![]() |
|||||
|
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() | |
![]() |
Gene: SNRPF |
Gene summary for SNRPF |
![]() |
Gene information | Species | Human | Gene symbol | SNRPF | Gene ID | 6636 |
Gene name | small nuclear ribonucleoprotein polypeptide F | |
Gene Alias | SMF | |
Cytomap | 12q23.1 | |
Gene Type | protein-coding | GO ID | GO:0000375 | UniProtAcc | P62306 |
Top |
Malignant transformation analysis |
![]() |
![]() |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
6636 | SNRPF | P9T-E | Human | Esophagus | ESCC | 5.56e-34 | 1.08e+00 | 0.1131 |
6636 | SNRPF | P10T-E | Human | Esophagus | ESCC | 3.88e-55 | 1.35e+00 | 0.116 |
6636 | SNRPF | P11T-E | Human | Esophagus | ESCC | 1.45e-06 | 6.77e-01 | 0.1426 |
6636 | SNRPF | P12T-E | Human | Esophagus | ESCC | 7.40e-24 | 8.08e-01 | 0.1122 |
6636 | SNRPF | P15T-E | Human | Esophagus | ESCC | 6.51e-30 | 1.06e+00 | 0.1149 |
6636 | SNRPF | P16T-E | Human | Esophagus | ESCC | 4.64e-21 | 6.85e-01 | 0.1153 |
6636 | SNRPF | P17T-E | Human | Esophagus | ESCC | 1.73e-13 | 1.11e+00 | 0.1278 |
6636 | SNRPF | P19T-E | Human | Esophagus | ESCC | 1.15e-07 | 1.89e+00 | 0.1662 |
6636 | SNRPF | P20T-E | Human | Esophagus | ESCC | 7.67e-20 | 8.25e-01 | 0.1124 |
6636 | SNRPF | P21T-E | Human | Esophagus | ESCC | 9.21e-66 | 1.99e+00 | 0.1617 |
6636 | SNRPF | P22T-E | Human | Esophagus | ESCC | 7.35e-52 | 1.15e+00 | 0.1236 |
6636 | SNRPF | P23T-E | Human | Esophagus | ESCC | 3.38e-28 | 1.51e+00 | 0.108 |
6636 | SNRPF | P24T-E | Human | Esophagus | ESCC | 3.70e-12 | 5.55e-01 | 0.1287 |
6636 | SNRPF | P26T-E | Human | Esophagus | ESCC | 8.84e-53 | 1.41e+00 | 0.1276 |
6636 | SNRPF | P27T-E | Human | Esophagus | ESCC | 2.37e-47 | 1.27e+00 | 0.1055 |
6636 | SNRPF | P28T-E | Human | Esophagus | ESCC | 6.23e-51 | 1.36e+00 | 0.1149 |
6636 | SNRPF | P30T-E | Human | Esophagus | ESCC | 1.47e-22 | 1.41e+00 | 0.137 |
6636 | SNRPF | P31T-E | Human | Esophagus | ESCC | 5.71e-25 | 8.27e-01 | 0.1251 |
6636 | SNRPF | P32T-E | Human | Esophagus | ESCC | 6.29e-41 | 1.22e+00 | 0.1666 |
6636 | SNRPF | P36T-E | Human | Esophagus | ESCC | 5.12e-17 | 1.01e+00 | 0.1187 |
Page: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 |
![]() |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
![]() |
![]() |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | ![]() |
Colorectum | SER | ![]() |
Colorectum | MSS | ![]() |
Colorectum | MSI-H | ![]() |
Colorectum | FAP | ![]() |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
![]() |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:00226139 | Breast | Precancer | ribonucleoprotein complex biogenesis | 79/1080 | 463/18723 | 2.11e-18 | 1.03e-15 | 79 |
GO:00718269 | Breast | Precancer | ribonucleoprotein complex subunit organization | 48/1080 | 227/18723 | 2.68e-15 | 8.45e-13 | 48 |
GO:00226189 | Breast | Precancer | ribonucleoprotein complex assembly | 47/1080 | 220/18723 | 3.47e-15 | 1.03e-12 | 47 |
GO:00083809 | Breast | Precancer | RNA splicing | 65/1080 | 434/18723 | 1.27e-12 | 2.53e-10 | 65 |
GO:00003759 | Breast | Precancer | RNA splicing, via transesterification reactions | 52/1080 | 324/18723 | 1.74e-11 | 2.22e-09 | 52 |
GO:00003779 | Breast | Precancer | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 51/1080 | 320/18723 | 3.55e-11 | 4.04e-09 | 51 |
GO:00003989 | Breast | Precancer | mRNA splicing, via spliceosome | 51/1080 | 320/18723 | 3.55e-11 | 4.04e-09 | 51 |
GO:00003873 | Breast | Precancer | spliceosomal snRNP assembly | 10/1080 | 50/18723 | 4.86e-04 | 6.35e-03 | 10 |
GO:002261314 | Breast | IDC | ribonucleoprotein complex biogenesis | 83/1434 | 463/18723 | 2.01e-13 | 5.20e-11 | 83 |
GO:007182614 | Breast | IDC | ribonucleoprotein complex subunit organization | 52/1434 | 227/18723 | 5.18e-13 | 1.21e-10 | 52 |
GO:002261814 | Breast | IDC | ribonucleoprotein complex assembly | 51/1434 | 220/18723 | 5.32e-13 | 1.21e-10 | 51 |
GO:000838014 | Breast | IDC | RNA splicing | 73/1434 | 434/18723 | 1.27e-10 | 1.57e-08 | 73 |
GO:000037514 | Breast | IDC | RNA splicing, via transesterification reactions | 58/1434 | 324/18723 | 9.44e-10 | 9.58e-08 | 58 |
GO:000037714 | Breast | IDC | RNA splicing, via transesterification reactions with bulged adenosine as nucleophile | 57/1434 | 320/18723 | 1.60e-09 | 1.49e-07 | 57 |
GO:000039814 | Breast | IDC | mRNA splicing, via spliceosome | 57/1434 | 320/18723 | 1.60e-09 | 1.49e-07 | 57 |
GO:000038711 | Breast | IDC | spliceosomal snRNP assembly | 11/1434 | 50/18723 | 1.18e-03 | 1.28e-02 | 11 |
GO:002261324 | Breast | DCIS | ribonucleoprotein complex biogenesis | 83/1390 | 463/18723 | 3.65e-14 | 1.09e-11 | 83 |
GO:007182624 | Breast | DCIS | ribonucleoprotein complex subunit organization | 52/1390 | 227/18723 | 1.54e-13 | 3.95e-11 | 52 |
GO:002261824 | Breast | DCIS | ribonucleoprotein complex assembly | 51/1390 | 220/18723 | 1.60e-13 | 3.95e-11 | 51 |
GO:000838024 | Breast | DCIS | RNA splicing | 73/1390 | 434/18723 | 3.05e-11 | 5.08e-09 | 73 |
Page: 1 2 3 4 5 6 7 8 9 10 11 |
![]() |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
hsa030408 | Breast | Precancer | Spliceosome | 39/684 | 217/8465 | 1.44e-06 | 2.27e-05 | 1.74e-05 | 39 |
hsa0304013 | Breast | Precancer | Spliceosome | 39/684 | 217/8465 | 1.44e-06 | 2.27e-05 | 1.74e-05 | 39 |
hsa0304023 | Breast | IDC | Spliceosome | 40/867 | 217/8465 | 1.53e-04 | 1.42e-03 | 1.06e-03 | 40 |
hsa0304033 | Breast | IDC | Spliceosome | 40/867 | 217/8465 | 1.53e-04 | 1.42e-03 | 1.06e-03 | 40 |
hsa0304043 | Breast | DCIS | Spliceosome | 40/846 | 217/8465 | 8.97e-05 | 8.52e-04 | 6.28e-04 | 40 |
hsa0304053 | Breast | DCIS | Spliceosome | 40/846 | 217/8465 | 8.97e-05 | 8.52e-04 | 6.28e-04 | 40 |
hsa03040 | Colorectum | AD | Spliceosome | 73/2092 | 217/8465 | 1.73e-03 | 9.68e-03 | 6.18e-03 | 73 |
hsa030401 | Colorectum | AD | Spliceosome | 73/2092 | 217/8465 | 1.73e-03 | 9.68e-03 | 6.18e-03 | 73 |
hsa030402 | Colorectum | MSS | Spliceosome | 66/1875 | 217/8465 | 2.58e-03 | 1.27e-02 | 7.81e-03 | 66 |
hsa030403 | Colorectum | MSS | Spliceosome | 66/1875 | 217/8465 | 2.58e-03 | 1.27e-02 | 7.81e-03 | 66 |
hsa030404 | Colorectum | MSI-H | Spliceosome | 37/797 | 217/8465 | 2.49e-04 | 3.23e-03 | 2.70e-03 | 37 |
hsa030405 | Colorectum | MSI-H | Spliceosome | 37/797 | 217/8465 | 2.49e-04 | 3.23e-03 | 2.70e-03 | 37 |
hsa030409 | Endometrium | AEH | Spliceosome | 54/1197 | 217/8465 | 1.47e-05 | 1.65e-04 | 1.21e-04 | 54 |
hsa0304014 | Endometrium | AEH | Spliceosome | 54/1197 | 217/8465 | 1.47e-05 | 1.65e-04 | 1.21e-04 | 54 |
hsa0304024 | Endometrium | EEC | Spliceosome | 54/1237 | 217/8465 | 3.78e-05 | 3.88e-04 | 2.89e-04 | 54 |
hsa0304034 | Endometrium | EEC | Spliceosome | 54/1237 | 217/8465 | 3.78e-05 | 3.88e-04 | 2.89e-04 | 54 |
hsa0304027 | Esophagus | ESCC | Spliceosome | 128/4205 | 217/8465 | 3.31e-03 | 8.79e-03 | 4.50e-03 | 128 |
hsa0304037 | Esophagus | ESCC | Spliceosome | 128/4205 | 217/8465 | 3.31e-03 | 8.79e-03 | 4.50e-03 | 128 |
hsa030407 | Liver | Cirrhotic | Spliceosome | 102/2530 | 217/8465 | 5.69e-08 | 9.47e-07 | 5.84e-07 | 102 |
hsa0304012 | Liver | Cirrhotic | Spliceosome | 102/2530 | 217/8465 | 5.69e-08 | 9.47e-07 | 5.84e-07 | 102 |
Page: 1 2 |
Top |
Cell-cell communication analysis |
![]() |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
![]() |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
![]() |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
SNRPF | SNV | Missense_Mutation | novel | c.52N>T | p.Pro18Ser | p.P18S | P62306 | protein_coding | tolerated(0.17) | benign(0.021) | TCGA-AP-A1DK-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
SNRPF | SNV | Missense_Mutation | novel | c.119T>C | p.Met40Thr | p.M40T | P62306 | protein_coding | deleterious(0) | probably_damaging(0.978) | TCGA-EO-A22R-01 | Endometrium | uterine corpus endometrioid carcinoma | Female | <65 | I/II | Unknown | Unknown | SD |
SNRPF | deletion | In_Frame_Del | novel | c.62_82delTGAAACTTAAGTGGGGAATGG | p.Val21_Met27del | p.V21_M27del | P62306 | protein_coding | TCGA-CC-A7IJ-01 | Liver | liver hepatocellular carcinoma | Male | <65 | I/II | Unknown | Unknown | SD | ||
SNRPF | SNV | Missense_Mutation | c.169N>A | p.Gly57Arg | p.G57R | P62306 | protein_coding | deleterious(0.01) | possibly_damaging(0.77) | TCGA-33-6737-01 | Lung | lung squamous cell carcinoma | Male | >=65 | III/IV | Chemotherapy | gemcitabine | PD |
Page: 1 |
Top |
Related drugs of malignant transformation related genes |
![]() |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
Page: 1 |