
Page: 1 2 3 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1