|
Gene: P3H3 |
Gene summary for P3H3 |
Gene summary. |
Gene information | Species | Human | Gene symbol | P3H3 | Gene ID | 10536 |
Gene name | prolyl 3-hydroxylase 3 | |
Gene Alias | GRCB | |
Cytomap | 12p13.31 | |
Gene Type | protein-coding | GO ID | GO:0006464 | UniProtAcc | Q8IVL6 |
Top |
Malignant transformation analysis |
Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
Malignant transformation involving gene list. |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
10536 | P3H3 | male-WTA | Human | Thyroid | PTC | 3.40e-05 | 1.46e-01 | 0.1037 |
10536 | P3H3 | PTC01 | Human | Thyroid | PTC | 3.83e-07 | 1.89e-01 | 0.1899 |
10536 | P3H3 | PTC04 | Human | Thyroid | PTC | 6.92e-05 | 1.26e-01 | 0.1927 |
10536 | P3H3 | PTC05 | Human | Thyroid | PTC | 1.26e-11 | 3.43e-01 | 0.2065 |
10536 | P3H3 | PTC06 | Human | Thyroid | PTC | 1.23e-15 | 3.33e-01 | 0.2057 |
10536 | P3H3 | PTC07 | Human | Thyroid | PTC | 6.64e-14 | 2.97e-01 | 0.2044 |
10536 | P3H3 | ATC09 | Human | Thyroid | ATC | 5.36e-33 | 1.07e+00 | 0.2871 |
10536 | P3H3 | ATC11 | Human | Thyroid | ATC | 9.94e-09 | 5.90e-01 | 0.3386 |
10536 | P3H3 | ATC12 | Human | Thyroid | ATC | 5.61e-58 | 1.21e+00 | 0.34 |
10536 | P3H3 | ATC13 | Human | Thyroid | ATC | 4.63e-28 | 5.48e-01 | 0.34 |
10536 | P3H3 | ATC1 | Human | Thyroid | ATC | 2.97e-33 | 1.12e+00 | 0.2878 |
10536 | P3H3 | ATC2 | Human | Thyroid | ATC | 8.57e-18 | 1.16e+00 | 0.34 |
10536 | P3H3 | ATC3 | Human | Thyroid | ATC | 2.85e-21 | 7.78e-01 | 0.338 |
10536 | P3H3 | ATC4 | Human | Thyroid | ATC | 5.44e-75 | 1.39e+00 | 0.34 |
10536 | P3H3 | ATC5 | Human | Thyroid | ATC | 4.07e-31 | 6.20e-01 | 0.34 |
Page: 1 |
Transcriptomic changes along malignancy continuum. |
Tissue | Expression Dynamics | Abbreviation |
Thyroid | ATC: Anaplastic thyroid cancer | |
HT: Hashimoto's thyroiditis | ||
PTC: Papillary thyroid cancer |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
Figure of enriched GO biological processes. |
Tissue | Disease Stage | Enriched GO biological Processes |
Stomach | WIM | |
Stomach | SIM | |
Liver | NAFLD | |
Liver | Cirrhotic | |
Liver | HCC |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
Enriched GO biological processes. |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00182059 | Thyroid | PTC | peptidyl-lysine modification | 188/5968 | 376/18723 | 1.34e-13 | 7.09e-12 | 188 |
GO:001820817 | Thyroid | PTC | peptidyl-proline modification | 42/5968 | 58/18723 | 2.71e-10 | 8.91e-09 | 42 |
GO:00181265 | Thyroid | PTC | protein hydroxylation | 17/5968 | 27/18723 | 8.67e-04 | 5.30e-03 | 17 |
GO:00195116 | Thyroid | PTC | peptidyl-proline hydroxylation | 11/5968 | 15/18723 | 1.19e-03 | 6.84e-03 | 11 |
GO:001820516 | Thyroid | ATC | peptidyl-lysine modification | 193/6293 | 376/18723 | 6.92e-13 | 3.06e-11 | 193 |
GO:001820818 | Thyroid | ATC | peptidyl-proline modification | 42/6293 | 58/18723 | 1.70e-09 | 4.21e-08 | 42 |
GO:00329633 | Thyroid | ATC | collagen metabolic process | 52/6293 | 104/18723 | 3.94e-04 | 2.38e-03 | 52 |
GO:001812612 | Thyroid | ATC | protein hydroxylation | 17/6293 | 27/18723 | 1.70e-03 | 8.47e-03 | 17 |
GO:001951111 | Thyroid | ATC | peptidyl-proline hydroxylation | 11/6293 | 15/18723 | 1.94e-03 | 9.41e-03 | 11 |
GO:00329641 | Thyroid | ATC | collagen biosynthetic process | 27/6293 | 51/18723 | 3.41e-03 | 1.52e-02 | 27 |
Page: 1 |
Enriched KEGG pathways. |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
Annotation of somatic variants for genes involved in malignant transformation |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
P3H3 | SNV | Missense_Mutation | rs781811454 | c.610N>T | p.Arg204Trp | p.R204W | Q8IVL6 | protein_coding | deleterious(0) | probably_damaging(0.952) | TCGA-BH-A0DH-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | cyclophosphamide | SD |
P3H3 | SNV | Missense_Mutation | novel | c.2095G>A | p.Glu699Lys | p.E699K | Q8IVL6 | protein_coding | tolerated(0.21) | benign(0.045) | TCGA-BH-A0DZ-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | docetaxel | SD |
P3H3 | SNV | Missense_Mutation | rs376420128 | c.2150N>A | p.Arg717His | p.R717H | Q8IVL6 | protein_coding | tolerated(0.22) | benign(0) | TCGA-E9-A22B-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | tamoxiphen | SD |
P3H3 | SNV | Missense_Mutation | novel | c.1120N>C | p.Glu374Gln | p.E374Q | Q8IVL6 | protein_coding | tolerated(0.2) | benign(0.037) | TCGA-EW-A6SB-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
P3H3 | SNV | Missense_Mutation | c.1199N>C | p.Ser400Thr | p.S400T | Q8IVL6 | protein_coding | tolerated(1) | benign(0.031) | TCGA-Q1-A5R2-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | PR | |
P3H3 | deletion | Frame_Shift_Del | novel | c.1929_1959delGCGCCTTGTGGCCTTCAGCTCCGGTGTCGAG | p.Arg644IlefsTer8 | p.R644Ifs*8 | Q8IVL6 | protein_coding | TCGA-EK-A2H0-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR | ||
P3H3 | deletion | Frame_Shift_Del | novel | c.1929_1959delGCGCCTTGTGGCCTTCAGCTCCGGTGTCGAG | p.Arg644IlefsTer8 | p.R644Ifs*8 | Q8IVL6 | protein_coding | TCGA-ZJ-A8QQ-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | SD | ||
P3H3 | SNV | Missense_Mutation | c.835N>A | p.Leu279Ile | p.L279I | Q8IVL6 | protein_coding | deleterious(0.01) | benign(0.232) | TCGA-A6-5665-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | PD | |
P3H3 | SNV | Missense_Mutation | rs782816168 | c.1930N>T | p.Arg644Cys | p.R644C | Q8IVL6 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-AA-3510-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
P3H3 | SNV | Missense_Mutation | c.2026N>A | p.Ala676Thr | p.A676T | Q8IVL6 | protein_coding | tolerated(0.06) | possibly_damaging(0.626) | TCGA-AA-3510-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
Page: 1 2 3 4 5 6 7 |
Top |
Related drugs of malignant transformation related genes |
Identification of chemicals and drugs interact with genes involved in malignant transfromation |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
10536 | P3H3 | DRUGGABLE GENOME | sertraline | SERTRALINE | 30324302 |
Page: 1 |