![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: EXOSC8 |
Gene summary for EXOSC8 |
![]() |
Gene information | Species | Human | Gene symbol | EXOSC8 | Gene ID | 11340 |
Gene name | exosome component 8 | |
Gene Alias | CIP3 | |
Cytomap | 13q13.3 | |
Gene Type | protein-coding | GO ID | GO:0000288 | UniProtAcc | Q96B26 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
11340 | EXOSC8 | LZE4T | Human | Esophagus | ESCC | 1.06e-07 | 1.02e-01 | 0.0811 |
11340 | EXOSC8 | LZE5T | Human | Esophagus | ESCC | 4.39e-03 | 2.49e-01 | 0.0514 |
11340 | EXOSC8 | LZE7T | Human | Esophagus | ESCC | 1.01e-04 | 2.27e-01 | 0.0667 |
11340 | EXOSC8 | LZE8T | Human | Esophagus | ESCC | 3.66e-03 | 1.67e-01 | 0.067 |
11340 | EXOSC8 | LZE24T | Human | Esophagus | ESCC | 4.52e-16 | 3.10e-01 | 0.0596 |
11340 | EXOSC8 | LZE6T | Human | Esophagus | ESCC | 2.85e-02 | 2.00e-01 | 0.0845 |
11340 | EXOSC8 | P1T-E | Human | Esophagus | ESCC | 1.61e-07 | 2.08e-01 | 0.0875 |
11340 | EXOSC8 | P2T-E | Human | Esophagus | ESCC | 4.22e-34 | 6.57e-01 | 0.1177 |
11340 | EXOSC8 | P4T-E | Human | Esophagus | ESCC | 1.37e-24 | 7.75e-01 | 0.1323 |
11340 | EXOSC8 | P5T-E | Human | Esophagus | ESCC | 3.25e-21 | 4.10e-01 | 0.1327 |
11340 | EXOSC8 | P8T-E | Human | Esophagus | ESCC | 9.63e-27 | 4.77e-01 | 0.0889 |
11340 | EXOSC8 | P9T-E | Human | Esophagus | ESCC | 1.20e-12 | 3.66e-01 | 0.1131 |
11340 | EXOSC8 | P10T-E | Human | Esophagus | ESCC | 1.82e-26 | 5.45e-01 | 0.116 |
11340 | EXOSC8 | P11T-E | Human | Esophagus | ESCC | 3.10e-15 | 3.99e-01 | 0.1426 |
11340 | EXOSC8 | P12T-E | Human | Esophagus | ESCC | 4.73e-14 | 2.78e-01 | 0.1122 |
11340 | EXOSC8 | P15T-E | Human | Esophagus | ESCC | 1.22e-11 | 2.85e-01 | 0.1149 |
11340 | EXOSC8 | P16T-E | Human | Esophagus | ESCC | 1.19e-22 | 4.38e-01 | 0.1153 |
11340 | EXOSC8 | P17T-E | Human | Esophagus | ESCC | 2.78e-09 | 5.41e-01 | 0.1278 |
11340 | EXOSC8 | P19T-E | Human | Esophagus | ESCC | 3.88e-03 | 3.23e-01 | 0.1662 |
11340 | EXOSC8 | P20T-E | Human | Esophagus | ESCC | 2.83e-16 | 4.82e-01 | 0.1124 |
Page: 1 2 3 4 5 6 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Esophagus | ESCC | ![]() |
Skin | AK | ![]() |
Skin | SCCIS | ![]() |
Skin | cSCC | ![]() |
Thyroid | HT | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:0022613111 | Esophagus | ESCC | ribonucleoprotein complex biogenesis | 365/8552 | 463/18723 | 1.74e-49 | 1.11e-45 | 365 |
GO:0042254111 | Esophagus | ESCC | ribosome biogenesis | 252/8552 | 299/18723 | 3.27e-44 | 1.04e-40 | 252 |
GO:003447015 | Esophagus | ESCC | ncRNA processing | 300/8552 | 395/18723 | 3.09e-35 | 3.26e-32 | 300 |
GO:0016072110 | Esophagus | ESCC | rRNA metabolic process | 197/8552 | 236/18723 | 1.31e-33 | 1.18e-30 | 197 |
GO:0006364110 | Esophagus | ESCC | rRNA processing | 189/8552 | 225/18723 | 4.88e-33 | 3.87e-30 | 189 |
GO:003466012 | Esophagus | ESCC | ncRNA metabolic process | 346/8552 | 485/18723 | 4.35e-31 | 2.51e-28 | 346 |
GO:0009896111 | Esophagus | ESCC | positive regulation of catabolic process | 332/8552 | 492/18723 | 4.36e-23 | 9.22e-21 | 332 |
GO:0031331111 | Esophagus | ESCC | positive regulation of cellular catabolic process | 292/8552 | 427/18723 | 8.67e-22 | 1.53e-19 | 292 |
GO:1903311110 | Esophagus | ESCC | regulation of mRNA metabolic process | 210/8552 | 288/18723 | 3.25e-21 | 5.56e-19 | 210 |
GO:0006401110 | Esophagus | ESCC | RNA catabolic process | 204/8552 | 278/18723 | 3.39e-21 | 5.66e-19 | 204 |
GO:0034655110 | Esophagus | ESCC | nucleobase-containing compound catabolic process | 272/8552 | 407/18723 | 2.92e-18 | 2.90e-16 | 272 |
GO:0006402110 | Esophagus | ESCC | mRNA catabolic process | 170/8552 | 232/18723 | 8.70e-18 | 8.00e-16 | 170 |
GO:0006417111 | Esophagus | ESCC | regulation of translation | 304/8552 | 468/18723 | 1.53e-17 | 1.33e-15 | 304 |
GO:004670018 | Esophagus | ESCC | heterocycle catabolic process | 286/8552 | 445/18723 | 1.12e-15 | 7.47e-14 | 286 |
GO:004427019 | Esophagus | ESCC | cellular nitrogen compound catabolic process | 288/8552 | 451/18723 | 3.03e-15 | 1.79e-13 | 288 |
GO:001943918 | Esophagus | ESCC | aromatic compound catabolic process | 295/8552 | 467/18723 | 1.09e-14 | 5.98e-13 | 295 |
GO:190136118 | Esophagus | ESCC | organic cyclic compound catabolic process | 307/8552 | 495/18723 | 9.99e-14 | 4.80e-12 | 307 |
GO:000095618 | Esophagus | ESCC | nuclear-transcribed mRNA catabolic process | 88/8552 | 112/18723 | 9.41e-13 | 4.14e-11 | 88 |
GO:00905013 | Esophagus | ESCC | RNA phosphodiester bond hydrolysis | 110/8552 | 152/18723 | 1.95e-11 | 6.81e-10 | 110 |
GO:190331316 | Esophagus | ESCC | positive regulation of mRNA metabolic process | 87/8552 | 118/18723 | 5.10e-10 | 1.32e-08 | 87 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa0301824 | Esophagus | ESCC | RNA degradation | 62/4205 | 79/8465 | 1.18e-07 | 9.39e-07 | 4.81e-07 | 62 |
hsa0301834 | Esophagus | ESCC | RNA degradation | 62/4205 | 79/8465 | 1.18e-07 | 9.39e-07 | 4.81e-07 | 62 |
hsa03018 | Liver | Cirrhotic | RNA degradation | 44/2530 | 79/8465 | 1.43e-06 | 1.65e-05 | 1.02e-05 | 44 |
hsa030181 | Liver | Cirrhotic | RNA degradation | 44/2530 | 79/8465 | 1.43e-06 | 1.65e-05 | 1.02e-05 | 44 |
hsa030182 | Liver | HCC | RNA degradation | 58/4020 | 79/8465 | 2.29e-06 | 2.19e-05 | 1.22e-05 | 58 |
hsa030183 | Liver | HCC | RNA degradation | 58/4020 | 79/8465 | 2.29e-06 | 2.19e-05 | 1.22e-05 | 58 |
hsa030189 | Oral cavity | OSCC | RNA degradation | 59/3704 | 79/8465 | 2.05e-08 | 1.91e-07 | 9.70e-08 | 59 |
hsa0301814 | Oral cavity | OSCC | RNA degradation | 59/3704 | 79/8465 | 2.05e-08 | 1.91e-07 | 9.70e-08 | 59 |
hsa0301823 | Oral cavity | LP | RNA degradation | 39/2418 | 79/8465 | 6.98e-05 | 4.38e-04 | 2.83e-04 | 39 |
hsa0301833 | Oral cavity | LP | RNA degradation | 39/2418 | 79/8465 | 6.98e-05 | 4.38e-04 | 2.83e-04 | 39 |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
EXOSC8 | SNV | Missense_Mutation | c.133N>A | p.Ala45Thr | p.A45T | Q96B26 | protein_coding | deleterious(0) | probably_damaging(0.998) | TCGA-BH-A18G-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
EXOSC8 | SNV | Missense_Mutation | novel | c.329N>A | p.Ala110Glu | p.A110E | Q96B26 | protein_coding | tolerated(0.73) | benign(0.181) | TCGA-EW-A1P8-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | fluorouracil | PD |
EXOSC8 | SNV | Missense_Mutation | rs757011310 | c.139N>A | p.Gly47Ser | p.G47S | Q96B26 | protein_coding | tolerated(0.15) | probably_damaging(0.965) | TCGA-CK-4951-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | PD |
EXOSC8 | SNV | Missense_Mutation | c.473N>T | p.Ala158Val | p.A158V | Q96B26 | protein_coding | deleterious(0) | probably_damaging(0.981) | TCGA-CK-6751-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
EXOSC8 | SNV | Missense_Mutation | c.578C>T | p.Pro193Leu | p.P193L | Q96B26 | protein_coding | tolerated(0.12) | probably_damaging(0.93) | TCGA-CM-6677-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
EXOSC8 | SNV | Missense_Mutation | c.698N>A | p.Cys233Tyr | p.C233Y | Q96B26 | protein_coding | deleterious(0) | probably_damaging(0.982) | TCGA-G4-6588-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
EXOSC8 | SNV | Missense_Mutation | novel | c.60N>T | p.Glu20Asp | p.E20D | Q96B26 | protein_coding | deleterious(0.02) | benign(0.067) | TCGA-EI-6917-01 | Colorectum | rectum adenocarcinoma | Male | <65 | III/IV | Chemotherapy | 5fluorouracil+oxaciplatina+l-folinian | SD |
EXOSC8 | deletion | Frame_Shift_Del | novel | c.480delN | p.Asn162MetfsTer9 | p.N162Mfs*9 | Q96B26 | protein_coding | TCGA-AA-3947-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
EXOSC8 | insertion | Frame_Shift_Ins | novel | c.234_238+50dupCGTTGGTAAGTTAAATGGTTTTGTAATTTTAATACAAATACTTTTAACACATTTA | Q96B26 | protein_coding | TCGA-CI-6624-01 | Colorectum | rectum adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||||
EXOSC8 | SNV | Missense_Mutation | novel | c.635N>A | p.Gly212Glu | p.G212E | Q96B26 | protein_coding | tolerated(1) | benign(0.011) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
Page: 1 2 3 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |