FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 43467

FusionGeneSummary for ZNF585A_CCDC3

check button Fusion gene summary
Fusion gene informationFusion gene name: ZNF585A_CCDC3
Fusion gene ID: 43467
HgeneTgene
Gene symbol

ZNF585A

CCDC3

Gene ID

199704

83643

Gene namezinc finger protein 585Acoiled-coil domain containing 3
Synonyms--
Cytomap

19q13.12

10p13

Type of geneprotein-codingprotein-coding
Descriptionzinc finger protein 585Acoiled-coil domain-containing protein 3fat/vessel-derived secretory proteinfavine
Modification date2018051920180329
UniProtAcc

Q6P3V2

Q9BQI4

Ensembl transtripts involved in fusion geneENST00000588723, ENST00000356958, 
ENST00000292841, ENST00000392157, 
ENST00000355533, ENST00000588354, 
ENST00000378825, ENST00000378839, 
Fusion gene scores* DoF score4 X 3 X 3=363 X 3 X 3=27
# samples 33
** MAII scorelog2(3/36*10)=-0.263034405833794
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(3/27*10)=0.15200309344505
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: ZNF585A [Title/Abstract] AND CCDC3 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVPRADTCGA-V1-A9O5-06AZNF585Achr19

37646767

-CCDC3chr10

13040512

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
5UTR-3CDSENST00000588723ENST00000378825ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
5UTR-5UTRENST00000588723ENST00000378839ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
Frame-shitENST00000356958ENST00000378825ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
5CDS-5UTRENST00000356958ENST00000378839ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
In-frameENST00000292841ENST00000378825ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
5CDS-5UTRENST00000292841ENST00000378839ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
Frame-shitENST00000392157ENST00000378825ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
5CDS-5UTRENST00000392157ENST00000378839ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
In-frameENST00000355533ENST00000378825ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
5CDS-5UTRENST00000355533ENST00000378839ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
intron-3CDSENST00000588354ENST00000378825ZNF585Achr19

37646767

-CCDC3chr10

13040512

-
intron-5UTRENST00000588354ENST00000378839ZNF585Achr19

37646767

-CCDC3chr10

13040512

-

Top

FusionProtFeatures for ZNF585A_CCDC3


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
ZNF585A

Q6P3V2

CCDC3

Q9BQI4

May be involved in transcriptional regulation. Negatively regulates TNF-alpha-induced pro-inflammatoryresponse in endothelial cells (ECs) via inhibition of TNF-alpha-induced NF-kappaB activation in ECs (PubMed:25193116). Positivelyregulates lipid accumulation in adipose cells (By similarity).{ECO:0000250|UniProtKB:Q9D6Y1, ECO:0000269|PubMed:25193116}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for ZNF585A_CCDC3


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_ZNF585A_ENST00000292841_chr19_37646767_-_CCDC3_ENST00000378825_chr10_13040512_-_146aa
DG_KL_PLASRSQFPRCHLPRHSREQKDVF_PFPVFKLFARAAAGDFLQ_LGNPGRQ_AHVLLGAEGLV_GGGPRQETAAESGHPGEAQP

>In-frame_ZNF585A_ENST00000355533_chr19_37646767_-_CCDC3_ENST00000378825_chr10_13040512_-_146aa
DG_KL_PLASRSQFPRCHLPRHSREQKDVF_PFPVFKLFARAAAGDFLQ_LGNPGRQ_AHVLLGAEGLV_GGGPRQETAAESGHPGEAQP


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_ZNF585A_ENST00000292841_chr19_37646767_-_CCDC3_ENST00000378825_chr10_13040512_-_439nt
GATGGATGAAAATTATAACCTCTTGCCTCACGGAGTCAATTTCCAAGATGCCATCTTCCCAGACACTCAAGAGAACAGAAGGATGTTTTC
TAGCCTTTTCCAGTTTTCAAACTGTTCGCAAGGGCAGCAGCTGGCGACTTTCTCCAGTGACTGGGAAATCCAGGAAGACAGTAGGCTCAT
GTGCTCCTCGGTGCAGAAGGCCTTGTTTGAGGAGGAGGACCACGTCAAGAAACTGCAGCAGAAAGTGGCCACCCTGGAGAAGCGCAACCG
GCAGCTCCGGGAGCGAGTGAAGAAGGTCAAGAGGTCCTTGCGGCAGGCGCGTAAGAAGGGCCGCCACCTGGAGCTGGCGAACCAGAAACT

>In-frame_ZNF585A_ENST00000355533_chr19_37646767_-_CCDC3_ENST00000378825_chr10_13040512_-_439nt
GATGGATGAAAATTATAACCTCTTGCCTCACGGAGTCAATTTCCAAGATGCCATCTTCCCAGACACTCAAGAGAACAGAAGGATGTTTTC
TAGCCTTTTCCAGTTTTCAAACTGTTCGCAAGGGCAGCAGCTGGCGACTTTCTCCAGTGACTGGGAAATCCAGGAAGACAGTAGGCTCAT
GTGCTCCTCGGTGCAGAAGGCCTTGTTTGAGGAGGAGGACCACGTCAAGAAACTGCAGCAGAAAGTGGCCACCCTGGAGAAGCGCAACCG
GCAGCTCCGGGAGCGAGTGAAGAAGGTCAAGAGGTCCTTGCGGCAGGCGCGTAAGAAGGGCCGCCACCTGGAGCTGGCGAACCAGAAACT


* Fusion transcript sequences (Full-length transcript).
>In-frame_ZNF585A_ENST00000292841_chr19_37646767_-_CCDC3_ENST00000378825_chr10_13040512_-_2853nt
GGACCGGAAGTGGAAGTGGTCTTCCAAGGCTTTTTTGCCGCTGGTGTCAGGAGTATTTTCATATTCCAATACCGATAAATCTTTGAGGTT
TCTGGGTGTCTCTGGGGAGCCCCTGGGCCAGATTTTCCTCTAGACTCCAGCCCATCTCTTCAGAGCAGCTCTGCTTGAGTTCACAGATGA
CTGCCAAGCTTCAGACACCCTACAGAAAAAGGGTTGAGACCCAGTGTGGCCATGCCAGCTAATTGGACCTCACCTCAGAAATCCTCAGCC
CTGGCTCCAGAGGATCATGGCAGCTCCTATGAGTGTTAACCTTGATGCCTGAAAGAACTGGAAATTATGAAGATAGATTCAGAAGTCAAA
TATGTTAACTAACTGCATTGAAGAGTAGAAGAAAACAATAGCCTAGGATCAGTGTCCTTCAGGGATGTGGCTATCGATTTCAGCAGAGAG
GAATGGCGGCACCTGGACCCTTCTCAGAGAAACCTGTACCGGGATGTGATGCTGGAGACCTACAGCCACCTGCTCTCAGTAGGATATCAA
GTTCCTGAAGCAGAGGTGGTCATGTTGGAGCAAGGAAAGGAACCATGGGCACTGCAGGGTGAGAGGCCACGTCAGAGCTGCCCAGGATGG
ATGAAAATTATAACCTCTTGCCTCACGGAGTCAATTTCCAAGATGCCATCTTCCCAGACACTCAAGAGAACAGAAGGATGTTTTCTAGCC
TTTTCCAGTTTTCAAACTGTTCGCAAGGGCAGCAGCTGGCGACTTTCTCCAGTGACTGGGAAATCCAGGAAGACAGTAGGCTCATGTGCT
CCTCGGTGCAGAAGGCCTTGTTTGAGGAGGAGGACCACGTCAAGAAACTGCAGCAGAAAGTGGCCACCCTGGAGAAGCGCAACCGGCAGC
TCCGGGAGCGAGTGAAGAAGGTCAAGAGGTCCTTGCGGCAGGCGCGTAAGAAGGGCCGCCACCTGGAGCTGGCGAACCAGAAACTCAGTG
AGAAGCTGGCGGCGGGCGCGCTGCCGCACATCAATGCCCGGGGGCCCGTGCGCCCCCCCTACCTGCGGGGGTAACGGGCCTGGGGGCTGC
CAGGTGTGCAGGGCCAATCCTGACGGTAATTGAGAATGAGTGAGGTTTCGTACATGCAGCTATTTCAAGGGTTGTAAGAGTTTTTGTTTT
TAATCACGCATTTGGTAGAGTCTAAATGGATAAAATGCAAGGCTTGCTTTCCCCTTGGGTGCTGGCCTCAATGTCAGACCCCACGCGCTG
CCCCTTCCTGGCCTGACCCCAGACGCAGTGCCTGGCAGTCCAGAGGCAGTGGGATCCCTGAGTGCTGAATGCTCGCCTGCAGAGCAGCCC
AGAAAGAGCCCTGACTGGGGAGAGAACATTTTAGAATCTCTAGTGTAAAAGACATCAACGTGCTTAGCCTTTATTTCAGAAAAAAATCAG
GGTGGTTCCCAGCTCCCCAGTCCAGGACAACCATTAGTCCTGATGAGTGAGCTGACGCTGGTGCTGGAACCTGCTGGCACCTCACTGGCC
ACATCTTTGGAAGGGGATGGTGGCCTTGCATCCAAGATGCCTGAAAATCAGCACGTGCAGGGCCTCCCTATCCAGCCAGCATTTTCCTTC
CAGCTGAGGCAGGTGAAGACTTCATAAGCTCATCACAGGGGAGGGAATTAGGAGCAGGGCAGCAGGTAATTAAACAAGATAAATTATACC
TGATTTCCAACACCAGCTACAAAGAGTTGAAGATGATACCTATGGGTCGCGTTAACACAGGGGGCAACTGCCTTGATCGGCCTGCCATGG
GTCATCAGACTGCTTCCTAAATTGAGAGAAACTGAGCAATCTCTCAGCCACTGCTATAGTCTAACTTCTTGTTTGCTGAGTAATTGTTTC
TAATGTCTCTGAACTCAAAGTGAGGTGCTCCAAGACGCTGTGAACTTCTGCAAAGACACCTCCTTACCTACTGGGATCACGTGACCTGAC
CTCACTCCCAGCCAGGCTCCCAAAGGGCTCATTCCAGCCATTCCAATCTCTTCTTCTTTATGCAAACACTTTTCCCCCACAACAAGCCTT
GTTTGTTCCGATAGGAATACGTGTACGTCAGTGCACTTGTCCTTACGTCAGTTCCTTACACCACCAAAGCACTTCACCTTTCTGGAAATA
AAACTTTTAAGACACTACTATAAGTAAAAATGAGAGTATTCACTAGACTTATTGCTCAGGCACATTTGAGTGGGTCCCAGCTGTGTGATT
AAGAAGTCAACTGGGTGGCCTTTTCTGGGTTATCTTCTGATCATGGCCTTTCAACCCAACAAGGGCCCTTCCCTGCTCTTCCACCAGTAA
AGGCTCCTGGCCTCTCATCAGGATCTGCCCCCCAGAGACCCCCCCCAGACACTGCAGGGCCTGGTGATGCTGTCCTCTGTACCGGAAATG
GCAGGCACTGTCAGATTTCCACTCTTCTGCCTTTAGGAAGGCTGGGTGCTTCTTGCTCTGACAGCCAGTCTGGGGAGATGACTCTTACGT
TGCTTGAGTCTTGGTGGCAGGCTGCTGTCCACGGGGGAGAAGTCTCTGCTCTGGACTGGACAGAAGAGAGACTTTTACCCTGGGGCACTC
ACACGGCCAAGCTTCTGCCACCACTTCATTAGCTGTATTCTCCATAGTATGGTGAAATAGCAGGTGCGTCTTCTAGTTTATTCCTCCTGG
GGACATTTCCTCAAAGCAGTTTTGCGCCCCCGCAAGGGAATGGTCAGCCTAAGGGTAATGTACAGCCCGTGCTTGGAGAACCATGGAAGC

>In-frame_ZNF585A_ENST00000355533_chr19_37646767_-_CCDC3_ENST00000378825_chr10_13040512_-_2853nt
GGACCGGAAGTGGAAGTGGTCTTCCAAGGCTTTTTTGCCGCTGGTGTCAGGAGTATTTTCATATTCCAATACCGATAAATCTTTGAGGTT
TCTGGGTGTCTCTGGGGAGCCCCTGGGCCAGATTTTCCTCTAGACTCCAGCCCATCTCTTCAGAGCAGCTCTGCTTGAGTTCACAGATGA
CTGCCAAGCTTCAGACACCCTACAGAAAAAGGGTTGAGACCCAGTGTGGCCATGCCAGCTAATTGGACCTCACCTCAGAAATCCTCAGCC
CTGGCTCCAGAGGATCATGGCAGCTCCTATGAGTGTTAACCTTGATGCCTGAAAGAACTGGAAATTATGAAGATAGATTCAGAAGTCAAA
TATGTTAACTAACTGCATTGAAGAGTAGAAGAAAACAATAGCCTAGGATCAGTGTCCTTCAGGGATGTGGCTATCGATTTCAGCAGAGAG
GAATGGCGGCACCTGGACCCTTCTCAGAGAAACCTGTACCGGGATGTGATGCTGGAGACCTACAGCCACCTGCTCTCAGTAGGATATCAA
GTTCCTGAAGCAGAGGTGGTCATGTTGGAGCAAGGAAAGGAACCATGGGCACTGCAGGGTGAGAGGCCACGTCAGAGCTGCCCAGGATGG
ATGAAAATTATAACCTCTTGCCTCACGGAGTCAATTTCCAAGATGCCATCTTCCCAGACACTCAAGAGAACAGAAGGATGTTTTCTAGCC
TTTTCCAGTTTTCAAACTGTTCGCAAGGGCAGCAGCTGGCGACTTTCTCCAGTGACTGGGAAATCCAGGAAGACAGTAGGCTCATGTGCT
CCTCGGTGCAGAAGGCCTTGTTTGAGGAGGAGGACCACGTCAAGAAACTGCAGCAGAAAGTGGCCACCCTGGAGAAGCGCAACCGGCAGC
TCCGGGAGCGAGTGAAGAAGGTCAAGAGGTCCTTGCGGCAGGCGCGTAAGAAGGGCCGCCACCTGGAGCTGGCGAACCAGAAACTCAGTG
AGAAGCTGGCGGCGGGCGCGCTGCCGCACATCAATGCCCGGGGGCCCGTGCGCCCCCCCTACCTGCGGGGGTAACGGGCCTGGGGGCTGC
CAGGTGTGCAGGGCCAATCCTGACGGTAATTGAGAATGAGTGAGGTTTCGTACATGCAGCTATTTCAAGGGTTGTAAGAGTTTTTGTTTT
TAATCACGCATTTGGTAGAGTCTAAATGGATAAAATGCAAGGCTTGCTTTCCCCTTGGGTGCTGGCCTCAATGTCAGACCCCACGCGCTG
CCCCTTCCTGGCCTGACCCCAGACGCAGTGCCTGGCAGTCCAGAGGCAGTGGGATCCCTGAGTGCTGAATGCTCGCCTGCAGAGCAGCCC
AGAAAGAGCCCTGACTGGGGAGAGAACATTTTAGAATCTCTAGTGTAAAAGACATCAACGTGCTTAGCCTTTATTTCAGAAAAAAATCAG
GGTGGTTCCCAGCTCCCCAGTCCAGGACAACCATTAGTCCTGATGAGTGAGCTGACGCTGGTGCTGGAACCTGCTGGCACCTCACTGGCC
ACATCTTTGGAAGGGGATGGTGGCCTTGCATCCAAGATGCCTGAAAATCAGCACGTGCAGGGCCTCCCTATCCAGCCAGCATTTTCCTTC
CAGCTGAGGCAGGTGAAGACTTCATAAGCTCATCACAGGGGAGGGAATTAGGAGCAGGGCAGCAGGTAATTAAACAAGATAAATTATACC
TGATTTCCAACACCAGCTACAAAGAGTTGAAGATGATACCTATGGGTCGCGTTAACACAGGGGGCAACTGCCTTGATCGGCCTGCCATGG
GTCATCAGACTGCTTCCTAAATTGAGAGAAACTGAGCAATCTCTCAGCCACTGCTATAGTCTAACTTCTTGTTTGCTGAGTAATTGTTTC
TAATGTCTCTGAACTCAAAGTGAGGTGCTCCAAGACGCTGTGAACTTCTGCAAAGACACCTCCTTACCTACTGGGATCACGTGACCTGAC
CTCACTCCCAGCCAGGCTCCCAAAGGGCTCATTCCAGCCATTCCAATCTCTTCTTCTTTATGCAAACACTTTTCCCCCACAACAAGCCTT
GTTTGTTCCGATAGGAATACGTGTACGTCAGTGCACTTGTCCTTACGTCAGTTCCTTACACCACCAAAGCACTTCACCTTTCTGGAAATA
AAACTTTTAAGACACTACTATAAGTAAAAATGAGAGTATTCACTAGACTTATTGCTCAGGCACATTTGAGTGGGTCCCAGCTGTGTGATT
AAGAAGTCAACTGGGTGGCCTTTTCTGGGTTATCTTCTGATCATGGCCTTTCAACCCAACAAGGGCCCTTCCCTGCTCTTCCACCAGTAA
AGGCTCCTGGCCTCTCATCAGGATCTGCCCCCCAGAGACCCCCCCCAGACACTGCAGGGCCTGGTGATGCTGTCCTCTGTACCGGAAATG
GCAGGCACTGTCAGATTTCCACTCTTCTGCCTTTAGGAAGGCTGGGTGCTTCTTGCTCTGACAGCCAGTCTGGGGAGATGACTCTTACGT
TGCTTGAGTCTTGGTGGCAGGCTGCTGTCCACGGGGGAGAAGTCTCTGCTCTGGACTGGACAGAAGAGAGACTTTTACCCTGGGGCACTC
ACACGGCCAAGCTTCTGCCACCACTTCATTAGCTGTATTCTCCATAGTATGGTGAAATAGCAGGTGCGTCTTCTAGTTTATTCCTCCTGG
GGACATTTCCTCAAAGCAGTTTTGCGCCCCCGCAAGGGAATGGTCAGCCTAAGGGTAATGTACAGCCCGTGCTTGGAGAACCATGGAAGC


Top

FusionGenePPI for ZNF585A_CCDC3


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
ZNF585ACBX5CCDC3


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for ZNF585A_CCDC3


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for ZNF585A_CCDC3


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource