Tissue | Expression Dynamics | Abbreviation |
Esophagus | | ESCC: Esophageal squamous cell carcinoma |
HGIN: High-grade intraepithelial neoplasias |
LGIN: Low-grade intraepithelial neoplasias |
Liver | | HCC: Hepatocellular carcinoma |
NAFLD: Non-alcoholic fatty liver disease |
Oral Cavity | | EOLP: Erosive Oral lichen planus |
LP: leukoplakia |
NEOLP: Non-erosive oral lichen planus |
OSCC: Oral squamous cell carcinoma |
Prostate | | BPH: Benign Prostatic Hyperplasia |
Skin | | AK: Actinic keratosis |
cSCC: Cutaneous squamous cell carcinoma |
SCCIS:squamous cell carcinoma in situ |
Thyroid | | ATC: Anaplastic thyroid cancer |
HT: Hashimoto's thyroiditis |
PTC: Papillary thyroid cancer |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:007147919 | Esophagus | HGIN | cellular response to ionizing radiation | 21/2587 | 72/18723 | 5.31e-04 | 7.59e-03 | 21 |
GO:000931418 | Esophagus | HGIN | response to radiation | 88/2587 | 456/18723 | 6.26e-04 | 8.65e-03 | 88 |
GO:00714789 | Esophagus | HGIN | cellular response to radiation | 42/2587 | 186/18723 | 7.66e-04 | 1.00e-02 | 42 |
GO:007121418 | Esophagus | HGIN | cellular response to abiotic stimulus | 66/2587 | 331/18723 | 1.21e-03 | 1.45e-02 | 66 |
GO:010400418 | Esophagus | HGIN | cellular response to environmental stimulus | 66/2587 | 331/18723 | 1.21e-03 | 1.45e-02 | 66 |
GO:00102129 | Esophagus | HGIN | response to ionizing radiation | 33/2587 | 148/18723 | 3.28e-03 | 3.10e-02 | 33 |
GO:001021217 | Esophagus | ESCC | response to ionizing radiation | 110/8552 | 148/18723 | 1.11e-12 | 4.78e-11 | 110 |
GO:000931419 | Esophagus | ESCC | response to radiation | 277/8552 | 456/18723 | 4.42e-11 | 1.43e-09 | 277 |
GO:007121419 | Esophagus | ESCC | cellular response to abiotic stimulus | 206/8552 | 331/18723 | 7.52e-10 | 1.88e-08 | 206 |
GO:010400419 | Esophagus | ESCC | cellular response to environmental stimulus | 206/8552 | 331/18723 | 7.52e-10 | 1.88e-08 | 206 |
GO:007147816 | Esophagus | ESCC | cellular response to radiation | 122/8552 | 186/18723 | 3.07e-08 | 5.73e-07 | 122 |
GO:0071479110 | Esophagus | ESCC | cellular response to ionizing radiation | 54/8552 | 72/18723 | 3.85e-07 | 5.32e-06 | 54 |
GO:00063024 | Esophagus | ESCC | double-strand break repair | 152/8552 | 251/18723 | 1.33e-06 | 1.62e-05 | 152 |
GO:00063101 | Esophagus | ESCC | DNA recombination | 168/8552 | 305/18723 | 5.58e-04 | 3.05e-03 | 168 |
GO:00007241 | Esophagus | ESCC | double-strand break repair via homologous recombination | 79/8552 | 138/18723 | 4.05e-03 | 1.62e-02 | 79 |
GO:00007251 | Esophagus | ESCC | recombinational repair | 80/8552 | 140/18723 | 4.10e-03 | 1.63e-02 | 80 |
GO:007121411 | Liver | Cirrhotic | cellular response to abiotic stimulus | 115/4634 | 331/18723 | 2.62e-05 | 3.38e-04 | 115 |
GO:010400411 | Liver | Cirrhotic | cellular response to environmental stimulus | 115/4634 | 331/18723 | 2.62e-05 | 3.38e-04 | 115 |
GO:007147911 | Liver | Cirrhotic | cellular response to ionizing radiation | 34/4634 | 72/18723 | 2.86e-05 | 3.64e-04 | 34 |
GO:007147811 | Liver | Cirrhotic | cellular response to radiation | 68/4634 | 186/18723 | 2.11e-04 | 1.94e-03 | 68 |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
SWI5 | SNV | Missense_Mutation | novel | c.149N>C | p.Arg50Thr | p.R50T | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.28) | benign(0.01) | TCGA-5L-AAT1-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Hormone Therapy | letrozol | SD |
SWI5 | SNV | Missense_Mutation | | c.100N>T | p.Pro34Ser | p.P34S | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.54) | benign(0.021) | TCGA-D8-A27V-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Hormone Therapy | tamoxiphen | SD |
SWI5 | SNV | Missense_Mutation | | c.158N>A | p.Gly53Asp | p.G53D | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.65) | benign(0) | TCGA-E9-A22E-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | cyclophosphane | SD |
SWI5 | deletion | Frame_Shift_Del | | c.28_47delTGGCGTCACAACAAAAGCTG | p.Trp10ArgfsTer110 | p.W10Rfs*110 | Q1ZZU3 | protein_coding | | | TCGA-AN-A0AR-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
SWI5 | SNV | Missense_Mutation | rs758005489 | c.28N>C | p.Trp10Arg | p.W10R | Q1ZZU3 | protein_coding | deleterious_low_confidence(0) | benign(0.001) | TCGA-JX-A3Q0-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Unknown | Unknown | SD |
SWI5 | SNV | Missense_Mutation | | c.83N>T | p.Arg28Met | p.R28M | Q1ZZU3 | protein_coding | deleterious_low_confidence(0.04) | benign(0.043) | TCGA-AD-6888-01 | Colorectum | colon adenocarcinoma | Male | >=65 | III/IV | Unknown | Unknown | PD |
SWI5 | SNV | Missense_Mutation | | c.137N>T | p.Thr46Ile | p.T46I | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.12) | benign(0) | TCGA-AZ-6599-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | SD |
SWI5 | SNV | Missense_Mutation | | c.154C>T | p.Pro52Ser | p.P52S | Q1ZZU3 | protein_coding | tolerated_low_confidence(0.28) | benign(0.003) | TCGA-CM-4743-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Chemotherapy | capecitabine | SD |
SWI5 | SNV | Missense_Mutation | novel | c.452N>T | p.Ala151Val | p.A151V | Q1ZZU3 | protein_coding | tolerated(0.07) | possibly_damaging(0.71) | TCGA-A5-A0G1-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
SWI5 | SNV | Missense_Mutation | novel | c.624N>T | p.Gln208His | p.Q208H | Q1ZZU3 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-A5-A0G2-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | III/IV | Unknown | Unknown | SD |