![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: CCDC175 |
Gene summary for CCDC175 |
![]() |
Gene information | Species | Human | Gene symbol | CCDC175 | Gene ID | 729665 |
Gene name | coiled-coil domain containing 175 | |
Gene Alias | C14orf38 | |
Cytomap | 14q23.1 | |
Gene Type | protein-coding | GO ID | NA | UniProtAcc | P0C221 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
729665 | CCDC175 | F072B | Human | Colorectum | FAP | 2.34e-07 | 5.51e-01 | 0.257 |
Page: 1 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Cervix | N_HPV | ![]() |
Endometrium | AEH | ![]() |
Endometrium | EEC | ![]() |
Prostate | BPH | ![]() |
Prostate | Tumor | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
CCDC175 | SNV | Missense_Mutation | novel | c.676N>C | p.Glu226Gln | p.E226Q | P0C221 | protein_coding | tolerated(0.34) | benign(0.024) | TCGA-A2-A0CR-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | CR |
CCDC175 | SNV | Missense_Mutation | c.1722N>C | p.Glu574Asp | p.E574D | P0C221 | protein_coding | tolerated(0.37) | benign(0.003) | TCGA-AC-A23H-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | PD | |
CCDC175 | SNV | Missense_Mutation | rs769689516 | c.985N>T | p.Asp329Tyr | p.D329Y | P0C221 | protein_coding | deleterious(0.01) | probably_damaging(0.91) | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
CCDC175 | SNV | Missense_Mutation | novel | c.199N>A | p.Ala67Thr | p.A67T | P0C221 | protein_coding | tolerated(0.06) | possibly_damaging(0.838) | TCGA-AN-A0XW-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |
CCDC175 | SNV | Missense_Mutation | c.653N>G | p.Glu218Gly | p.E218G | P0C221 | protein_coding | tolerated(0.06) | benign(0.015) | TCGA-B6-A0RV-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD | |
CCDC175 | SNV | Missense_Mutation | novel | c.119N>T | p.Ser40Leu | p.S40L | P0C221 | protein_coding | deleterious(0) | possibly_damaging(0.506) | TCGA-D8-A73U-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | tamoxiphen | SD |
CCDC175 | SNV | Missense_Mutation | rs112952088 | c.883N>A | p.Glu295Lys | p.E295K | P0C221 | protein_coding | tolerated(0.07) | possibly_damaging(0.506) | TCGA-E2-A14S-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | cytoxan | SD |
CCDC175 | SNV | Missense_Mutation | c.1142N>A | p.Ala381Asp | p.A381D | P0C221 | protein_coding | tolerated(0.06) | benign(0.268) | TCGA-E2-A1L9-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | cytoxan | SD | |
CCDC175 | insertion | Frame_Shift_Ins | novel | c.1376_1377insCAGGCCAGGTGCAGTGGCTCAGGCCAGTAATC | p.Met459IlefsTer15 | p.M459Ifs*15 | P0C221 | protein_coding | TCGA-A2-A0EO-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | tamoxiphen | SD | ||
CCDC175 | deletion | Frame_Shift_Del | novel | c.1662_1684delGGAAGAAGAACTAGTTGAGTATC | p.Lys554AsnfsTer12 | p.K554Nfs*12 | P0C221 | protein_coding | TCGA-AR-A0TU-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Doxorubicin | SD |
Page: 1 2 3 4 5 6 7 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |