|
Gene: BRD9 |
Gene summary for BRD9 |
Gene summary. |
Gene information | Species | Human | Gene symbol | BRD9 | Gene ID | 65980 |
Gene name | bromodomain containing 9 | |
Gene Alias | LAVS3040 | |
Cytomap | 5p15.33 | |
Gene Type | protein-coding | GO ID | GO:0006139 | UniProtAcc | B4DXI2 |
Top |
Malignant transformation analysis |
Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
Malignant transformation involving gene list. |
Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
65980 | BRD9 | P91T-E | Human | Esophagus | ESCC | 1.34e-13 | 1.20e+00 | 0.1828 |
65980 | BRD9 | P104T-E | Human | Esophagus | ESCC | 2.25e-15 | 7.09e-01 | 0.0931 |
65980 | BRD9 | P107T-E | Human | Esophagus | ESCC | 4.08e-51 | 1.03e+00 | 0.171 |
65980 | BRD9 | P126T-E | Human | Esophagus | ESCC | 1.75e-10 | 8.25e-01 | 0.1125 |
65980 | BRD9 | P127T-E | Human | Esophagus | ESCC | 2.42e-19 | 3.56e-01 | 0.0826 |
65980 | BRD9 | P128T-E | Human | Esophagus | ESCC | 5.82e-68 | 2.00e+00 | 0.1241 |
65980 | BRD9 | P130T-E | Human | Esophagus | ESCC | 8.10e-71 | 1.24e+00 | 0.1676 |
65980 | BRD9 | HCC1_Meng | Human | Liver | HCC | 1.49e-79 | 4.37e-01 | 0.0246 |
65980 | BRD9 | HCC2_Meng | Human | Liver | HCC | 3.25e-22 | 2.03e-01 | 0.0107 |
65980 | BRD9 | HCC1 | Human | Liver | HCC | 7.97e-17 | 5.50e+00 | 0.5336 |
65980 | BRD9 | HCC2 | Human | Liver | HCC | 2.64e-09 | 3.96e+00 | 0.5341 |
65980 | BRD9 | Pt13.b | Human | Liver | HCC | 4.24e-10 | 1.82e-01 | 0.0251 |
65980 | BRD9 | Pt14.a | Human | Liver | HCC | 7.36e-03 | 3.33e-01 | 0.0169 |
65980 | BRD9 | Pt14.b | Human | Liver | HCC | 1.74e-02 | 2.54e-01 | 0.018 |
65980 | BRD9 | S014 | Human | Liver | HCC | 4.07e-20 | 9.92e-01 | 0.2254 |
65980 | BRD9 | S015 | Human | Liver | HCC | 3.92e-31 | 1.70e+00 | 0.2375 |
65980 | BRD9 | S016 | Human | Liver | HCC | 4.10e-28 | 1.25e+00 | 0.2243 |
65980 | BRD9 | S027 | Human | Liver | HCC | 9.25e-09 | 8.25e-01 | 0.2446 |
65980 | BRD9 | S028 | Human | Liver | HCC | 6.45e-25 | 1.32e+00 | 0.2503 |
65980 | BRD9 | S029 | Human | Liver | HCC | 2.23e-04 | 4.64e-01 | 0.2581 |
Page: 1 2 3 4 5 6 7 |
Transcriptomic changes along malignancy continuum. |
∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
Figure of enriched GO biological processes. |
Tissue | Disease Stage | Enriched GO biological Processes |
Colorectum | AD | |
Colorectum | SER | |
Colorectum | MSS | |
Colorectum | MSI-H | |
Colorectum | FAP |
∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
Page: 1 2 3 4 5 6 7 8 9 |
Enriched GO biological processes. |
GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
GO:000632516 | Esophagus | HGIN | chromatin organization | 92/2587 | 409/18723 | 1.05e-06 | 4.16e-05 | 92 |
GO:000632517 | Esophagus | ESCC | chromatin organization | 240/8552 | 409/18723 | 6.52e-08 | 1.14e-06 | 240 |
GO:000632511 | Liver | HCC | chromatin organization | 206/7958 | 409/18723 | 7.23e-04 | 4.41e-03 | 206 |
GO:000632510 | Oral cavity | OSCC | chromatin organization | 190/7305 | 409/18723 | 1.17e-03 | 5.97e-03 | 190 |
GO:000632514 | Prostate | Tumor | chromatin organization | 104/3246 | 409/18723 | 2.02e-05 | 2.62e-04 | 104 |
GO:000632518 | Skin | AK | chromatin organization | 73/1910 | 409/18723 | 1.40e-06 | 4.26e-05 | 73 |
GO:000632519 | Skin | cSCC | chromatin organization | 147/4864 | 409/18723 | 4.41e-06 | 6.52e-05 | 147 |
GO:000632520 | Thyroid | PTC | chromatin organization | 183/5968 | 409/18723 | 2.55e-08 | 5.70e-07 | 183 |
GO:0006325110 | Thyroid | ATC | chromatin organization | 189/6293 | 409/18723 | 6.40e-08 | 1.13e-06 | 189 |
Page: 1 |
Enriched KEGG pathways. |
Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
Page: 1 |
Top |
Cell-cell communication analysis |
Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
Annotation of somatic variants for genes involved in malignant transformation |
Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
BRD9 | SNV | Missense_Mutation | rs761934433 | c.1633N>T | p.Arg545Trp | p.R545W | Q9H8M2 | protein_coding | deleterious(0) | probably_damaging(0.947) | TCGA-AC-A3W5-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Chemotherapy | docetaxel | CR |
BRD9 | SNV | Missense_Mutation | c.1456G>A | p.Val486Ile | p.V486I | Q9H8M2 | protein_coding | tolerated(0.37) | benign(0.001) | TCGA-AO-A1KR-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | cyclophosphamide | SD | |
BRD9 | SNV | Missense_Mutation | c.1682N>T | p.Gln561Leu | p.Q561L | Q9H8M2 | protein_coding | tolerated(0.82) | benign(0) | TCGA-E2-A14R-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | doxorubicin | PD | |
BRD9 | deletion | Frame_Shift_Del | c.728_765delTTTTGGGCAATGAAGATACAGCTGTTGAGGAACCTGTC | p.Leu243ProfsTer2 | p.L243Pfs*2 | Q9H8M2 | protein_coding | TCGA-A2-A0YJ-01 | Breast | breast invasive carcinoma | Female | <65 | III/IV | Chemotherapy | cytoxan | PD | |||
BRD9 | SNV | Missense_Mutation | rs761934433 | c.1633N>T | p.Arg545Trp | p.R545W | Q9H8M2 | protein_coding | deleterious(0) | probably_damaging(0.947) | TCGA-EA-A43B-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
BRD9 | SNV | Missense_Mutation | rs763293348 | c.931C>T | p.Arg311Trp | p.R311W | Q9H8M2 | protein_coding | tolerated(0.06) | benign(0.115) | TCGA-MY-A5BD-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
BRD9 | SNV | Missense_Mutation | novel | c.1050N>C | p.Glu350Asp | p.E350D | Q9H8M2 | protein_coding | tolerated(0.32) | benign(0.204) | TCGA-VS-A9UM-01 | Cervix | cervical & endocervical cancer | Female | <65 | I/II | Chemotherapy | cisplatin | CR |
BRD9 | SNV | Missense_Mutation | rs144680205 | c.1027N>A | p.Glu343Lys | p.E343K | Q9H8M2 | protein_coding | deleterious(0) | benign(0.241) | TCGA-AA-3877-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
BRD9 | SNV | Missense_Mutation | rs758871899 | c.1705N>T | p.Arg569Cys | p.R569C | Q9H8M2 | protein_coding | deleterious_low_confidence(0) | benign(0.245) | TCGA-AA-A00N-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Unknown | Unknown | PD |
BRD9 | SNV | Missense_Mutation | c.883G>A | p.Ala295Thr | p.A295T | Q9H8M2 | protein_coding | tolerated(0.1) | possibly_damaging(0.766) | TCGA-AD-6889-01 | Colorectum | colon adenocarcinoma | Male | >=65 | I/II | Chemotherapy | xeloda | PD |
Page: 1 2 3 4 5 6 |
Top |
Related drugs of malignant transformation related genes |
Identification of chemicals and drugs interact with genes involved in malignant transfromation |
(DGIdb 4.0) |
Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
65980 | BRD9 | ENZYME | inhibitor | 252166773 | ||
65980 | BRD9 | ENZYME | inhibitor | 310264731 | ||
65980 | BRD9 | ENZYME | inhibitor | 336446908 | ||
65980 | BRD9 | ENZYME | 387065623 | |||
65980 | BRD9 | ENZYME | inhibitor | 252166608 | ||
65980 | BRD9 | ENZYME | inhibitor | 252827481 | ||
65980 | BRD9 | ENZYME | 387065622 | |||
65980 | BRD9 | ENZYME | inhibitor | 315661231 |
Page: 1 |