Schematic overview of the cellular and molecular mechanisms involved in the cancer progression, including the proposed cellular and molecular mechanisms in cancer cells trajectory. AT1: alveolar type 1 cells; AT2: alveolar type 2 cells; AAH: atypical adenomatous hyperplasia; AIS: adenocarcinoma in situ; MIA: minimally invasive adenocarcinoma; IA: invasive adenocarcinoma; EMT: epithelial-mesenchymal transition

Home

Download

Statistics

Help

Contact

Center for Computational Systems Medicine
leaf

Gene summary

leaf

Malignant transformation analysis

leaf

Malignant transformation related pathway analysis

leaf

Cell-cell communication analysis

leaf

Single-cell gene regulatory network inference analysis

leaf

Somatic mutation of malignant transformation related genes

leaf

Related drugs of malignant transformation related genes

Gene: APOC1

Gene summary for APOC1

check button Gene summary.

Gene informationSpeciesHuman
Gene symbol

APOC1

Gene ID

341

Gene nameapolipoprotein C1
Gene AliasApo-CI
Cytomap19q13.32
Gene Typeprotein-coding
GO ID

GO:0006082

UniProtAcc

A0A024R0T8


Top

Malignant transformation analysis

check button Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells
check button Malignant transformation involving gene list.
Entrez IDSymbolReplicatesSpeciesOrganTissueAdj P-valueLog2FCMalignancy
341APOC1GSM4909299HumanBreastIDC2.52e-052.81e-010.035
341APOC1GSM4909312HumanBreastIDC1.48e-02-1.11e-010.1552
341APOC1GSM4909319HumanBreastIDC3.70e-03-5.44e-020.1563
341APOC1NCCBC14HumanBreastDCIS6.92e-231.05e+000.2021
341APOC1NCCBC2HumanBreastDCIS4.75e-024.26e-010.1554
341APOC1NCCBC3HumanBreastDCIS2.68e-349.19e-010.1198
341APOC1NCCBC5HumanBreastDCIS1.67e-251.02e+000.2046
341APOC1P1HumanBreastIDC1.81e-032.74e-010.1527
341APOC1DCIS2HumanBreastDCIS1.39e-07-4.99e-020.0085
341APOC1LZE21THumanEsophagusESCC6.52e-072.62e-010.0655
341APOC1LZE6THumanEsophagusESCC1.04e-045.54e-010.0845
341APOC1P2T-EHumanEsophagusESCC5.91e-048.41e-020.1177
341APOC1P4T-EHumanEsophagusESCC4.19e-145.17e-010.1323
341APOC1P5T-EHumanEsophagusESCC2.85e-102.42e-010.1327
341APOC1P8T-EHumanEsophagusESCC1.48e-051.50e-010.0889
341APOC1P10T-EHumanEsophagusESCC2.04e-347.39e-010.116
341APOC1P12T-EHumanEsophagusESCC4.14e-163.75e-010.1122
341APOC1P15T-EHumanEsophagusESCC2.35e-021.03e-010.1149
341APOC1P22T-EHumanEsophagusESCC1.83e-183.73e-010.1236
341APOC1P24T-EHumanEsophagusESCC2.25e-031.35e-010.1287
Page: 1 2 3 4 5 

check button Transcriptomic changes along malignancy continuum.
TissueExpression DynamicsAbbreviation
BreastThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.IDC: Invasive ductal carcinoma
DCIS: Ductal carcinoma in situ
Precancer(BRCA1-mut): Precancerous lesion from BRCA1 mutation carriers
EsophagusThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ESCC: Esophageal squamous cell carcinoma
HGIN: High-grade intraepithelial neoplasias
LGIN: Low-grade intraepithelial neoplasias
LiverThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.HCC: Hepatocellular carcinoma
NAFLD: Non-alcoholic fatty liver disease
Oral CavityThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.EOLP: Erosive Oral lichen planus
LP: leukoplakia
NEOLP: Non-erosive oral lichen planus
OSCC: Oral squamous cell carcinoma
SkinThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.AK: Actinic keratosis
cSCC: Cutaneous squamous cell carcinoma
SCCIS:squamous cell carcinoma in situ
ThyroidThe image shows the transcriptomic changes along malignancy continuum.log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.ATC: Anaplastic thyroid cancer
HT: Hashimoto's thyroiditis
PTC: Papillary thyroid cancer
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage.

Top

Malignant transformation related pathway analysis

check buttonFind out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer
check button Figure of enriched GO biological processes.
TissueDisease StageEnriched GO biological Processes
LiverCystGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
LungIACGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
LungAISGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
LungAAHGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
LungMIACGO analysis - Figure of enriched GO biological processes: Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust).
Page: 1 2 3 4 5 6 7 8 9 

check button Enriched GO biological processes.
GO IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustCount
GO:005134613BreastIDCnegative regulation of hydrolase activity71/1434379/187231.33e-122.90e-1071
GO:001921612BreastIDCregulation of lipid metabolic process45/1434331/187231.21e-042.24e-0345
GO:003133014BreastIDCnegative regulation of cellular catabolic process37/1434262/187232.20e-043.52e-0337
GO:000689813BreastIDCreceptor-mediated endocytosis35/1434244/187232.38e-043.75e-0335
GO:00192184BreastIDCregulation of steroid metabolic process18/1434100/187235.40e-046.96e-0318
GO:00468904BreastIDCregulation of lipid biosynthetic process26/1434171/187235.92e-047.50e-0326
GO:00459369BreastIDCnegative regulation of phosphate metabolic process53/1434441/187237.21e-048.79e-0353
GO:00105639BreastIDCnegative regulation of phosphorus metabolic process53/1434442/187237.60e-049.25e-0353
GO:000989514BreastIDCnegative regulation of catabolic process40/1434320/187231.49e-031.50e-0240
GO:007233012BreastIDCmonocarboxylic acid biosynthetic process29/1434214/187231.91e-031.83e-0229
GO:001605313BreastIDCorganic acid biosynthetic process39/1434316/187232.13e-031.99e-0239
GO:000663312BreastIDCfatty acid biosynthetic process23/1434163/187233.21e-032.70e-0223
GO:004639413BreastIDCcarboxylic acid biosynthetic process38/1434314/187233.39e-032.83e-0238
GO:004230411BreastIDCregulation of fatty acid biosynthetic process10/143449/187233.51e-032.90e-0210
GO:00301007BreastIDCregulation of endocytosis27/1434211/187235.92e-034.26e-0227
GO:005134623BreastDCISnegative regulation of hydrolase activity64/1390379/187234.32e-104.80e-0864
GO:003133024BreastDCISnegative regulation of cellular catabolic process37/1390262/187231.18e-042.07e-0337
GO:000689823BreastDCISreceptor-mediated endocytosis35/1390244/187231.31e-042.25e-0335
GO:001921621BreastDCISregulation of lipid metabolic process43/1390331/187232.37e-043.71e-0343
GO:004593614BreastDCISnegative regulation of phosphate metabolic process53/1390441/187233.48e-044.96e-0353
Page: 1 2 3 4 5 6 7 8 9 10 11 

check button Enriched KEGG pathways.
Pathway IDTissueDisease StageDescriptionGene RatioBg Ratiopvaluep.adjustqvalueCount
hsa049792LiverCirrhoticCholesterol metabolism30/253051/84651.59e-051.39e-048.60e-0530
hsa049793LiverCirrhoticCholesterol metabolism30/253051/84651.59e-051.39e-048.60e-0530
hsa049794LiverHCCCholesterol metabolism41/402051/84651.33e-061.35e-057.49e-0641
hsa049795LiverHCCCholesterol metabolism41/402051/84651.33e-061.35e-057.49e-0641
Page: 1 

Top

Cell-cell communication analysis

check buttonIdentification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states
LigandReceptorLRpairPathwayTissueDisease Stage
Page: 1 

Top

Single-cell gene regulatory network inference analysis

check buttonFind out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states
TFCell TypeTissueDisease StageTarget GeneRSSRegulon Activity
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression.
Page: 1 

Top

Somatic mutation of malignant transformation related genes

check buttonAnnotation of somatic variants for genes involved in malignant transformation
Hugo SymbolVariant ClassVariant ClassificationdbSNP RSHGVScHGVSpHGVSp ShortSWISSPROTBIOTYPESIFTPolyPhenTumor Sample BarcodeTissueHistologySexAgeStageTherapy TypesDrugsOutcome
APOC1insertionFrame_Shift_Insnovelc.172_194+17dupAGTGAACTTTCTGCCAAGATGCGGTTAGAACCCTTCCCAGP02654protein_codingTCGA-VS-A94X-01Cervixcervical & endocervical cancerFemale<65I/IIChemotherapycisplatinPD
APOC1SNVMissense_Mutationrs369438021c.161G>Ap.Arg54Hisp.R54HP02654protein_codingtolerated(0.63)benign(0)TCGA-AP-A0LM-01Endometriumuterine corpus endometrioid carcinomaFemale<65III/IVChemotherapycisplatinSD
APOC1SNVMissense_Mutationc.224N>Cp.Val75Alap.V75AP02654protein_codingdeleterious(0.01)benign(0.031)TCGA-BS-A0UJ-01Endometriumuterine corpus endometrioid carcinomaFemale>=65I/IIUnknownUnknownSD
APOC1SNVMissense_Mutationc.205N>Cp.Ser69Prop.S69PP02654protein_codingdeleterious(0.01)benign(0.005)TCGA-D1-A16X-01Endometriumuterine corpus endometrioid carcinomaFemale<65I/IIUnknownUnknownSD
APOC1SNVMissense_Mutationnovelc.86N>Gp.Asp29Glyp.D29GP02654protein_codingdeleterious(0.04)benign(0.076)TCGA-XR-A8TD-01Liverliver hepatocellular carcinomaFemale<65III/IVUnknownUnknownSD
APOC1SNVMissense_Mutationnovelc.194G>Tp.Arg65Leup.R65LP02654protein_codingdeleterious(0.01)possibly_damaging(0.689)TCGA-55-7907-01Lunglung adenocarcinomaMale>=65I/IIUnknownUnknownPD
APOC1SNVMissense_Mutationnovelc.113A>Gp.Lys38Argp.K38RP02654protein_codingdeleterious(0.03)probably_damaging(0.969)TCGA-95-7567-01Lunglung adenocarcinomaMale<65I/IIChemotherapycisplatinSD
APOC1SNVMissense_Mutationrs760666016c.156N>Gp.Ile52Metp.I52MP02654protein_codingdeleterious(0.01)possibly_damaging(0.546)TCGA-CR-7394-01Oral cavityhead & neck squamous cell carcinomaMale>=65I/IIUnknownUnknownSD
APOC1SNVMissense_Mutationnovelc.114G>Tp.Lys38Asnp.K38NP02654protein_codingdeleterious(0.01)probably_damaging(0.99)TCGA-XK-AAIW-01Prostateprostate adenocarcinomaMale>=659UnknownUnknownPD
Page: 1 

Top

Related drugs of malignant transformation related genes

check buttonIdentification of chemicals and drugs interact with genes involved in malignant transfromation
(DGIdb 4.0)
Entrez IDSymbolCategoryInteraction TypesDrug Claim NameDrug NamePMIDs
Page: 1