|
Gene: MFSD4A |
Gene summary for MFSD4A |
Gene summary. |
Gene information | Species | Human | Gene symbol | MFSD4A | Gene ID | 148808 |
Gene name | major facilitator superfamily domain containing 4A | |
Gene Alias | MFSD4 | |
Cytomap | 1q32.1 | |
Gene Type | protein-coding | GO ID | GO:0006810 | UniProtAcc | Q8N468 |
Top |
Malignant transformation analysis |
Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
Malignant transformation involving gene list. |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
148808 | MFSD4A | HTA11_347_2000001011 | Human | Colorectum | AD | 2.93e-05 | 3.57e-01 | -0.1954 |
148808 | MFSD4A | HTA11_411_2000001011 | Human | Colorectum | SER | 5.90e-05 | 8.38e-01 | -0.2602 |
148808 | MFSD4A | HTA11_5212_2000001011 | Human | Colorectum | AD | 2.09e-09 | 9.08e-01 | -0.2061 |
148808 | MFSD4A | RNA-P17T-P17T-2 | Human | Lung | IAC | 1.23e-04 | 5.55e-01 | 0.3371 |
148808 | MFSD4A | RNA-P17T-P17T-6 | Human | Lung | IAC | 2.00e-06 | 6.71e-01 | 0.3385 |
148808 | MFSD4A | RNA-P17T-P17T-8 | Human | Lung | IAC | 1.10e-05 | 5.42e-01 | 0.3329 |
148808 | MFSD4A | RNA-P6T2-P6T2-4 | Human | Lung | IAC | 4.15e-07 | 3.32e-01 | -0.0121 |
Page: 1 |
Transcriptomic changes along malignancy continuum. |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
Figure of enriched GO biological processes. |
Tissue | Disease Stage | Enriched GO biological Processes |
Oral cavity | OSCC | |
Oral cavity | LP | |
Oral cavity | EOLP | |
Oral cavity | NEOLP | |
Esophagus | HGIN |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
Enriched GO biological processes. |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
Enriched KEGG pathways. |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
Annotation of somatic variants for genes involved in malignant transformation |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
MFSD4A | SNV | Missense_Mutation | c.1372T>C | p.Phe458Leu | p.F458L | Q8N468 | protein_coding | tolerated(0.1) | benign(0.012) | TCGA-A8-A06O-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | letrozole | SD | |
MFSD4A | SNV | Missense_Mutation | novel | c.433C>T | p.Leu145Phe | p.L145F | Q8N468 | protein_coding | deleterious(0) | probably_damaging(1) | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
MFSD4A | SNV | Missense_Mutation | c.1446C>G | p.Ile482Met | p.I482M | Q8N468 | protein_coding | tolerated(0.23) | benign(0.352) | TCGA-BH-A209-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
MFSD4A | insertion | Frame_Shift_Ins | novel | c.590_591insGTTAAAATGCAATACCCCTGCAAGCAAG | p.Asp197GlufsTer74 | p.D197Efs*74 | Q8N468 | protein_coding | TCGA-A8-A07Z-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unspecific | Exemestane | SD | ||
MFSD4A | insertion | Frame_Shift_Ins | novel | c.1450_1451insAAGGTTTCAGAACAAGGAAAGGACAAAATGACAG | p.Leu484GlnfsTer38 | p.L484Qfs*38 | Q8N468 | protein_coding | TCGA-AO-A03L-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | cyclophosphamide | SD | ||
MFSD4A | insertion | In_Frame_Ins | novel | c.249_250insTCTGACATTAGACTTTCAGACTGGTCTCAGAAAATACAA | p.Trp83_Ala84insSerAspIleArgLeuSerAspTrpSerGlnLysIleGln | p.W83_A84insSDIRLSDWSQKIQ | Q8N468 | protein_coding | TCGA-AO-A0JB-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | cyclophosphamide | SD | ||
MFSD4A | insertion | In_Frame_Ins | novel | c.1084_1085insCTTTTGTTACCTTGGGCAAGTCACCTGACCTCTCTGAGCCTT | p.Gly362delinsAlaPheValThrLeuGlyLysSerProAspLeuSerGluProCys | p.G362delinsAFVTLGKSPDLSEPC | Q8N468 | protein_coding | TCGA-BH-A0HF-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | arimidex | SD | ||
MFSD4A | SNV | Missense_Mutation | rs201257048 | c.614C>T | p.Thr205Met | p.T205M | Q8N468 | protein_coding | deleterious(0.01) | possibly_damaging(0.79) | TCGA-2W-A8YY-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
MFSD4A | SNV | Missense_Mutation | c.781G>A | p.Asp261Asn | p.D261N | Q8N468 | protein_coding | tolerated(0.06) | probably_damaging(0.971) | TCGA-MY-A5BD-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR | |
MFSD4A | deletion | Frame_Shift_Del | novel | c.1498_1537delCAAGACAGATCAATTGGAATGGAAAACTCTGAGTGCTACC | p.Gln500ArgfsTer6 | p.Q500Rfs*6 | Q8N468 | protein_coding | TCGA-C5-A3HD-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | SD |
Page: 1 2 3 4 5 |
Top |
Related drugs of malignant transformation related genes |
Identification of chemicals and drugs interact with genes involved in malignant transfromation |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |