![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: LONRF2 |
Gene summary for LONRF2 |
![]() |
Gene information | Species | Human | Gene symbol | LONRF2 | Gene ID | 164832 |
Gene name | LON peptidase N-terminal domain and ring finger 2 | |
Gene Alias | RNF192 | |
Cytomap | 2q11.2 | |
Gene Type | protein-coding | GO ID | GO:0003674 | UniProtAcc | Q1L5Z9 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
164832 | LONRF2 | HTA12-15-2 | Human | Pancreas | PDAC | 5.50e-06 | 5.71e-01 | 0.2315 |
164832 | LONRF2 | HTA12-23-1 | Human | Pancreas | PDAC | 1.72e-06 | 8.41e-01 | 0.3405 |
164832 | LONRF2 | HTA12-25-1 | Human | Pancreas | PDAC | 3.32e-03 | 5.46e-01 | 0.313 |
164832 | LONRF2 | HTA12-26-1 | Human | Pancreas | PDAC | 4.09e-29 | 1.19e+00 | 0.3728 |
164832 | LONRF2 | HTA12-29-1 | Human | Pancreas | PDAC | 5.66e-47 | 1.04e+00 | 0.3722 |
164832 | LONRF2 | PTCwithHT_8 | Human | Thyroid | HT | 1.09e-02 | -1.33e-01 | 0.0351 |
164832 | LONRF2 | male-WTA | Human | Thyroid | PTC | 9.44e-39 | 4.65e-01 | 0.1037 |
164832 | LONRF2 | PTC01 | Human | Thyroid | PTC | 1.29e-31 | 1.15e+00 | 0.1899 |
164832 | LONRF2 | PTC03 | Human | Thyroid | PTC | 3.69e-06 | 5.88e-01 | 0.1784 |
164832 | LONRF2 | PTC04 | Human | Thyroid | PTC | 4.52e-38 | 1.10e+00 | 0.1927 |
164832 | LONRF2 | PTC05 | Human | Thyroid | PTC | 1.17e-33 | 1.83e+00 | 0.2065 |
164832 | LONRF2 | PTC06 | Human | Thyroid | PTC | 1.34e-82 | 2.56e+00 | 0.2057 |
164832 | LONRF2 | PTC07 | Human | Thyroid | PTC | 1.24e-85 | 2.02e+00 | 0.2044 |
164832 | LONRF2 | ATC12 | Human | Thyroid | ATC | 1.09e-02 | -1.39e-01 | 0.34 |
164832 | LONRF2 | ATC13 | Human | Thyroid | ATC | 6.23e-21 | 1.54e-01 | 0.34 |
164832 | LONRF2 | ATC5 | Human | Thyroid | ATC | 6.69e-15 | 1.67e-01 | 0.34 |
Page: 1 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Thyroid | ![]() | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis | ||
PTC: Papillary thyroid cancer |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Oral cavity | OSCC | ![]() |
Oral cavity | LP | ![]() |
Oral cavity | EOLP | ![]() |
Oral cavity | NEOLP | ![]() |
Esophagus | HGIN | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
LONRF2 | SNV | Missense_Mutation | c.1604C>A | p.Thr535Asn | p.T535N | Q1L5Z9 | protein_coding | tolerated(1) | benign(0.084) | TCGA-AR-A0U0-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
LONRF2 | SNV | Missense_Mutation | c.2038N>T | p.Gly680Trp | p.G680W | Q1L5Z9 | protein_coding | deleterious(0) | probably_damaging(1) | TCGA-BH-A0DK-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | tamoxiphen | SD | |
LONRF2 | SNV | Missense_Mutation | c.775N>G | p.Gln259Glu | p.Q259E | Q1L5Z9 | protein_coding | deleterious(0.02) | benign(0.407) | TCGA-D8-A1XQ-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
LONRF2 | SNV | Missense_Mutation | c.1563G>C | p.Lys521Asn | p.K521N | Q1L5Z9 | protein_coding | deleterious(0) | possibly_damaging(0.596) | TCGA-D8-A27G-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | |
LONRF2 | SNV | Missense_Mutation | c.1994C>G | p.Ala665Gly | p.A665G | Q1L5Z9 | protein_coding | tolerated(0.33) | benign(0.378) | TCGA-OL-A66I-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR | |
LONRF2 | deletion | Frame_Shift_Del | c.1764_1807delAGAGTATGGATGCATGCTGGAGATTAAGGACGTGAGAACGTTTC | p.Glu589Ter | p.E589* | Q1L5Z9 | protein_coding | TCGA-A2-A04T-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | cyclophosphamide | SD | |||
LONRF2 | SNV | Missense_Mutation | rs760683755 | c.1993N>A | p.Ala665Thr | p.A665T | Q1L5Z9 | protein_coding | tolerated(1) | benign(0.01) | TCGA-C5-A1MK-01 | Cervix | cervical & endocervical cancer | Female | >=65 | III/IV | Chemotherapy | carboplatin | PD |
LONRF2 | SNV | Missense_Mutation | c.713C>T | p.Ala238Val | p.A238V | Q1L5Z9 | protein_coding | tolerated(0.08) | possibly_damaging(0.826) | TCGA-EK-A2PG-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Unknown | Unknown | SD | |
LONRF2 | SNV | Missense_Mutation | rs143848902 | c.1795N>A | p.Val599Met | p.V599M | Q1L5Z9 | protein_coding | deleterious(0) | probably_damaging(0.997) | TCGA-EK-A2PL-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Unknown | Unknown | SD |
LONRF2 | SNV | Missense_Mutation | c.1303N>A | p.Glu435Lys | p.E435K | Q1L5Z9 | protein_coding | tolerated(0.85) | benign(0.001) | TCGA-IR-A3LK-01 | Cervix | cervical & endocervical cancer | Female | >=65 | I/II | Chemotherapy | cisplatin | PD |
Page: 1 2 3 4 5 6 7 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |