![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: TMEM87B |
Gene summary for TMEM87B |
![]() |
Gene information | Species | Human | Gene symbol | TMEM87B | Gene ID | 84910 |
Gene name | transmembrane protein 87B | |
Gene Alias | TMEM87B | |
Cytomap | 2q13 | |
Gene Type | protein-coding | GO ID | GO:0006810 | UniProtAcc | Q96K49 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
84910 | TMEM87B | CCI_2 | Human | Cervix | CC | 3.20e-04 | 5.80e-01 | 0.5249 |
84910 | TMEM87B | CCI_3 | Human | Cervix | CC | 2.85e-03 | 5.32e-01 | 0.516 |
84910 | TMEM87B | HTA11_3410_2000001011 | Human | Colorectum | AD | 1.40e-03 | -3.18e-01 | 0.0155 |
84910 | TMEM87B | HTA11_347_2000001011 | Human | Colorectum | AD | 1.47e-04 | 4.26e-01 | -0.1954 |
84910 | TMEM87B | F007 | Human | Colorectum | FAP | 3.52e-02 | -1.84e-01 | 0.1176 |
84910 | TMEM87B | A002-C-010 | Human | Colorectum | FAP | 1.09e-04 | -1.80e-01 | 0.242 |
84910 | TMEM87B | A001-C-207 | Human | Colorectum | FAP | 1.03e-04 | -2.45e-01 | 0.1278 |
84910 | TMEM87B | A015-C-203 | Human | Colorectum | FAP | 5.70e-24 | -3.56e-01 | -0.1294 |
84910 | TMEM87B | A015-C-204 | Human | Colorectum | FAP | 5.38e-07 | -3.77e-01 | -0.0228 |
84910 | TMEM87B | A014-C-040 | Human | Colorectum | FAP | 3.73e-03 | -3.42e-01 | -0.1184 |
84910 | TMEM87B | A002-C-201 | Human | Colorectum | FAP | 2.22e-12 | -2.74e-01 | 0.0324 |
84910 | TMEM87B | A002-C-203 | Human | Colorectum | FAP | 9.19e-04 | -1.41e-01 | 0.2786 |
84910 | TMEM87B | A001-C-119 | Human | Colorectum | FAP | 4.60e-11 | -5.10e-01 | -0.1557 |
84910 | TMEM87B | A001-C-108 | Human | Colorectum | FAP | 6.81e-15 | -3.38e-01 | -0.0272 |
84910 | TMEM87B | A002-C-205 | Human | Colorectum | FAP | 1.52e-18 | -3.48e-01 | -0.1236 |
84910 | TMEM87B | A001-C-104 | Human | Colorectum | FAP | 4.41e-04 | -1.80e-01 | 0.0184 |
84910 | TMEM87B | A015-C-005 | Human | Colorectum | FAP | 8.12e-05 | -2.30e-01 | -0.0336 |
84910 | TMEM87B | A015-C-006 | Human | Colorectum | FAP | 1.46e-16 | -5.04e-01 | -0.0994 |
84910 | TMEM87B | A015-C-106 | Human | Colorectum | FAP | 5.86e-11 | -3.13e-01 | -0.0511 |
84910 | TMEM87B | A002-C-114 | Human | Colorectum | FAP | 1.68e-17 | -3.79e-01 | -0.1561 |
Page: 1 2 3 4 5 6 7 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Breast | Precancer | ![]() |
Breast | IDC | ![]() |
Breast | DCIS | ![]() |
Cervix | CC | ![]() |
Cervix | HSIL_HPV | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00161977 | Cervix | CC | endosomal transport | 48/2311 | 230/18723 | 1.65e-04 | 1.97e-03 | 48 |
GO:00164827 | Cervix | CC | cytosolic transport | 33/2311 | 168/18723 | 4.43e-03 | 2.70e-02 | 33 |
GO:0016197 | Colorectum | AD | endosomal transport | 90/3918 | 230/18723 | 1.88e-10 | 1.73e-08 | 90 |
GO:0016482 | Colorectum | AD | cytosolic transport | 68/3918 | 168/18723 | 6.00e-09 | 3.72e-07 | 68 |
GO:0042147 | Colorectum | AD | retrograde transport, endosome to Golgi | 37/3918 | 91/18723 | 1.46e-05 | 3.14e-04 | 37 |
GO:00164823 | Colorectum | FAP | cytosolic transport | 47/2622 | 168/18723 | 1.58e-06 | 6.72e-05 | 47 |
GO:00161973 | Colorectum | FAP | endosomal transport | 56/2622 | 230/18723 | 1.79e-05 | 4.53e-04 | 56 |
GO:00421472 | Colorectum | FAP | retrograde transport, endosome to Golgi | 26/2622 | 91/18723 | 2.21e-04 | 3.14e-03 | 26 |
GO:00164824 | Colorectum | CRC | cytosolic transport | 45/2078 | 168/18723 | 1.22e-08 | 2.52e-06 | 45 |
GO:00161974 | Colorectum | CRC | endosomal transport | 49/2078 | 230/18723 | 5.07e-06 | 2.05e-04 | 49 |
GO:00421473 | Colorectum | CRC | retrograde transport, endosome to Golgi | 24/2078 | 91/18723 | 3.88e-05 | 9.49e-04 | 24 |
GO:001619710 | Esophagus | HGIN | endosomal transport | 57/2587 | 230/18723 | 5.74e-06 | 1.81e-04 | 57 |
GO:001619715 | Esophagus | ESCC | endosomal transport | 168/8552 | 230/18723 | 2.28e-17 | 1.93e-15 | 168 |
GO:001648210 | Esophagus | ESCC | cytosolic transport | 124/8552 | 168/18723 | 9.69e-14 | 4.69e-12 | 124 |
GO:00421477 | Esophagus | ESCC | retrograde transport, endosome to Golgi | 63/8552 | 91/18723 | 4.58e-06 | 4.87e-05 | 63 |
GO:001619721 | Liver | HCC | endosomal transport | 154/7958 | 230/18723 | 4.74e-14 | 2.95e-12 | 154 |
GO:001648221 | Liver | HCC | cytosolic transport | 117/7958 | 168/18723 | 8.83e-13 | 4.48e-11 | 117 |
GO:004214721 | Liver | HCC | retrograde transport, endosome to Golgi | 61/7958 | 91/18723 | 1.94e-06 | 2.68e-05 | 61 |
GO:00161979 | Oral cavity | OSCC | endosomal transport | 141/7305 | 230/18723 | 5.40e-12 | 2.06e-10 | 141 |
GO:00164829 | Oral cavity | OSCC | cytosolic transport | 106/7305 | 168/18723 | 2.08e-10 | 5.90e-09 | 106 |
Page: 1 2 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
TMEM87B | SNV | Missense_Mutation | c.1652N>T | p.Ser551Leu | p.S551L | Q96K49 | protein_coding | deleterious_low_confidence(0) | probably_damaging(0.966) | TCGA-A8-A0A7-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
TMEM87B | SNV | Missense_Mutation | novel | c.1037N>A | p.Ser346Tyr | p.S346Y | Q96K49 | protein_coding | deleterious(0.03) | benign(0.285) | TCGA-AN-A046-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TMEM87B | SNV | Missense_Mutation | rs774828905 | c.1185N>A | p.Phe395Leu | p.F395L | Q96K49 | protein_coding | deleterious(0.03) | probably_damaging(0.947) | TCGA-BH-A0GZ-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | arimidex | SD |
TMEM87B | SNV | Missense_Mutation | c.734N>C | p.Ile245Thr | p.I245T | Q96K49 | protein_coding | deleterious(0.01) | possibly_damaging(0.646) | TCGA-BH-A0HF-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | arimidex | SD | |
TMEM87B | insertion | Frame_Shift_Ins | novel | c.861_862insGAGTT | p.Ile290SerfsTer2 | p.I290Sfs*2 | Q96K49 | protein_coding | TCGA-AC-A8OQ-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD | ||
TMEM87B | deletion | Frame_Shift_Del | novel | c.863_894delAGTTGATTTCTGCGATTAAGAGGACGTTGGCT | p.Glu288AlafsTer39 | p.E288Afs*39 | Q96K49 | protein_coding | TCGA-E2-A573-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | taxotere | CR | ||
TMEM87B | SNV | Missense_Mutation | rs755041108 | c.245N>T | p.Ser82Phe | p.S82F | Q96K49 | protein_coding | deleterious(0.03) | benign(0.438) | TCGA-EK-A2RM-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Unknown | Unknown | SD |
TMEM87B | SNV | Missense_Mutation | novel | c.1420G>C | p.Glu474Gln | p.E474Q | Q96K49 | protein_coding | tolerated(0.33) | benign(0.347) | TCGA-HM-A4S6-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | CR |
TMEM87B | SNV | Missense_Mutation | novel | c.1540T>C | p.Trp514Arg | p.W514R | Q96K49 | protein_coding | deleterious(0.02) | probably_damaging(0.96) | TCGA-AA-3950-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
TMEM87B | SNV | Missense_Mutation | c.1297N>A | p.Asp433Asn | p.D433N | Q96K49 | protein_coding | deleterious(0) | possibly_damaging(0.905) | TCGA-AA-A010-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Chemotherapy | folinic | CR |
Page: 1 2 3 4 5 6 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |