FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 40734

FusionGeneSummary for UHRF1BP1L_PXK

check button Fusion gene summary
Fusion gene informationFusion gene name: UHRF1BP1L_PXK
Fusion gene ID: 40734
HgeneTgene
Gene symbol

UHRF1BP1L

PXK

Gene ID

23074

54899

Gene nameUHRF1 binding protein 1 likePX domain containing serine/threonine kinase like
SynonymsSHIP164MONAKA|SLOB
Cytomap

12q23.1

3p14.3

Type of geneprotein-codingprotein-coding
DescriptionUHRF1-binding protein 1-likeUHRF1 (ICBP90) binding protein 1-likesyntaxin 6Habc-interacting protein of 164 kDasyntaxin-6 Habc-interacting protein of 164 kDaPX domain-containing protein kinase-like proteinPX ser/thr kinase v2PX serine/threonine kinasemodulator of Na,K-ATPase long form
Modification date2018051920180523
UniProtAcc

A0JNW5

Q7Z7A4

Ensembl transtripts involved in fusion geneENST00000279907, ENST00000356828, 
ENST00000545232, 
ENST00000356151, 
ENST00000302779, ENST00000383716, 
ENST00000463280, ENST00000383715, 
ENST00000484288, ENST00000479241, 
ENST00000536660, 
Fusion gene scores* DoF score10 X 6 X 5=3003 X 3 X 1=9
# samples 95
** MAII scorelog2(9/300*10)=-1.73696559416621
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(5/9*10)=2.47393118833241
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: UHRF1BP1L [Title/Abstract] AND PXK [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationKinase involved fusion gene, inframe and retained kinase domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1BC108670UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
ChiTaRS3.1BG166334UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000279907ENST00000356151UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000279907ENST00000302779UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000279907ENST00000383716UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000279907ENST00000463280UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000279907ENST00000383715UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000279907ENST00000484288UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000279907ENST00000479241UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000279907ENST00000536660UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
In-frameENST00000356828ENST00000356151UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000356828ENST00000302779UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000356828ENST00000383716UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000356828ENST00000463280UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000356828ENST00000383715UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000356828ENST00000484288UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000356828ENST00000479241UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
5CDS-intronENST00000356828ENST00000536660UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-3CDSENST00000545232ENST00000356151UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-intronENST00000545232ENST00000302779UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-intronENST00000545232ENST00000383716UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-intronENST00000545232ENST00000463280UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-intronENST00000545232ENST00000383715UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-intronENST00000545232ENST00000484288UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-intronENST00000545232ENST00000479241UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+
intron-intronENST00000545232ENST00000536660UHRF1BP1Lchr12

100536369

-PXKchr3

58351599

+

Top

FusionProtFeatures for UHRF1BP1L_PXK


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
UHRF1BP1L

A0JNW5

PXK

Q7Z7A4


check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgenePXKchr12:100536369chr3:58351599ENST00000302779+01714_126-33562DomainPX
TgenePXKchr12:100536369chr3:58351599ENST00000302779+017548_567-33562DomainWH2
TgenePXKchr12:100536369chr3:58351599ENST00000302779+01788_481-33562DomainProtein kinase
TgenePXKchr12:100536369chr3:58351599ENST00000356151+018548_56734579DomainWH2
TgenePXKchr12:100536369chr3:58351599ENST00000356151+01888_48134579DomainProtein kinase
TgenePXKchr12:100536369chr3:58351599ENST00000383716+01614_126-33546DomainPX
TgenePXKchr12:100536369chr3:58351599ENST00000383716+016548_567-33546DomainWH2
TgenePXKchr12:100536369chr3:58351599ENST00000383716+01688_481-33546DomainProtein kinase
TgenePXKchr12:100536369chr3:58351599ENST00000479241+01814_126-14564DomainPX
TgenePXKchr12:100536369chr3:58351599ENST00000479241+018548_567-14564DomainWH2
TgenePXKchr12:100536369chr3:58351599ENST00000479241+01888_481-14564DomainProtein kinase
TgenePXKchr12:100536369chr3:58351599ENST00000484288+018548_56734516DomainWH2
TgenePXKchr12:100536369chr3:58351599ENST00000484288+01888_48134516DomainProtein kinase
TgenePXKchr12:100536369chr3:58351599ENST00000536660+01514_126-53442DomainPX
TgenePXKchr12:100536369chr3:58351599ENST00000536660+015548_567-53442DomainWH2
TgenePXKchr12:100536369chr3:58351599ENST00000536660+01588_481-53442DomainProtein kinase

- In-frame and not-retained protein feature among the 13 regional features.
>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneUHRF1BP1Lchr12:100536369chr3:58351599ENST00000279907-1211418_1456141465Coiled coilOntology_term=ECO:0000255
HgeneUHRF1BP1Lchr12:100536369chr3:58351599ENST00000356828-1131418_145614523Coiled coilOntology_term=ECO:0000255
HgeneUHRF1BP1Lchr12:100536369chr3:58351599ENST00000545232-1151418_1456-841115Coiled coilOntology_term=ECO:0000255
TgenePXKchr12:100536369chr3:58351599ENST00000356151+01814_12634579DomainPX
TgenePXKchr12:100536369chr3:58351599ENST00000484288+01814_12634516DomainPX


Top

FusionGeneSequence for UHRF1BP1L_PXK


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_UHRF1BP1L_ENST00000279907_chr12_100536369_-_PXK_ENST00000356151_chr3_58351599_+_2083nt
AGATGGCGCCCGCGGCGGCCGTGGCGGCCTGAGCGTGATGCTCCGGGTTCTCGGCGGCGGCTGTGGCCTTGGCCGGGGCCTTGGGTCTCT
CCCGGTCGTGAGCGATCAGCGCCTCTCCGCCGGCCGGGCTAGCCGGGACAGAGAGGAGACGGCCACGAAGAGAGGAGGCAGTGAGCAACA
GGACGAGACCGCGGCGTCTCCAGCCTCGGTACCATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGGAATATATTATTC
GAGTGCAAAGAGGAATTTCTGTGGAAAACAGCTGGCAGATTGTTAGAAGATACAGTGACTTTGATTTGCTTAACAACAGCTTACAGATTG
CAGGCCTAAGTCTACCTCTTCCTCCCAAAAAATTGATTGGTAACATGGATCGTGAATTCATAGCTGAAAGGCAGAAAGGTCTTCAGAACT
ATCTCAACGTGATCACAACAAATCATATCTTGTCTAATTGTGAGCTGGTTAAGAAGTTTTTAGATCCAAACAACTATTCCGCAAACTATA
CTGAGATTGCCTTGCAACAGGTTTCCATGTTCTTCCGATCAGAACCAAAGTGGGAGGTGGTGGAACCTTTGAAAGACATAGGTTGGAGAA
TAAGGAAGAAATATTTCTTGATGAAGATTAAAAATCAGCCAAAGGAACGGCTAGTGTTAAGCTGGGCTGACCTTGGCCCAGACAAGTATT
TGTCAGATAAAGATTTTCAGTGTCTAATCAAACTTCTGCCTTCTTGTTTGCACCCTTACATCTATCGGGTTACCTTTGCCACAGCTAATG
AATCCTCAGCGTTGCTAATTAGGATGTTTAACGAAAAGGGAACATTGAAGGATCTGATCTACAAGGCAAAACCAAAAGACCCATTTCTAA
AGAAGTACTGCAACCCTAAGAAGATTCAGGGCCTGGAACTCCAGCAAATAAAAACATATGGACGGCAAATATTAGAGGTACTGAAGTTTC
TTCATGACAAGGGATTCCCTTATGGGCATCTTCACGCCTCCAATGTGATGCTCGATGGGGACACTTGCCGGCTGCTGGACCTTGAGAATT
CCTTATTGGGCCTGCCTTCCTTCTACCGATCTTATTTTTCACAATTCAGGAAAATCAATACATTGGAAAGTGTGGATGTCCACTGCTTTG
GCCACTTACTGTATGAAATGACTTATGGACGACCGCCAGACTCGGTGCCTGTGGACTCCTTCCCTCCTGCCCCGTCCATGGCTGTGGTGG
CCGTGTTGGAGTCTACGCTGTCTTGTGAAGCCTGTAAAAATGGCATGCCTACCATCTCCCGGCTCTTACAGATGCCATTATTCAGCGATG
TTTTACTAACCACTTCTGAAAAACCACAGTTTAAGATCCCTACAAAGTTAAAAGAGGCATTGAGAATTGCCAAAGAATGTATAGAGAAGA
GACTAATTGAGGAACAGAAACAGATTCACCAGCATCGAAGACTGACAAGAGCTCAGTCCCACCATGGATCTGAGGAGGAAAGAAAAAAAA
GAAAGATTTTAGCTCGAAAGAAGTCAAAACGATCTGCTCTTGAAAATAGTGAAGAGCATTCAGCGAAGTACAGCAACTCCAATAATTCAG
CAGGATCTGGGGCCAGCTCACCTCTCACGTCCCCGTCATCGCCAACTCCACCCTCTACATCAGGGATATCTGCATTACCTCCACCTCCTC
CACCTCCACCACCACCAGCAGCTCCCTTGCCTCCTGCGAGCACCGAGGCACCTGCCCAGCTCTCGTCTCAGGCTGTGAATGGCATGAGCC
GAGGGGCCTTGCTCAGCTCCATCCAGAATTTCCAAAAAGGAACTTTGAGGAAAGCCAAAACCTGTGATCACAGTGCTCCGAAGATCGGCT
GAAGCTTCCTGTTTACACTTGGAGGGAAAAGTTCTTTTTTATTCCTACTCACCCCTACCCCCCAAACTACCCTCTTCCTGGGAAAGTAAT
TGCTGAGCCAGTACAGCCACAAACAGTACTATTTTGCAGATGCTCATGTAAGCAGCTTTTCGAGAGAAATAATTCTTTAAGCAGAATAAA

>In-frame_UHRF1BP1L_ENST00000356828_chr12_100536369_-_PXK_ENST00000356151_chr3_58351599_+_2082nt
GATGGCGCCCGCGGCGGCCGTGGCGGCCTGAGCGTGATGCTCCGGGTTCTCGGCGGCGGCTGTGGCCTTGGCCGGGGCCTTGGGTCTCTC
CCGGTCGTGAGCGATCAGCGCCTCTCCGCCGGCCGGGCTAGCCGGGACAGAGAGGAGACGGCCACGAAGAGAGGAGGCAGTGAGCAACAG
GACGAGACCGCGGCGTCTCCAGCCTCGGTACCATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGGAATATATTATTCG
AGTGCAAAGAGGAATTTCTGTGGAAAACAGCTGGCAGATTGTTAGAAGATACAGTGACTTTGATTTGCTTAACAACAGCTTACAGATTGC
AGGCCTAAGTCTACCTCTTCCTCCCAAAAAATTGATTGGTAACATGGATCGTGAATTCATAGCTGAAAGGCAGAAAGGTCTTCAGAACTA
TCTCAACGTGATCACAACAAATCATATCTTGTCTAATTGTGAGCTGGTTAAGAAGTTTTTAGATCCAAACAACTATTCCGCAAACTATAC
TGAGATTGCCTTGCAACAGGTTTCCATGTTCTTCCGATCAGAACCAAAGTGGGAGGTGGTGGAACCTTTGAAAGACATAGGTTGGAGAAT
AAGGAAGAAATATTTCTTGATGAAGATTAAAAATCAGCCAAAGGAACGGCTAGTGTTAAGCTGGGCTGACCTTGGCCCAGACAAGTATTT
GTCAGATAAAGATTTTCAGTGTCTAATCAAACTTCTGCCTTCTTGTTTGCACCCTTACATCTATCGGGTTACCTTTGCCACAGCTAATGA
ATCCTCAGCGTTGCTAATTAGGATGTTTAACGAAAAGGGAACATTGAAGGATCTGATCTACAAGGCAAAACCAAAAGACCCATTTCTAAA
GAAGTACTGCAACCCTAAGAAGATTCAGGGCCTGGAACTCCAGCAAATAAAAACATATGGACGGCAAATATTAGAGGTACTGAAGTTTCT
TCATGACAAGGGATTCCCTTATGGGCATCTTCACGCCTCCAATGTGATGCTCGATGGGGACACTTGCCGGCTGCTGGACCTTGAGAATTC
CTTATTGGGCCTGCCTTCCTTCTACCGATCTTATTTTTCACAATTCAGGAAAATCAATACATTGGAAAGTGTGGATGTCCACTGCTTTGG
CCACTTACTGTATGAAATGACTTATGGACGACCGCCAGACTCGGTGCCTGTGGACTCCTTCCCTCCTGCCCCGTCCATGGCTGTGGTGGC
CGTGTTGGAGTCTACGCTGTCTTGTGAAGCCTGTAAAAATGGCATGCCTACCATCTCCCGGCTCTTACAGATGCCATTATTCAGCGATGT
TTTACTAACCACTTCTGAAAAACCACAGTTTAAGATCCCTACAAAGTTAAAAGAGGCATTGAGAATTGCCAAAGAATGTATAGAGAAGAG
ACTAATTGAGGAACAGAAACAGATTCACCAGCATCGAAGACTGACAAGAGCTCAGTCCCACCATGGATCTGAGGAGGAAAGAAAAAAAAG
AAAGATTTTAGCTCGAAAGAAGTCAAAACGATCTGCTCTTGAAAATAGTGAAGAGCATTCAGCGAAGTACAGCAACTCCAATAATTCAGC
AGGATCTGGGGCCAGCTCACCTCTCACGTCCCCGTCATCGCCAACTCCACCCTCTACATCAGGGATATCTGCATTACCTCCACCTCCTCC
ACCTCCACCACCACCAGCAGCTCCCTTGCCTCCTGCGAGCACCGAGGCACCTGCCCAGCTCTCGTCTCAGGCTGTGAATGGCATGAGCCG
AGGGGCCTTGCTCAGCTCCATCCAGAATTTCCAAAAAGGAACTTTGAGGAAAGCCAAAACCTGTGATCACAGTGCTCCGAAGATCGGCTG
AAGCTTCCTGTTTACACTTGGAGGGAAAAGTTCTTTTTTATTCCTACTCACCCCTACCCCCCAAACTACCCTCTTCCTGGGAAAGTAATT
GCTGAGCCAGTACAGCCACAAACAGTACTATTTTGCAGATGCTCATGTAAGCAGCTTTTCGAGAGAAATAATTCTTTAAGCAGAATAAAG

>In-frame_UHRF1BP1L_ENST00000279907_chr12_100536369_-_PXK_ENST00000356151_chr3_58351599_+_2083nt
AGATGGCGCCCGCGGCGGCCGTGGCGGCCTGAGCGTGATGCTCCGGGTTCTCGGCGGCGGCTGTGGCCTTGGCCGGGGCCTTGGGTCTCT
CCCGGTCGTGAGCGATCAGCGCCTCTCCGCCGGCCGGGCTAGCCGGGACAGAGAGGAGACGGCCACGAAGAGAGGAGGCAGTGAGCAACA
GGACGAGACCGCGGCGTCTCCAGCCTCGGTACCATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGGAATATATTATTC
GAGTGCAAAGAGGAATTTCTGTGGAAAACAGCTGGCAGATTGTTAGAAGATACAGTGACTTTGATTTGCTTAACAACAGCTTACAGATTG
CAGGCCTAAGTCTACCTCTTCCTCCCAAAAAATTGATTGGTAACATGGATCGTGAATTCATAGCTGAAAGGCAGAAAGGTCTTCAGAACT
ATCTCAACGTGATCACAACAAATCATATCTTGTCTAATTGTGAGCTGGTTAAGAAGTTTTTAGATCCAAACAACTATTCCGCAAACTATA
CTGAGATTGCCTTGCAACAGGTTTCCATGTTCTTCCGATCAGAACCAAAGTGGGAGGTGGTGGAACCTTTGAAAGACATAGGTTGGAGAA
TAAGGAAGAAATATTTCTTGATGAAGATTAAAAATCAGCCAAAGGAACGGCTAGTGTTAAGCTGGGCTGACCTTGGCCCAGACAAGTATT
TGTCAGATAAAGATTTTCAGTGTCTAATCAAACTTCTGCCTTCTTGTTTGCACCCTTACATCTATCGGGTTACCTTTGCCACAGCTAATG
AATCCTCAGCGTTGCTAATTAGGATGTTTAACGAAAAGGGAACATTGAAGGATCTGATCTACAAGGCAAAACCAAAAGACCCATTTCTAA
AGAAGTACTGCAACCCTAAGAAGATTCAGGGCCTGGAACTCCAGCAAATAAAAACATATGGACGGCAAATATTAGAGGTACTGAAGTTTC
TTCATGACAAGGGATTCCCTTATGGGCATCTTCACGCCTCCAATGTGATGCTCGATGGGGACACTTGCCGGCTGCTGGACCTTGAGAATT
CCTTATTGGGCCTGCCTTCCTTCTACCGATCTTATTTTTCACAATTCAGGAAAATCAATACATTGGAAAGTGTGGATGTCCACTGCTTTG
GCCACTTACTGTATGAAATGACTTATGGACGACCGCCAGACTCGGTGCCTGTGGACTCCTTCCCTCCTGCCCCGTCCATGGCTGTGGTGG
CCGTGTTGGAGTCTACGCTGTCTTGTGAAGCCTGTAAAAATGGCATGCCTACCATCTCCCGGCTCTTACAGATGCCATTATTCAGCGATG
TTTTACTAACCACTTCTGAAAAACCACAGTTTAAGATCCCTACAAAGTTAAAAGAGGCATTGAGAATTGCCAAAGAATGTATAGAGAAGA
GACTAATTGAGGAACAGAAACAGATTCACCAGCATCGAAGACTGACAAGAGCTCAGTCCCACCATGGATCTGAGGAGGAAAGAAAAAAAA
GAAAGATTTTAGCTCGAAAGAAGTCAAAACGATCTGCTCTTGAAAATAGTGAAGAGCATTCAGCGAAGTACAGCAACTCCAATAATTCAG
CAGGATCTGGGGCCAGCTCACCTCTCACGTCCCCGTCATCGCCAACTCCACCCTCTACATCAGGGATATCTGCATTACCTCCACCTCCTC
CACCTCCACCACCACCAGCAGCTCCCTTGCCTCCTGCGAGCACCGAGGCACCTGCCCAGCTCTCGTCTCAGGCTGTGAATGGCATGAGCC
GAGGGGCCTTGCTCAGCTCCATCCAGAATTTCCAAAAAGGAACTTTGAGGAAAGCCAAAACCTGTGATCACAGTGCTCCGAAGATCGGCT
GAAGCTTCCTGTTTACACTTGGAGGGAAAAGTTCTTTTTTATTCCTACTCACCCCTACCCCCCAAACTACCCTCTTCCTGGGAAAGTAAT
TGCTGAGCCAGTACAGCCACAAACAGTACTATTTTGCAGATGCTCATGTAAGCAGCTTTTCGAGAGAAATAATTCTTTAAGCAGAATAAA

>In-frame_UHRF1BP1L_ENST00000356828_chr12_100536369_-_PXK_ENST00000356151_chr3_58351599_+_2082nt
GATGGCGCCCGCGGCGGCCGTGGCGGCCTGAGCGTGATGCTCCGGGTTCTCGGCGGCGGCTGTGGCCTTGGCCGGGGCCTTGGGTCTCTC
CCGGTCGTGAGCGATCAGCGCCTCTCCGCCGGCCGGGCTAGCCGGGACAGAGAGGAGACGGCCACGAAGAGAGGAGGCAGTGAGCAACAG
GACGAGACCGCGGCGTCTCCAGCCTCGGTACCATGGCCGGGATCATCAAGAAACAAATCTTGAAGCACCTCTCCAGGAATATATTATTCG
AGTGCAAAGAGGAATTTCTGTGGAAAACAGCTGGCAGATTGTTAGAAGATACAGTGACTTTGATTTGCTTAACAACAGCTTACAGATTGC
AGGCCTAAGTCTACCTCTTCCTCCCAAAAAATTGATTGGTAACATGGATCGTGAATTCATAGCTGAAAGGCAGAAAGGTCTTCAGAACTA
TCTCAACGTGATCACAACAAATCATATCTTGTCTAATTGTGAGCTGGTTAAGAAGTTTTTAGATCCAAACAACTATTCCGCAAACTATAC
TGAGATTGCCTTGCAACAGGTTTCCATGTTCTTCCGATCAGAACCAAAGTGGGAGGTGGTGGAACCTTTGAAAGACATAGGTTGGAGAAT
AAGGAAGAAATATTTCTTGATGAAGATTAAAAATCAGCCAAAGGAACGGCTAGTGTTAAGCTGGGCTGACCTTGGCCCAGACAAGTATTT
GTCAGATAAAGATTTTCAGTGTCTAATCAAACTTCTGCCTTCTTGTTTGCACCCTTACATCTATCGGGTTACCTTTGCCACAGCTAATGA
ATCCTCAGCGTTGCTAATTAGGATGTTTAACGAAAAGGGAACATTGAAGGATCTGATCTACAAGGCAAAACCAAAAGACCCATTTCTAAA
GAAGTACTGCAACCCTAAGAAGATTCAGGGCCTGGAACTCCAGCAAATAAAAACATATGGACGGCAAATATTAGAGGTACTGAAGTTTCT
TCATGACAAGGGATTCCCTTATGGGCATCTTCACGCCTCCAATGTGATGCTCGATGGGGACACTTGCCGGCTGCTGGACCTTGAGAATTC
CTTATTGGGCCTGCCTTCCTTCTACCGATCTTATTTTTCACAATTCAGGAAAATCAATACATTGGAAAGTGTGGATGTCCACTGCTTTGG
CCACTTACTGTATGAAATGACTTATGGACGACCGCCAGACTCGGTGCCTGTGGACTCCTTCCCTCCTGCCCCGTCCATGGCTGTGGTGGC
CGTGTTGGAGTCTACGCTGTCTTGTGAAGCCTGTAAAAATGGCATGCCTACCATCTCCCGGCTCTTACAGATGCCATTATTCAGCGATGT
TTTACTAACCACTTCTGAAAAACCACAGTTTAAGATCCCTACAAAGTTAAAAGAGGCATTGAGAATTGCCAAAGAATGTATAGAGAAGAG
ACTAATTGAGGAACAGAAACAGATTCACCAGCATCGAAGACTGACAAGAGCTCAGTCCCACCATGGATCTGAGGAGGAAAGAAAAAAAAG
AAAGATTTTAGCTCGAAAGAAGTCAAAACGATCTGCTCTTGAAAATAGTGAAGAGCATTCAGCGAAGTACAGCAACTCCAATAATTCAGC
AGGATCTGGGGCCAGCTCACCTCTCACGTCCCCGTCATCGCCAACTCCACCCTCTACATCAGGGATATCTGCATTACCTCCACCTCCTCC
ACCTCCACCACCACCAGCAGCTCCCTTGCCTCCTGCGAGCACCGAGGCACCTGCCCAGCTCTCGTCTCAGGCTGTGAATGGCATGAGCCG
AGGGGCCTTGCTCAGCTCCATCCAGAATTTCCAAAAAGGAACTTTGAGGAAAGCCAAAACCTGTGATCACAGTGCTCCGAAGATCGGCTG
AAGCTTCCTGTTTACACTTGGAGGGAAAAGTTCTTTTTTATTCCTACTCACCCCTACCCCCCAAACTACCCTCTTCCTGGGAAAGTAATT
GCTGAGCCAGTACAGCCACAAACAGTACTATTTTGCAGATGCTCATGTAAGCAGCTTTTCGAGAGAAATAATTCTTTAAGCAGAATAAAG


Top

FusionGenePPI for UHRF1BP1L_PXK


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
UHRF1BP1LATXN1, YWHAB, CT55, DOK3, FNTB, CDK2, YWHAZ, DYNLL1, CHD8, FERMT3, RAB8B, FAM174A, COBLL1, AMOTL1, IFFO1, CDADC1, SCML1PXKPIK3R1, EEA1, TFRC, LAMP2, ACTBL2, YBX3, FBL, HNRNPA0, ALYREF, CCKBR, TMC6, USP48, CLEC14A, EDNRB, GPRC5C


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for UHRF1BP1L_PXK


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for UHRF1BP1L_PXK


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneUHRF1BP1LC3495559Juvenile arthritis1CTD_human
TgenePXKC0003873Rheumatoid Arthritis1CTD_human
TgenePXKC0024141Lupus Erythematosus, Systemic1CTD_human