![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: HPDL |
Gene summary for HPDL |
![]() |
Gene information | Species | Human | Gene symbol | HPDL | Gene ID | 84842 |
Gene name | 4-hydroxyphenylpyruvate dioxygenase like | |
Gene Alias | 4-HPPD-L | |
Cytomap | 1p34.1 | |
Gene Type | protein-coding | GO ID | GO:0006082 | UniProtAcc | Q96IR7 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
84842 | HPDL | LZE24T | Human | Esophagus | ESCC | 6.29e-04 | 2.00e-01 | 0.0596 |
84842 | HPDL | P2T-E | Human | Esophagus | ESCC | 2.20e-03 | 6.15e-02 | 0.1177 |
84842 | HPDL | P5T-E | Human | Esophagus | ESCC | 1.50e-08 | 1.73e-01 | 0.1327 |
84842 | HPDL | P21T-E | Human | Esophagus | ESCC | 2.94e-14 | 2.73e-01 | 0.1617 |
84842 | HPDL | P23T-E | Human | Esophagus | ESCC | 4.97e-06 | 1.72e-01 | 0.108 |
84842 | HPDL | P24T-E | Human | Esophagus | ESCC | 1.12e-08 | 1.83e-01 | 0.1287 |
84842 | HPDL | P27T-E | Human | Esophagus | ESCC | 5.13e-04 | 1.06e-01 | 0.1055 |
84842 | HPDL | P28T-E | Human | Esophagus | ESCC | 2.59e-12 | 2.29e-01 | 0.1149 |
84842 | HPDL | P31T-E | Human | Esophagus | ESCC | 4.66e-12 | 2.53e-01 | 0.1251 |
84842 | HPDL | P32T-E | Human | Esophagus | ESCC | 7.36e-07 | 1.64e-01 | 0.1666 |
84842 | HPDL | P36T-E | Human | Esophagus | ESCC | 7.72e-03 | 1.33e-01 | 0.1187 |
84842 | HPDL | P37T-E | Human | Esophagus | ESCC | 1.24e-04 | 1.64e-01 | 0.1371 |
84842 | HPDL | P54T-E | Human | Esophagus | ESCC | 3.57e-04 | 1.58e-01 | 0.0975 |
84842 | HPDL | P62T-E | Human | Esophagus | ESCC | 5.58e-03 | 9.51e-02 | 0.1302 |
84842 | HPDL | P74T-E | Human | Esophagus | ESCC | 4.95e-14 | 3.61e-01 | 0.1479 |
84842 | HPDL | P75T-E | Human | Esophagus | ESCC | 6.17e-11 | 2.65e-01 | 0.1125 |
84842 | HPDL | P76T-E | Human | Esophagus | ESCC | 1.19e-10 | 2.16e-01 | 0.1207 |
84842 | HPDL | P79T-E | Human | Esophagus | ESCC | 3.39e-05 | 1.95e-01 | 0.1154 |
84842 | HPDL | P80T-E | Human | Esophagus | ESCC | 4.88e-05 | 1.92e-01 | 0.155 |
84842 | HPDL | P82T-E | Human | Esophagus | ESCC | 6.28e-04 | 2.20e-01 | 0.1072 |
Page: 1 2 |
![]() |
Tissue | Expression Dynamics | Abbreviation |
Esophagus | ![]() | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias | ||
LGIN: Low-grade intraepithelial neoplasias |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Breast | Precancer | ![]() |
Breast | IDC | ![]() |
Breast | DCIS | ![]() |
Cervix | CC | ![]() |
Cervix | HSIL_HPV | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
Page: 1 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
HPDL | SNV | Missense_Mutation | c.888N>C | p.Gln296His | p.Q296H | Q96IR7 | protein_coding | deleterious(0) | possibly_damaging(0.892) | TCGA-B6-A0RE-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
HPDL | deletion | Frame_Shift_Del | novel | c.131_150delAGCTAGCCCTGCGCAGCGGC | p.Gln44ArgfsTer145 | p.Q44Rfs*145 | Q96IR7 | protein_coding | TCGA-AC-A4ZE-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | ||
HPDL | SNV | Missense_Mutation | novel | c.322C>G | p.Arg108Gly | p.R108G | Q96IR7 | protein_coding | tolerated(0.28) | benign(0.021) | TCGA-VS-A958-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
HPDL | SNV | Missense_Mutation | novel | c.38N>C | p.Phe13Ser | p.F13S | Q96IR7 | protein_coding | deleterious(0) | possibly_damaging(0.881) | TCGA-AA-3811-01 | Colorectum | colon adenocarcinoma | Female | >=65 | III/IV | Unknown | Unknown | PD |
HPDL | SNV | Missense_Mutation | novel | c.403C>T | p.Arg135Cys | p.R135C | Q96IR7 | protein_coding | deleterious(0.05) | probably_damaging(0.991) | TCGA-T9-A92H-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
HPDL | SNV | Missense_Mutation | c.614C>T | p.Ala205Val | p.A205V | Q96IR7 | protein_coding | tolerated(0.25) | benign(0.003) | TCGA-WS-AB45-01 | Colorectum | colon adenocarcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
HPDL | SNV | Missense_Mutation | c.605A>G | p.Glu202Gly | p.E202G | Q96IR7 | protein_coding | tolerated(0.32) | benign(0.345) | TCGA-AP-A056-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD | |
HPDL | SNV | Missense_Mutation | rs774472385 | c.1112N>T | p.Ala371Val | p.A371V | Q96IR7 | protein_coding | deleterious_low_confidence(0) | benign(0.087) | TCGA-AP-A059-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
HPDL | SNV | Missense_Mutation | rs147652653 | c.746N>T | p.Ala249Val | p.A249V | Q96IR7 | protein_coding | tolerated(0.21) | benign(0.142) | TCGA-AP-A1DK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
HPDL | SNV | Missense_Mutation | c.532N>T | p.Arg178Cys | p.R178C | Q96IR7 | protein_coding | deleterious(0.01) | benign(0.144) | TCGA-AX-A1C4-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |