Tissue | Expression Dynamics | Abbreviation |
Liver | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Liver/WDR6_pca_on_diff_genes.png) | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Oral Cavity | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/OralCavity/WDR6_pca_on_diff_genes.png) | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Prostate/WDR6_pca_on_diff_genes.png) | BPH: Benign Prostatic Hyperplasia |
Thyroid | ![The image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.](images/deg_images/Thyroid/WDR6_pca_on_diff_genes.png) | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:001657015 | Esophagus | ESCC | histone modification | 323/8552 | 463/18723 | 2.61e-26 | 7.88e-24 | 323 |
GO:001820514 | Esophagus | ESCC | peptidyl-lysine modification | 259/8552 | 376/18723 | 3.90e-20 | 5.26e-18 | 259 |
GO:000635414 | Esophagus | ESCC | DNA-templated transcription, elongation | 76/8552 | 91/18723 | 8.35e-14 | 4.11e-12 | 76 |
GO:001605517 | Esophagus | ESCC | Wnt signaling pathway | 268/8552 | 444/18723 | 2.32e-10 | 6.58e-09 | 268 |
GO:019873817 | Esophagus | ESCC | cell-cell signaling by wnt | 269/8552 | 446/18723 | 2.41e-10 | 6.79e-09 | 269 |
GO:00434143 | Esophagus | ESCC | macromolecule methylation | 199/8552 | 316/18723 | 3.44e-10 | 9.57e-09 | 199 |
GO:0030099111 | Esophagus | ESCC | myeloid cell differentiation | 232/8552 | 381/18723 | 1.22e-09 | 2.90e-08 | 232 |
GO:000636814 | Esophagus | ESCC | transcription elongation from RNA polymerase II promoter | 56/8552 | 69/18723 | 1.40e-09 | 3.30e-08 | 56 |
GO:003105614 | Esophagus | ESCC | regulation of histone modification | 106/8552 | 152/18723 | 1.52e-09 | 3.55e-08 | 106 |
GO:00322592 | Esophagus | ESCC | methylation | 222/8552 | 364/18723 | 2.26e-09 | 5.09e-08 | 222 |
GO:000647914 | Esophagus | ESCC | protein methylation | 115/8552 | 181/18723 | 9.07e-07 | 1.16e-05 | 115 |
GO:000821314 | Esophagus | ESCC | protein alkylation | 115/8552 | 181/18723 | 9.07e-07 | 1.16e-05 | 115 |
GO:00310583 | Esophagus | ESCC | positive regulation of histone modification | 65/8552 | 92/18723 | 1.04e-06 | 1.31e-05 | 65 |
GO:00165718 | Esophagus | ESCC | histone methylation | 89/8552 | 141/18723 | 2.17e-05 | 1.87e-04 | 89 |
GO:003496814 | Esophagus | ESCC | histone lysine methylation | 72/8552 | 115/18723 | 1.85e-04 | 1.18e-03 | 72 |
GO:1903706110 | Esophagus | ESCC | regulation of hemopoiesis | 201/8552 | 367/18723 | 2.60e-04 | 1.58e-03 | 201 |
GO:003106013 | Esophagus | ESCC | regulation of histone methylation | 46/8552 | 69/18723 | 3.46e-04 | 2.03e-03 | 46 |
GO:001802214 | Esophagus | ESCC | peptidyl-lysine methylation | 79/8552 | 131/18723 | 5.17e-04 | 2.86e-03 | 79 |
GO:0045637111 | Esophagus | ESCC | regulation of myeloid cell differentiation | 118/8552 | 210/18723 | 1.35e-03 | 6.43e-03 | 118 |
GO:003106211 | Esophagus | ESCC | positive regulation of histone methylation | 28/8552 | 41/18723 | 2.88e-03 | 1.21e-02 | 28 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
WDR6 | SNV | Missense_Mutation | novel | c.3151G>A | p.Glu1051Lys | p.E1051K | | protein_coding | tolerated(0.35) | benign(0.015) | TCGA-5L-AAT1-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Hormone Therapy | letrozol | SD |
WDR6 | SNV | Missense_Mutation | novel | c.2837N>C | p.Val946Ala | p.V946A | | protein_coding | deleterious(0.03) | possibly_damaging(0.597) | TCGA-A7-A5ZW-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | cyclophosphamide | CR |
WDR6 | SNV | Missense_Mutation | | c.2764N>G | p.Leu922Val | p.L922V | | protein_coding | tolerated(0.6) | benign(0.005) | TCGA-AC-A23H-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | PD |
WDR6 | SNV | Missense_Mutation | | c.613N>G | p.Ile205Val | p.I205V | | protein_coding | tolerated(0.36) | benign(0.003) | TCGA-BH-A0HA-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
WDR6 | SNV | Missense_Mutation | rs61732633 | c.2417N>T | p.Ser806Leu | p.S806L | | protein_coding | deleterious(0) | probably_damaging(0.991) | TCGA-BH-A0HF-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | arimidex | SD |
WDR6 | SNV | Missense_Mutation | | c.3394G>C | p.Glu1132Gln | p.E1132Q | | protein_coding | tolerated(0.16) | possibly_damaging(0.857) | TCGA-C8-A26Y-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
WDR6 | SNV | Missense_Mutation | | c.1507N>C | p.Gly503Arg | p.G503R | | protein_coding | tolerated(0.06) | probably_damaging(1) | TCGA-GM-A2DB-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | taxol | CR |
WDR6 | SNV | Missense_Mutation | rs542788663 | c.1960N>A | p.Asp654Asn | p.D654N | | protein_coding | tolerated(0.07) | probably_damaging(0.994) | TCGA-PE-A5DE-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | taxotere | CR |
WDR6 | deletion | Frame_Shift_Del | | c.1342_1370delAAGGTTGTCCCCATCAACACTCCAACTGC | p.Lys448CysfsTer22 | p.K448Cfs*22 | | protein_coding | | | TCGA-B6-A0RS-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD |
WDR6 | deletion | Frame_Shift_Del | novel | c.226delN | p.Phe76LeufsTer7 | p.F76Lfs*7 | | protein_coding | | | TCGA-D8-A27V-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | tamoxiphen | SD |