FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 9294

FusionGeneSummary for DAPK2_MAP2K5

check button Fusion gene summary
Fusion gene informationFusion gene name: DAPK2_MAP2K5
Fusion gene ID: 9294
HgeneTgene
Gene symbol

DAPK2

MAP2K5

Gene ID

23604

5607

Gene namedeath associated protein kinase 2mitogen-activated protein kinase kinase 5
SynonymsDRP-1|DRP1HsT17454|MAPKK5|MEK5|PRKMK5
Cytomap

15q22.31

15q23

Type of geneprotein-codingprotein-coding
Descriptiondeath-associated protein kinase 2DAP kinase 2DAP-kinase-related protein 1 beta isoformdual specificity mitogen-activated protein kinase kinase 5MAP kinase kinase 5MAP kinase kinase MEK5bMAPK/ERK kinase 5MAPKK 5MEK 5
Modification date2018052620180523
UniProtAcc

Q9UIK4

Q13163

Ensembl transtripts involved in fusion geneENST00000261891, ENST00000457488, 
ENST00000558069, ENST00000558482, 
ENST00000178640, ENST00000560591, 
ENST00000395476, ENST00000354498, 
ENST00000340972, 
Fusion gene scores* DoF score5 X 5 X 4=1008 X 7 X 9=504
# samples 913
** MAII scorelog2(9/100*10)=-0.15200309344505
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(13/504*10)=-1.95491211047146
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: DAPK2 [Title/Abstract] AND MAP2K5 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationTumor suppressor gene involved fusion gene, retained protein feature but frameshift.
DDR (DNA damage repair) gene involved fusion gene, in-frame but not retained their domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneDAPK2

GO:0006468

protein phosphorylation

10376525

HgeneDAPK2

GO:0035556

intracellular signal transduction

10376525


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1AI692764DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
ChiTaRS3.1BE464504DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
ChiTaRS3.1BE328057DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
ChiTaRS3.1AW013877DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000261891ENST00000178640DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000261891ENST00000560591DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000261891ENST00000395476DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000261891ENST00000354498DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000261891ENST00000340972DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
In-frameENST00000457488ENST00000178640DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000457488ENST00000560591DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000457488ENST00000395476DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000457488ENST00000354498DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000457488ENST00000340972DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
In-frameENST00000558069ENST00000178640DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000558069ENST00000560591DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000558069ENST00000395476DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000558069ENST00000354498DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5CDS-intronENST00000558069ENST00000340972DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5UTR-3CDSENST00000558482ENST00000178640DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5UTR-intronENST00000558482ENST00000560591DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5UTR-intronENST00000558482ENST00000395476DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5UTR-intronENST00000558482ENST00000354498DAPK2chr15

64332368

-MAP2K5chr15

68098982

+
5UTR-intronENST00000558482ENST00000340972DAPK2chr15

64332368

-MAP2K5chr15

68098982

+

Top

FusionProtFeatures for DAPK2_MAP2K5


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
DAPK2

Q9UIK4

MAP2K5

Q13163

Calcium/calmodulin-dependent serine/threonine kinaseinvolved in multiple cellular signaling pathways that trigger cellsurvival, apoptosis, and autophagy. Regulates both type Iapoptotic and type II autophagic cell death signals, depending onthe cellular setting. The former is caspase-dependent, while thelatter is caspase-independent and is characterized by theaccumulation of autophagic vesicles. Acts as a mediator of anoikisand a suppressor of beta-catenin-dependent anchorage-independentgrowth of malignant epithelial cells. May play a role ingranulocytic maturation (PubMed:17347302). Regulates granulocyticmotility by controlling cell spreading and polarization(PubMed:24163421). {ECO:0000269|PubMed:17347302,ECO:0000269|PubMed:24163421, ECO:0000269|PubMed:26047703}. Isoform 2 is not regulated by calmodulin. It canphosphorylate MYL9. It can induce membrane blebbing and autophagiccell death. Acts as a scaffold for the formation of a ternaryMAP3K2/MAP3K3-MAP3K5-MAPK7 signaling complex. Activation of thispathway appears to play a critical role in protecting cells fromstress-induced apoptosis, neuronal survival and cardiacdevelopment and angiogenesis. {ECO:0000269|PubMed:7759517,ECO:0000269|PubMed:9384584}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for DAPK2_MAP2K5


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_DAPK2_ENST00000457488_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG

>In-frame_DAPK2_ENST00000558069_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG

>In-frame_DAPK2_ENST00000457488_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG

>In-frame_DAPK2_ENST00000558069_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG

>In-frame_DAPK2_ENST00000457488_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG

>In-frame_DAPK2_ENST00000558069_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG

>In-frame_DAPK2_ENST00000457488_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG

>In-frame_DAPK2_ENST00000558069_chr15_64332368_-_MAP2K5_ENST00000178640_chr15_68098982_+_601nt
GACCGCGGCAGCTCAGCCTCCCGCCGATTGTATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGA
GGACTTTTATGACATCGGAGAGGAGCTGGGGAGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGG
GTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGAGGCTGCCGCAGGGCACTGAAAGCCCAGGACCAGTAACCAAGG
AGAACAACCCACCCGTCGCCCTTCTCCGTATGCTGCCTGCGCCAGAAGAGCTTTGCTGGGCCCTGGCTTCCCTGCCCTCGCCTTCACCTC
TGTCAGCAGGTGGCCTTGCCTGGGGAGCCCCATGTGTGGCCCACCCCACCAGGCCATCCCCATACCTTCTGGTTTGAAGGCGCTGACACT
GGCAGAGAGGTAAAGGGTGGGGCATTGAGAATGGAGGCTCCCAGGGTCCCTGCCCACTTCTGTTTTCCTAATGTTTTTCTCTATAAAGGG


Top

FusionGenePPI for DAPK2_MAP2K5


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
DAPK2DAPK2, APP, FAM9B, LLGL2, RACGAP1, TUBGCP5, KLC3MAP2K5MAP3K3, MAP3K2, PRKCZ, MAPK7, MAP2K5, YWHAZ, CDC42BPB, ENO1, SQSTM1, ASRGL1, STAMBP, PRKCI, PARD6A, HSP90AA1, GCH1, XRCC6, ESRRA, RPL28, NXF1, LNX2, TRAF7, C10orf88, CDC37


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for DAPK2_MAP2K5


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for DAPK2_MAP2K5


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
TgeneMAP2K5C0005910Body Weight1CTD_human
TgeneMAP2K5C0011581Depressive disorder1PSYGENET
TgeneMAP2K5C0236733Amphetamine-Related Disorders1CTD_human