FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 6186

FusionGeneSummary for CD44_EXT2

check button Fusion gene summary
Fusion gene informationFusion gene name: CD44_EXT2
Fusion gene ID: 6186
HgeneTgene
Gene symbol

CD44

EXT2

Gene ID

960

2132

Gene nameCD44 molecule (Indian blood group)exostosin glycosyltransferase 2
SynonymsCDW44|CSPG8|ECMR-III|HCELL|HUTCH-I|IN|LHR|MC56|MDU2|MDU3|MIC4|Pgp1SOTV|SSMS
Cytomap

11p13

11p11.2

Type of geneprotein-codingprotein-coding
DescriptionCD44 antigenGP90 lymphocyte homing/adhesion receptorHermes antigencell surface glycoprotein CD44chondroitin sulfate proteoglycan 8epicanextracellular matrix receptor IIIhematopoietic cell E- and L-selectin ligandheparan sulfate proteoglycanhomingexostosin-2N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferaseglucuronosyl-N-acetylglucosaminyl-proteoglycan/N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferasemultiple exostoses protein 2multiple exostosis 2putativ
Modification date2018052720180522
UniProtAcc

P16070

Q93063

Ensembl transtripts involved in fusion geneENST00000263398, ENST00000526025, 
ENST00000449691, ENST00000360158, 
ENST00000415148, ENST00000437706, 
ENST00000433354, ENST00000428726, 
ENST00000526669, ENST00000433892, 
ENST00000278386, ENST00000434472, 
ENST00000352818, ENST00000528922, 
ENST00000533608, ENST00000358681, 
ENST00000395673, ENST00000343631, 
ENST00000529186, 
Fusion gene scores* DoF score11 X 10 X 7=7705 X 5 X 3=75
# samples 145
** MAII scorelog2(14/770*10)=-2.4594316186373
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(5/75*10)=-0.584962500721156
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: CD44 [Title/Abstract] AND EXT2 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationTumor suppressor gene involved fusion gene, retained protein feature but frameshift.
DDR (DNA damage repair) gene involved fusion gene, in-frame but not retained their domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneCD44

GO:0030214

hyaluronan catabolic process

17170110

HgeneCD44

GO:0033138

positive regulation of peptidyl-serine phosphorylation

17045821

HgeneCD44

GO:0043518

negative regulation of DNA damage response, signal transduction by p53 class mediator

17045821

HgeneCD44

GO:0044344

cellular response to fibroblast growth factor stimulus

19577615

HgeneCD44

GO:0050731

positive regulation of peptidyl-tyrosine phosphorylation

17045821

HgeneCD44

GO:0070374

positive regulation of ERK1 and ERK2 cascade

17045821

HgeneCD44

GO:1902166

negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator

17045821

TgeneEXT2

GO:0006024

glycosaminoglycan biosynthetic process

12907669

TgeneEXT2

GO:0033692

cellular polysaccharide biosynthetic process

12907669


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVSARCTCGA-X6-A8C6-01ACD44chr11

35160917

+EXT2chr11

44265699

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000263398ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000263398ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000263398ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000263398ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000263398ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000526025ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000526025ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000526025ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000526025ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000526025ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000449691ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000449691ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000449691ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000449691ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000449691ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000360158ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000360158ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000360158ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000360158ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000360158ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000415148ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000415148ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000415148ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000415148ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000415148ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000437706ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000437706ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000437706ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000437706ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000437706ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000433354ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000433354ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000433354ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000433354ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000433354ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000428726ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000428726ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000428726ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000428726ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000428726ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000526669ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000526669ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000526669ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000526669ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000526669ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000433892ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000433892ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000433892ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000433892ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000433892ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000278386ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000278386ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000278386ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000278386ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000278386ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000434472ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000434472ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000434472ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000434472ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000434472ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000352818ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000352818ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
In-frameENST00000352818ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
Frame-shitENST00000352818ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
5CDS-intronENST00000352818ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+
intron-3CDSENST00000528922ENST00000533608CD44chr11

35160917

+EXT2chr11

44265699

+
intron-3CDSENST00000528922ENST00000358681CD44chr11

35160917

+EXT2chr11

44265699

+
intron-3CDSENST00000528922ENST00000395673CD44chr11

35160917

+EXT2chr11

44265699

+
intron-3CDSENST00000528922ENST00000343631CD44chr11

35160917

+EXT2chr11

44265699

+
intron-intronENST00000528922ENST00000529186CD44chr11

35160917

+EXT2chr11

44265699

+

Top

FusionProtFeatures for CD44_EXT2


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
CD44

P16070

EXT2

Q93063

Glycosyltransferase required for the biosynthesis ofheparan-sulfate. The EXT1/EXT2 complex possesses substantiallyhigher glycosyltransferase activity than EXT1 or EXT2 alone.Appears to be a tumor suppressor. Required for the exosomalrelease of SDCBP, CD63 and syndecan (PubMed:22660413).{ECO:0000269|PubMed:22660413}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for CD44_EXT2


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_CD44_ENST00000263398_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000263398_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000526025_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000526025_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000449691_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000449691_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000360158_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000360158_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000415148_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000415148_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000437706_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000437706_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000433354_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000433354_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000428726_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000428726_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000526669_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000526669_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000433892_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000433892_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000278386_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000278386_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000434472_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000434472_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000352818_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_68aa

>In-frame_CD44_ENST00000352818_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_68aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_CD44_ENST00000263398_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000263398_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000526025_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000526025_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000449691_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000449691_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000360158_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000360158_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000415148_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000415148_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000437706_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000437706_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000433354_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000433354_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000428726_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000428726_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000526669_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000526669_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000433892_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000433892_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000278386_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000278386_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000434472_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000434472_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000352818_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA

>In-frame_CD44_ENST00000352818_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_206nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA


* Fusion transcript sequences (Full-length transcript).
>In-frame_CD44_ENST00000263398_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_1284nt
GAGAAGAAAGCCAGTGCGTCTCTGGGCGCAGGGGCCAGTGGGGCTCGGAGGCACAGGCACCCCGCGACACTCCAGGTTCCCCGACCCACG
TCCCTGGCAGCCCCGATTATTTACAGCCTCAGCAGAGCACGGGGCGGGGGCAGAGGGGCCCGCCCGGGAGGGCTGCTACTTCTTAAAACC
TCTGCGGGCTGCTTAGTCACAGCCCCCCTTGCTTGGGTGTGTCCTTCGCTCGCTCCCTCCCTCCGTCTTAGGTCACTGTTTTCAACCTCG
AATAAAAACTGCAGCCAACTTCCGAGGCAGCCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCC
TCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGT
GGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGAC
CATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGG
CAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAG
TAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAAT
ATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTT
GTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGA
CTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAA
TGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCT
GGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGA

>In-frame_CD44_ENST00000263398_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1782nt
GAGAAGAAAGCCAGTGCGTCTCTGGGCGCAGGGGCCAGTGGGGCTCGGAGGCACAGGCACCCCGCGACACTCCAGGTTCCCCGACCCACG
TCCCTGGCAGCCCCGATTATTTACAGCCTCAGCAGAGCACGGGGCGGGGGCAGAGGGGCCCGCCCGGGAGGGCTGCTACTTCTTAAAACC
TCTGCGGGCTGCTTAGTCACAGCCCCCCTTGCTTGGGTGTGTCCTTCGCTCGCTCCCTCCCTCCGTCTTAGGTCACTGTTTTCAACCTCG
AATAAAAACTGCAGCCAACTTCCGAGGCAGCCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCC
TCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGT
GGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGAC
CATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGG
CAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAG
TAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAAT
ATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTT
GTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGA
CTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAA
TGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCT
GGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGA
TTAAAATTATTTTTTATTCCTTTTTCTACTGTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTA
ACTCCGTCTTTGGCCTGACAACAGTCTTCTGCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAG
AAGGTCCCAAATCATAACCATTTTAAGAACAGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTT
TTAAAGGTATTGTCAGAGAAAAACAGAGGGTCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGT
GACCCCCATCCCAAGGGGATGCCAAAATTTCTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATG

>In-frame_CD44_ENST00000526025_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_1272nt
AGTGCGTCTCTGGGCGCAGGGGCCAGTGGGGCTCGGAGGCACAGGCACCCCGCGACACTCCAGGTTCCCCGACCCACGTCCCTGGCAGCC
CCGATTATTTACAGCCTCAGCAGAGCACGGGGCGGGGGCAGAGGGGCCCGCCCGGGAGGGCTGCTACTTCTTAAAACCTCTGCGGGCTGC
TTAGTCACAGCCCCCCTTGCTTGGGTGTGTCCTTCGCTCGCTCCCTCCCTCCGTCTTAGGTCACTGTTTTCAACCTCGAATAAAAACTGC
AGCCAACTTCCGAGGCAGCCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCC
TGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCT
GGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAA
GGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAA
CGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAG
GGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCT
CGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCC
AGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAG
AGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCA
GGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCAC
AGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTT

>In-frame_CD44_ENST00000526025_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1770nt
AGTGCGTCTCTGGGCGCAGGGGCCAGTGGGGCTCGGAGGCACAGGCACCCCGCGACACTCCAGGTTCCCCGACCCACGTCCCTGGCAGCC
CCGATTATTTACAGCCTCAGCAGAGCACGGGGCGGGGGCAGAGGGGCCCGCCCGGGAGGGCTGCTACTTCTTAAAACCTCTGCGGGCTGC
TTAGTCACAGCCCCCCTTGCTTGGGTGTGTCCTTCGCTCGCTCCCTCCCTCCGTCTTAGGTCACTGTTTTCAACCTCGAATAAAAACTGC
AGCCAACTTCCGAGGCAGCCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCC
TGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCT
GGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAA
GGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAA
CGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAG
GGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCT
CGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCC
AGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAG
AGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCA
GGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCAC
AGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTT
TTTATTCCTTTTTCTACTGTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTG
GCCTGACAACAGTCTTCTGCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAAT
CATAACCATTTTAAGAACAGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTG
TCAGAGAAAAACAGAGGGTCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCC
AAGGGGATGCCAAAATTTCTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAAC

>In-frame_CD44_ENST00000449691_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_984nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC

>In-frame_CD44_ENST00000449691_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1482nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC
TGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACT
GTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCT
GCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAAC
AGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGG
TCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTT
CTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCT

>In-frame_CD44_ENST00000360158_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_984nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC

>In-frame_CD44_ENST00000360158_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1482nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC
TGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACT
GTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCT
GCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAAC
AGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGG
TCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTT
CTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCT

>In-frame_CD44_ENST00000415148_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_984nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC

>In-frame_CD44_ENST00000415148_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1482nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC
TGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACT
GTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCT
GCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAAC
AGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGG
TCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTT
CTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCT

>In-frame_CD44_ENST00000437706_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_984nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC

>In-frame_CD44_ENST00000437706_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1482nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC
TGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACT
GTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCT
GCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAAC
AGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGG
TCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTT
CTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCT

>In-frame_CD44_ENST00000433354_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_984nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC

>In-frame_CD44_ENST00000433354_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1482nt
CCTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGAT
CCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGC
CGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGC
TGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGT
CTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTAC
TTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTG
TTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGA
GGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCAT
TTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAAT
TCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGC
TGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACT
GTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCT
GCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAAC
AGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGG
TCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTT
CTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCT

>In-frame_CD44_ENST00000428726_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_973nt
AGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCC
TTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTG
GCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCC
TGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAG
GCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGG
CATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTT
CTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTG
TTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGG
GGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAA
GCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGAT

>In-frame_CD44_ENST00000428726_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1471nt
AGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCC
TTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTG
GCGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCC
TGTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAG
GCTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGG
CATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTT
CTTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTG
TTTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGG
GGAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAA
GCCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGAT
CCTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACTGTGTCTTAAAC
ACCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCTGCCCATGTCTG
GGAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAACAGATGACTCAG
AAACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGGTCTGTACTAGC
CATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTTCTCTCATTCTT
TTGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCTGGTATATTTAA

>In-frame_CD44_ENST00000526669_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_972nt
GCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCT
TTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGG
CGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCT
GTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGG
CTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGC
ATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTC
TTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGT
TTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGG
GAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAG
CCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATC

>In-frame_CD44_ENST00000526669_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1470nt
GCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCT
TTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGG
CGCAGATCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCT
GTACAAAGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGG
CTGGGACAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGC
ATGCACCCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTC
TTATGATCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGT
TTTCAGTTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGG
GAATCATGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAG
CCAAACATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATC
CTGTCAGTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACTGTGTCTTAAACA
CCAATTCCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCTGCCCATGTCTGG
GAACACACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAACAGATGACTCAGA
AACCTCCAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGGTCTGTACTAGCC
ATGCAAGGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTTCTCTCATTCTTT
TGGTATAAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCTGGTATATTTAAA

>In-frame_CD44_ENST00000433892_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_966nt
CCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCC
CGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGA
TCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAA
AGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGA
CAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCAC
CCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGA
TCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAG
TTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCA
TGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAAC
ATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCA

>In-frame_CD44_ENST00000433892_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1464nt
CCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCC
CGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGA
TCGGTCAGAGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAA
AGATGACTTTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGA
CAGAGGGAGAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCAC
CCACCTAACCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGA
TCTCTGATGGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAG
TTCCATGTAACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCA
TGTAAAGGGTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAAC
ATCTTGGTGGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCA
GTTCCATGAGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACTGTGTCTTAAACACCAATT
CCTGATAGTCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCTGCCCATGTCTGGGAACAC
ACGCCAGGAGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAACAGATGACTCAGAAACCTC
CAGAGGAATCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGGTCTGTACTAGCCATGCAA
GGAGTCGCTCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTTCTCTCATTCTTTTGGTAT
AAACTTAACATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCTGGTATATTTAAATCATTA

>In-frame_CD44_ENST00000278386_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_868nt
CCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAG
AGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACT
TTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGA
GAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAA
CCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGAT
GGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGT
AACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGG
GTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGT
GGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATG

>In-frame_CD44_ENST00000278386_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1366nt
CCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAG
AGTGCATCAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACT
TTCCTGAGAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGA
GAGAACAAGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAA
CCCACTTTCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGAT
GGGTTCTTCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGT
AACAATCTGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGG
GTACCCAGACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGT
GGGATTTGATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATG
AGCTATTCCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACTGTGTCTTAAACACCAATTCCTGATAG
TCCAAGGAACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCTGCCCATGTCTGGGAACACACGCCAGG
AGGAATGTCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAACAGATGACTCAGAAACCTCCAGAGGAA
TCTGTTTGCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGGTCTGTACTAGCCATGCAAGGAGTCGC
TCTAGCTGGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTTCTCTCATTCTTTTGGTATAAACTTAA
CATTAGCCAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCTGGTATATTTAAATCATTAAATTTCAG

>In-frame_CD44_ENST00000434472_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_861nt
CTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCAT
CAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGA
GAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACA
AGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTT
TCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCT
TCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATC
TGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCA
GACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTT
GATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATT

>In-frame_CD44_ENST00000434472_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1359nt
CTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCAT
CAACAAGTTTGCTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGA
GAAGCTGAAGAGCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACA
AGGCCTCCCAGCACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTT
TCTCAAGAACAAGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCT
TCTCGAAAATGCCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATC
TGGAAGGAAACTTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCA
GACCTCACTTTTAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTT
GATAAATGCCTTGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATT
CCTCTTTGGTTTGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACTGTGTCTTAAACACCAATTCCTGATAGTCCAAGG
AACCACCTTTCTCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCTGCCCATGTCTGGGAACACACGCCAGGAGGAATG
TCTGATACCCTCTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAACAGATGACTCAGAAACCTCCAGAGGAATCTGTTT
GCTTCCTGATTAGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGGTCTGTACTAGCCATGCAAGGAGTCGCTCTAGCT
GGTACCCGTAAAAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTTCTCTCATTCTTTTGGTATAAACTTAACATTAGC
CAGGGAGGTTCTGGCTAACGTTAAATGCTGCTATACAACTGCTTTGCAACAGTTGCTGGTATATTTAAATCATTAAATTTCAGCATTTAC

>In-frame_CD44_ENST00000352818_chr11_35160917_+_EXT2_ENST00000358681_chr11_44265699_+_850nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA
GCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAG
CACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACA
AGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATG
CCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAAC
TTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTT
TAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCT
TGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTT

>In-frame_CD44_ENST00000352818_chr11_35160917_+_EXT2_ENST00000395673_chr11_44265699_+_1348nt
ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGGTCAGAGTGCATCAACAAGTTTG
CTTCAGTCTTCGGGACCATGCCTCTCAAGGTGGTGGAACACCGAGCTGACCCTGTCCTGTACAAAGATGACTTTCCTGAGAAGCTGAAGA
GCTTCCCCAACATTGGCAGCTTATGAAACGTGTCATTGGTGGAGGTCTGAATGTGAGGCTGGGACAGAGGGAGAGAACAAGGCCTCCCAG
CACTCTGATGTCAGAGTAGTAGGTTAAGGGTGGAAGGTTGACCTACTTGGATCTTGGCATGCACCCACCTAACCCACTTTCTCAAGAACA
AGAACCTAGAATGAATATCCAAGCACCTCGAGCTATGCAACCTCTGTTCTTGTATTTCTTATGATCTCTGATGGGTTCTTCTCGAAAATG
CCAAGTGGAAGACTTTGTGGCATGCTCCAGATTTAAATCCAGCTGAGGCTCCCTTTGTTTTCAGTTCCATGTAACAATCTGGAAGGAAAC
TTCACGGACAGGAAGACTGCTGGAGAAGAGAAGCGTGTTAGCCCATTTGAGGTCTGGGGAATCATGTAAAGGGTACCCAGACCTCACTTT
TAGTTATTTACATCAATGAGTTCTTTCAGGGAACCAAACCCAGAATTCGGTGCAAAAGCCAAACATCTTGGTGGGATTTGATAAATGCCT
TGGGACCTGGAGTGCTGGGCTTGTGCACAGGAAGAGCACCAGCCGCTGAGTCAGGATCCTGTCAGTTCCATGAGCTATTCCTCTTTGGTT
TGGCTTTTTGATATGATTAAAATTATTTTTTATTCCTTTTTCTACTGTGTCTTAAACACCAATTCCTGATAGTCCAAGGAACCACCTTTC
TCCCTTGATATATTTAACTCCGTCTTTGGCCTGACAACAGTCTTCTGCCCATGTCTGGGAACACACGCCAGGAGGAATGTCTGATACCCT
CTGCATCAAGCGTAAGAAGGTCCCAAATCATAACCATTTTAAGAACAGATGACTCAGAAACCTCCAGAGGAATCTGTTTGCTTCCTGATT
AGATCCAGTCAATGTTTTAAAGGTATTGTCAGAGAAAAACAGAGGGTCTGTACTAGCCATGCAAGGAGTCGCTCTAGCTGGTACCCGTAA
AAGTTGTGGGAATTGTGACCCCCATCCCAAGGGGATGCCAAAATTTCTCTCATTCTTTTGGTATAAACTTAACATTAGCCAGGGAGGTTC


Top

FusionGenePPI for CD44_EXT2


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
CD44ARHGEF1, COL14A1, LCK, IGFBP3, MMP7, ERBB4, TIAM1, TGFBR1, VAV2, FN1, EGFR, ERBB2, HBEGF, EZR, VCAN, SRC, PTPRC, FYN, MSN, NF2, ELAVL1, PRKCZ, ITGB1, FLOT2, CAV1, EP300, STAT3, SLC3A2, IQGAP1, FMNL1, ATF2, ANK1, VHL, BAG1, DPP8, ABCE1, AIM1, DBN1, FLNA, MYH9, DYNLL1, SYNPO, LIMA1, MYO19, SQSTM1, CHERP, PHRF1, CDC73, CD44, FGFR1, CTDSPL, GMEB2, FGF2, GMEB1, DHRS2, METTL8, FAM115C, SLC39A9, AMPD2, SNX33, CAMKV, ATG9A, PRDM10, C17orf80, SNX18, FGFR2, FGFRL1, VANGL1, PARP2, TEFM, LAMA3, MTCH2, HADHB, CLCN7, XAB2, GTF3C2, CDC40, GTF3C3, AQR, GTF3C1, GTF3C6, HADHA, TMEM160, OSBPL8, CDC5L, TNPO2, PRKCI, LEMD3, LGALS1, RBM22, VANGL2, MBOAT7, ISY1, GBAS, TRIM25, CD74EXT2STK16, SNCG, HYOU1, CNTF, TCEB1, RPS29, CRB1, CLEC2L, FABP4, HNF4A, EXT1, EXT2, GALNT5, TRAP1, TK1, CDKN1A, SMN1, ANXA7, PFDN1, GSKIP, SLC22A2, IDS, INVS, TTC19, RBFA, AFAP1, ATE1, CUX1, USP30, NOP9, HLA-DPB1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for CD44_EXT2


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
HgeneCD44P16070DB08818Hyaluronic acidCD44 antigensmall moleculeapproved|vet_approved

Top

RelatedDiseases for CD44_EXT2


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneCD44C0023487Acute Promyelocytic Leukemia2CTD_human
HgeneCD44C0011616Contact Dermatitis1CTD_human
HgeneCD44C0017661IGA Glomerulonephritis1CTD_human
HgeneCD44C0023467Leukemia, Myelocytic, Acute1CTD_human
HgeneCD44C0024668Mammary Neoplasms, Experimental1CTD_human
HgeneCD44C0027627Neoplasm Metastasis1CTD_human
HgeneCD44C0027746Nerve Degeneration1CTD_human
HgeneCD44C0030297Pancreatic Neoplasm1CTD_human
HgeneCD44C0037274Dermatologic disorders1CTD_human
HgeneCD44C0038356Stomach Neoplasms1CTD_human
HgeneCD44C0042900Vitiligo1CTD_human
HgeneCD44C0311375Arsenic Poisoning1CTD_human
HgeneCD44C2609414Acute kidney injury1CTD_human
TgeneEXT2C1851413EXOSTOSES, MULTIPLE, TYPE II9CTD_human;UNIPROT
TgeneEXT2C0015306Hereditary Multiple Exostoses1CTD_human;HPO;ORPHANET
TgeneEXT2C4225248SEIZURES, SCOLIOSIS, AND MACROCEPHALY SYNDROME1ORPHANET;UNIPROT