|
|||||
|
 | |
| |
| |
| |
| |
| |
|
Gene: TBRG4 |
Gene summary for TBRG4 |
 Gene summary. |
| Gene information | Species | Human | Gene symbol | TBRG4 | Gene ID | 9238 |
| Gene name | transforming growth factor beta regulator 4 | |
| Gene Alias | CPR2 | |
| Cytomap | 7p13 | |
| Gene Type | protein-coding | GO ID | GO:0000959 | UniProtAcc | B3KRS4 |
Top |
Malignant transformation analysis |
| Identification of the aberrant gene expression in precancerous and cancerous lesions by comparing the gene expression of stem-like cells in diseased tissues with normal stem cells |
| Malignant transformation involving gene list. |
| Entrez ID | Symbol | Replicates | Species | Organ | Tissue | Adj P-value | Log2FC | Malignancy |
| 9238 | TBRG4 | P47T-E | Human | Esophagus | ESCC | 7.07e-24 | 2.39e-01 | 0.1067 |
| 9238 | TBRG4 | P48T-E | Human | Esophagus | ESCC | 6.07e-29 | 4.72e-01 | 0.0959 |
| 9238 | TBRG4 | P49T-E | Human | Esophagus | ESCC | 8.52e-12 | 1.06e+00 | 0.1768 |
| 9238 | TBRG4 | P52T-E | Human | Esophagus | ESCC | 3.02e-41 | 9.00e-01 | 0.1555 |
| 9238 | TBRG4 | P54T-E | Human | Esophagus | ESCC | 1.32e-20 | 5.20e-01 | 0.0975 |
| 9238 | TBRG4 | P56T-E | Human | Esophagus | ESCC | 2.68e-09 | 1.04e+00 | 0.1613 |
| 9238 | TBRG4 | P57T-E | Human | Esophagus | ESCC | 4.22e-15 | 2.47e-01 | 0.0926 |
| 9238 | TBRG4 | P61T-E | Human | Esophagus | ESCC | 4.32e-17 | 4.06e-01 | 0.099 |
| 9238 | TBRG4 | P62T-E | Human | Esophagus | ESCC | 8.99e-45 | 8.15e-01 | 0.1302 |
| 9238 | TBRG4 | P65T-E | Human | Esophagus | ESCC | 1.12e-27 | 2.39e-01 | 0.0978 |
| 9238 | TBRG4 | P74T-E | Human | Esophagus | ESCC | 1.87e-28 | 8.38e-01 | 0.1479 |
| 9238 | TBRG4 | P75T-E | Human | Esophagus | ESCC | 1.79e-33 | 5.70e-01 | 0.1125 |
| 9238 | TBRG4 | P76T-E | Human | Esophagus | ESCC | 3.14e-39 | 6.42e-01 | 0.1207 |
| 9238 | TBRG4 | P79T-E | Human | Esophagus | ESCC | 1.09e-24 | 4.36e-01 | 0.1154 |
| 9238 | TBRG4 | P80T-E | Human | Esophagus | ESCC | 9.03e-39 | 1.13e+00 | 0.155 |
| 9238 | TBRG4 | P82T-E | Human | Esophagus | ESCC | 6.16e-21 | 7.11e-01 | 0.1072 |
| 9238 | TBRG4 | P83T-E | Human | Esophagus | ESCC | 1.37e-64 | 1.91e+00 | 0.1738 |
| 9238 | TBRG4 | P84T-E | Human | Esophagus | ESCC | 2.34e-02 | 3.67e-01 | 0.0933 |
| 9238 | TBRG4 | P89T-E | Human | Esophagus | ESCC | 9.23e-22 | 1.44e+00 | 0.1752 |
| 9238 | TBRG4 | P91T-E | Human | Esophagus | ESCC | 3.53e-17 | 1.50e+00 | 0.1828 |
| Page: 1 2 3 4 5 6 |
| Transcriptomic changes along malignancy continuum. |
| Tissue | Expression Dynamics | Abbreviation |
| Esophagus |  | ESCC: Esophageal squamous cell carcinoma |
| HGIN: High-grade intraepithelial neoplasias | ||
| LGIN: Low-grade intraepithelial neoplasias | ||
| Liver |  | HCC: Hepatocellular carcinoma |
| NAFLD: Non-alcoholic fatty liver disease | ||
| Oral Cavity |  | EOLP: Erosive Oral lichen planus |
| LP: leukoplakia | ||
| NEOLP: Non-erosive oral lichen planus | ||
| OSCC: Oral squamous cell carcinoma | ||
| Skin |  | AK: Actinic keratosis |
| cSCC: Cutaneous squamous cell carcinoma | ||
| SCCIS:squamous cell carcinoma in situ | ||
| Thyroid |  | ATC: Anaplastic thyroid cancer |
| HT: Hashimoto's thyroiditis | ||
| PTC: Papillary thyroid cancer |
| ∗log2FC in expression of this searched gene in stem-like cells from each diseased tissue sample relative to stem-like cells in normal samples in each tissue plotted against the malignancy continuum. Samples are colored based on if they are from different disease stage. |
Top |
Malignant transformation related pathway analysis |
| Find out the enriched GO biological processes and KEGG pathways involved in transition from healthy to precancer to cancer |
| Figure of enriched GO biological processes. |
| Tissue | Disease Stage | Enriched GO biological Processes |
| Colorectum | AD |  |
| Colorectum | SER |  |
| Colorectum | MSS |  |
| Colorectum | MSI-H |  |
| Colorectum | FAP |  |
| ∗Top 15 enriched GO BP terms are showed in the bar plot of each disease state in each tissue. Each row represents a significant GO biological process which is colored according to the -log10(p.adjust). |
| Page: 1 2 3 4 5 6 7 8 9 |
| Enriched GO biological processes. |
| GO ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | Count |
| GO:1903311110 | Esophagus | ESCC | regulation of mRNA metabolic process | 210/8552 | 288/18723 | 3.25e-21 | 5.56e-19 | 210 |
| GO:0006401110 | Esophagus | ESCC | RNA catabolic process | 204/8552 | 278/18723 | 3.39e-21 | 5.66e-19 | 204 |
| GO:014005313 | Esophagus | ESCC | mitochondrial gene expression | 93/8552 | 108/18723 | 1.96e-18 | 2.03e-16 | 93 |
| GO:0034655110 | Esophagus | ESCC | nucleobase-containing compound catabolic process | 272/8552 | 407/18723 | 2.92e-18 | 2.90e-16 | 272 |
| GO:0006402110 | Esophagus | ESCC | mRNA catabolic process | 170/8552 | 232/18723 | 8.70e-18 | 8.00e-16 | 170 |
| GO:004670018 | Esophagus | ESCC | heterocycle catabolic process | 286/8552 | 445/18723 | 1.12e-15 | 7.47e-14 | 286 |
| GO:004427019 | Esophagus | ESCC | cellular nitrogen compound catabolic process | 288/8552 | 451/18723 | 3.03e-15 | 1.79e-13 | 288 |
| GO:001943918 | Esophagus | ESCC | aromatic compound catabolic process | 295/8552 | 467/18723 | 1.09e-14 | 5.98e-13 | 295 |
| GO:190136118 | Esophagus | ESCC | organic cyclic compound catabolic process | 307/8552 | 495/18723 | 9.99e-14 | 4.80e-12 | 307 |
| GO:006101319 | Esophagus | ESCC | regulation of mRNA catabolic process | 115/8552 | 166/18723 | 5.90e-10 | 1.49e-08 | 115 |
| GO:004348719 | Esophagus | ESCC | regulation of RNA stability | 117/8552 | 170/18723 | 7.91e-10 | 1.94e-08 | 117 |
| GO:004348819 | Esophagus | ESCC | regulation of mRNA stability | 109/8552 | 158/18723 | 2.40e-09 | 5.35e-08 | 109 |
| GO:00009592 | Esophagus | ESCC | mitochondrial RNA metabolic process | 39/8552 | 49/18723 | 1.20e-06 | 1.49e-05 | 39 |
| GO:00009631 | Esophagus | ESCC | mitochondrial RNA processing | 19/8552 | 20/18723 | 3.83e-06 | 4.14e-05 | 19 |
| GO:190136111 | Liver | Cirrhotic | organic cyclic compound catabolic process | 213/4634 | 495/18723 | 1.58e-19 | 3.67e-17 | 213 |
| GO:001943911 | Liver | Cirrhotic | aromatic compound catabolic process | 202/4634 | 467/18723 | 6.93e-19 | 1.28e-16 | 202 |
| GO:190331111 | Liver | Cirrhotic | regulation of mRNA metabolic process | 140/4634 | 288/18723 | 1.07e-18 | 1.91e-16 | 140 |
| GO:004427011 | Liver | Cirrhotic | cellular nitrogen compound catabolic process | 195/4634 | 451/18723 | 2.99e-18 | 4.94e-16 | 195 |
| GO:004670011 | Liver | Cirrhotic | heterocycle catabolic process | 192/4634 | 445/18723 | 7.17e-18 | 1.12e-15 | 192 |
| GO:003465511 | Liver | Cirrhotic | nucleobase-containing compound catabolic process | 171/4634 | 407/18723 | 9.07e-15 | 9.33e-13 | 171 |
| Page: 1 2 3 4 5 6 |
| Enriched KEGG pathways. |
| Pathway ID | Tissue | Disease Stage | Description | Gene Ratio | Bg Ratio | pvalue | p.adjust | qvalue | Count |
| Page: 1 |
Top |
Cell-cell communication analysis |
| Identification of potential cell-cell interactions between two cell types and their ligand-receptor pairs for different disease states |
| Ligand | Receptor | LRpair | Pathway | Tissue | Disease Stage |
| Page: 1 |
Top |
Single-cell gene regulatory network inference analysis |
| Find out the significant the regulons (TFs) and the target genes of each regulon across cell types for different disease states |
| TF | Cell Type | Tissue | Disease Stage | Target Gene | RSS | Regulon Activity |
| ∗The dot plots of a searched regulon are shown for all cell subpopulations in each disease state of each tissue based on the regulon specific score inferred using pySCENIC and by calculating the average expression. |
| Page: 1 |
Top |
Somatic mutation of malignant transformation related genes |
| Annotation of somatic variants for genes involved in malignant transformation |
| Hugo Symbol | Variant Class | Variant Classification | dbSNP RS | HGVSc | HGVSp | HGVSp Short | SWISSPROT | BIOTYPE | SIFT | PolyPhen | Tumor Sample Barcode | Tissue | Histology | Sex | Age | Stage | Therapy Types | Drugs | Outcome |
| TBRG4 | SNV | Missense_Mutation | novel | c.1607N>A | p.Pro536His | p.P536H | Q969Z0 | protein_coding | deleterious(0.01) | probably_damaging(0.915) | TCGA-AR-A2LN-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | letrozole | SD |
| TBRG4 | SNV | Missense_Mutation | novel | c.533N>G | p.Lys178Arg | p.K178R | Q969Z0 | protein_coding | tolerated(1) | benign(0.001) | TCGA-BH-A42T-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
| TBRG4 | SNV | Missense_Mutation | rs143689271 | c.811C>T | p.Arg271Trp | p.R271W | Q969Z0 | protein_coding | deleterious(0) | probably_damaging(0.999) | TCGA-D8-A1J8-01 | Breast | breast invasive carcinoma | Female | >=65 | I/II | Hormone Therapy | nolvadex | SD |
| TBRG4 | insertion | In_Frame_Ins | novel | c.68_69insCAC | p.Met23delinsIleThr | p.M23delinsIT | Q969Z0 | protein_coding | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD | ||
| TBRG4 | insertion | Frame_Shift_Ins | novel | c.67_68insGAATTCA | p.Met23ArgfsTer17 | p.M23Rfs*17 | Q969Z0 | protein_coding | TCGA-AR-A0TY-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unspecific | Paclitaxel | PD | ||
| TBRG4 | insertion | In_Frame_Ins | novel | c.1570_1571insGTC | p.Ala524delinsGlyPro | p.A524delinsGP | Q969Z0 | protein_coding | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD | ||
| TBRG4 | insertion | Nonsense_Mutation | novel | c.1568_1569insGGCTTCCTGATAGTGGACGTGAGTACCTCTTGGGCAGG | p.Asp523GlufsTer4 | p.D523Efs*4 | Q969Z0 | protein_coding | TCGA-B6-A0IN-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Unknown | Unknown | PD | ||
| TBRG4 | deletion | In_Frame_Del | c.606_659delGCTGCTGGCTGAGCTGCTCACACACCTGGAAAGGCGTTGGACAGAAATTGAAGA | p.Glu202_Glu219del | p.E202_E219del | Q969Z0 | protein_coding | TCGA-E2-A1LH-01 | Breast | breast invasive carcinoma | Female | <65 | I/II | Chemotherapy | adriamycin | SD | |||
| TBRG4 | SNV | Missense_Mutation | novel | c.337G>C | p.Glu113Gln | p.E113Q | Q969Z0 | protein_coding | tolerated(0.16) | benign(0.08) | TCGA-HM-A4S6-01 | Cervix | cervical & endocervical cancer | Female | <65 | III/IV | Chemotherapy | cisplatin | CR |
| TBRG4 | SNV | Missense_Mutation | c.776N>A | p.Arg259Gln | p.R259Q | Q969Z0 | protein_coding | tolerated(0.05) | probably_damaging(0.974) | TCGA-A6-3809-01 | Colorectum | colon adenocarcinoma | Female | >=65 | I/II | Unknown | Unknown | SD |
| Page: 1 2 3 4 5 6 7 |
Top |
Related drugs of malignant transformation related genes |
| Identification of chemicals and drugs interact with genes involved in malignant transfromation |
| (DGIdb 4.0) |
| Entrez ID | Symbol | Category | Interaction Types | Drug Claim Name | Drug Name | PMIDs |
| Page: 1 |
Copyright 2023-Present -The University of Texas Health Science Center at Houston |