FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 39981

FusionGeneSummary for TTC39B_SPTSSA

check button Fusion gene summary
Fusion gene informationFusion gene name: TTC39B_SPTSSA
Fusion gene ID: 39981
HgeneTgene
Gene symbol

TTC39B

SPTSSA

Gene ID

158219

171546

Gene nametetratricopeptide repeat domain 39Bserine palmitoyltransferase small subunit A
SynonymsC9orf52C14orf147|SSSPTA
Cytomap

9p22.3

14q13.1

Type of geneprotein-codingprotein-coding
Descriptiontetratricopeptide repeat protein 39BTPR repeat protein 39Bserine palmitoyltransferase small subunit Asmall subunit of serine palmitoyltransferase A
Modification date2018051920180519
UniProtAcc

Q5VTQ0

Q969W0

Ensembl transtripts involved in fusion geneENST00000512701, ENST00000355694, 
ENST00000380850, ENST00000297615, 
ENST00000507285, ENST00000507993, 
ENST00000541445, ENST00000582994, 
ENST00000298130, 
Fusion gene scores* DoF score2 X 2 X 2=84 X 2 X 4=32
# samples 24
** MAII scorelog2(2/8*10)=1.32192809488736log2(4/32*10)=0.321928094887362
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: TTC39B [Title/Abstract] AND SPTSSA [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneSPTSSA

GO:0046513

ceramide biosynthetic process

25691431


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDBRCATCGA-BH-A1FM-01ATTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shiftENST00000512701ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
Frame-shiftENST00000355694ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
Frame-shiftENST00000380850ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
Frame-shiftENST00000297615ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
In-frameENST00000507285ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
Frame-shiftENST00000507993ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
intron-3CDSENST00000541445ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-
intron-3CDSENST00000582994ENST00000298130TTC39Bchr9

15182305

-SPTSSAchr14

34904510

-

Top

FusionProtFeatures for TTC39B_SPTSSA


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
TTC39B

Q5VTQ0

SPTSSA

Q969W0

Stimulates the activity of serine palmitoyltransferase(SPT). The composition of the serine palmitoyltransferase (SPT)complex determines the substrate preference. The SPTLC1-SPTLC2-SPTSSA complex shows a strong preference for C16-CoA substrate,while the SPTLC1-SPTLC3-SPTSSA isozyme uses both C14-CoA and C16-CoA as substrates, with a slight preference for C14-CoA.{ECO:0000269|PubMed:19416851}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for TTC39B_SPTSSA


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_TTC39B_ENST00000507285_chr9_15182305_-_SPTSSA_ENST00000298130_chr14_34904510_-_34aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_TTC39B_ENST00000507285_chr9_15182305_-_SPTSSA_ENST00000298130_chr14_34904510_-_104nt
ATTCCATGCTGGTTTCCATTGTGGGGATGGCACTATACACAGGATACGTCTTCATGCCCCAGCACATCATGGCGATATTGCACTACTTTG


* Fusion transcript sequences (Full-length transcript).
>In-frame_TTC39B_ENST00000507285_chr9_15182305_-_SPTSSA_ENST00000298130_chr14_34904510_-_4343nt
ATGTTGGTTTCTTCTCATCTAGAGAGGCTACTGCTTTTTCTTTTTGAATTTATTTTCATTTAGATGGGCGTCCCCCCCACCTCCCGTTTC
CACCTCTTCTAGGGGTGTAACTATAGCGTTAGTATGTTGGGTAGGGTCTTTTGGGTTCGCTTCTAAGGCCCTGCGCGATTCTGTCTGCAG
GTTTTATATTGGTCTGTGCAGTTTGACCTGGAGATCTTCTCACTCAGATATGGCAACAAGCAGCCTTCACTTTGCATCATGTGATACACA
ACAGGCGCCCAGACAGCGCGGAGCGTCTACTGTCAGCAGAGAGCCATAACAAAAGAGAAGAGAATGGAGGAAGGAACCTTTTGGGAACAC
AGAACATTGAAGCATGGCTGAGACAGTGACCGTTCAAACAAGAGCTACATAGATGTGTGAGAGAGGAAGACTACAAGTTGGTGGCCACAG
GACAGGCAAGGGACTTGGGGGAAGGTTCATCATCAACCAAGGTGGATCTCAAGAGTGGCCTCGAAGAATGTGCTGTGGCATTGAACTTAT
TTCTAAGCAACAAATTTACAGACGCCTTAGAATTGCTTCGCCCCTGGGCTAAGGAGAGTATGTACCATGCCTTGGGCTACAGTACCATTG
TGGTGTTGCAGGCTGTCCTGACCTTCGAGCAACAGGACATCCAGAACGGCATTTCTGCCATGAAGGACGCTTTACAAACCTGCCAAAAAT
ACAGGAAAAAATACACAGTTGTAGAATCTTTCTCAAGTCTTCTTTCTAGAGGATCCCTGGAGCAACTGAGTGAAGAGGAAATGCATGCTG
AAATCTGTTATGCCGAGTGTCTCCTACAGAAAGCTGCACTCACGTTTGTGCAGGATGAAAATATGATCAACTTCATCAAAGGTGGACTCA
AAATTAGAACAAGTTACCAAATATATAAAGAATGTCTTTCTATCCTGCATGAAATTCAGAAGAACAAACTTCAGCAGGAATTCTTCTATG
AGTTTGAAGGGGGTGTCAAGCTTGGCAGTGGGGCCTTTAATTTGATGCTGTCCCTTTTACCAGCAAGGATTATCAGACTACTAGAATTTA
TTGGATTTTCTGGGAATAGGGAGTTGGGCCTCCTGCAGTTACGTGAAGGTGCTTCAGGAAGGAGCATGAGGTCTGCACTGTGCTGCTTAA
CCATCTTAGCTTTTCATACTTACATCTCCCTAATACTTGGTACAGGAGAAGTGAATGTTGCGGAAGCAGAGCGTCTCCTGGCACCCTTCC
TCCAGCAGTTTCCAAATGGCTCACTCGTGTTGTTTTATCATGCCCGAATAGAGTTGCTGAAAGGGAATCTTGAAGAGGCACAAGAAGTAT
TTCAAAAATGCATTTCAGTTCAAGAAGAATGGAAACAGTTTCACCATCTCTGCTACTGGGAGCTAATGTGGATTAATGTTTTCCAACAAA
ACTGGATGCAGGCATATTACTATTCAGATCTGCTTTGCAAAGAGAGTAAATGGTCCAAGGCAACTTATGTGTTCTTGAAAGCAGCAATTT
TGAGTATGCTTCCAGAGGAGGATGTAGTAGCAACGAATGAGAATGTGGTAACTTTATTCAGACAGGTGGACAGCTTGAAGCAGAGAATTG
CCGGGAAATCTATCCCTACTGAGAAGTTTGCTGTGAGGAAGGCTCGGCGTTACTCCGCCTCCTTACCTGCACCTGTGAAGCTCATCTTAC
CTGCCCTGGAAATGATGTATGTCTGGAATGGTTTTTCAATAGTGAGCAAAAGAAAAGACCTTTCTGAAAATCTGTTAGTAACTGTTGAAA
AAGCTGAGGCAGCTTTACAAAGTCAAAATTCCATGCTGGTTTCCATTGTGGGGATGGCACTATACACAGGATACGTCTTCATGCCCCAGC
ACATCATGGCGATATTGCACTACTTTGAAATCGTACAATGACCAAGATGCGACCAGGATCAGAGGTTCCTTGGGGAAGACCCACCCTACG
AAGTTGGAATGAGACCATCAGATGTGATAAGAAACTCTTCTAGATGTCAACATAACCAACCTTATAAAGACTAAAATTCATGAGTAGAAC
AGGAAAATCATCCTGACTCATGTGTTGTGTTCTTTATTTTTAATTTTCAAAGAGGCTCTTGTATAGCAGTTTTTGTCTATTTTAACATTG
TAGTCATTTGTACTTTGATATCAGTATTTTCTTAACCTTTGTGACTGTTTCAATATTACCCCCGTGAAAGCTTTTCTTAATGTAACTTTG
AGTACATTTTAATTGCCTTCTATTTTTAAAACTCAAAATCATTAGTTGGGCTTTACTGTTCTTGCTATTGTATGGCATATACATCTGCCT
GGATATATTTCTACTCTTGACCAAAGTTTTGTAAAGAACAATATAAGATTTCGGGTAGGGGTATGGGGAGGGAAGATATTTTATTGAGAA
CTACTTAACAAAAGATTTATCTGTAAGCTTGAACTCAGGAGTACAGTTTTAGCTATCTAGACTCTAACAGCTTTTGCTTTAAAATTATTA
AAGTGTTTCTTAATGAAAAAGAAAAGATCTTGCTAAAGTTAAAATAAGGAACATTTCACCTTTTAAATATTTAATTCTTATGTGGACTTA
TTTCCAGAAAACTTTGGTGATAATTCTTGAGACAAAAGGTGGTTAAGTAGCATTATTATGTAATGCTTATATACCATAGAGTTTTTAATA
GAAGAGAAATCCATTTCCTCCGAGGGTCACTATTAACAATGTACTTCCTTAAATTTAGTTTAATGATTGTAATGGGTGCTGCATTTGCAC
ATTGCATTAAGTTATGATGAGACGAATTGTTGTTAAAAATTATAGCAAAAAGAAATGTAAACTTGGTTAAAATCCTTTCACTCTTTGTAT
TGTTTTTTTTAAGGTTTTTATTCCTTAAATGTAAAATGACTACCTAATTTTTTGATGTAAATACATTAAATTCAAAGAGAAAAAAAATCA
GCTGATGTAGCAGTATATCTTTTCCTTGATGGTTAAATATTGATCTAGTATTTATATTGCTGAATTATTTTCTGTGGAGGACCAGATAAG
CAGTAAGTATGTCTTATCCTATATGTTTTGCAACATAAAAATATTGCTAATTGAAAAGAATTAGGCAATTATGTGTGTTGCTGGGTTGTT
TTTTTGTTTTTTTTTTTTTGAGACGGAGTCTTGCCCTGTCGCCCAGGATGGAGTGCAACAGCATGATCTCGGTTCACTGCAACCTCCATC
TCCTGGGATCAAGTGATTCTCCTGCCTCAGCCTCCTGAATAGCTGGGATTACAGGCACCTGCCACCATGCCTGGCTAATTTTTTGTATCT
GTAGTAGAGACGGGGTTTCACTGTGTTGGCCAGGATGGTCTCAAACTCCTGACCTCCTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGG
GTTTACAGGCGTGAGCCACCGCGCCCGGCCAAAATTGAGGTATTTTTTGCCCTACGTTTTAAGGACTAGACTTTTGAAGTATTTTATAGT
CTAGAGGTCTCAAGTAATATATATGTGTTTAATATTTTTAGAGCCAATTGATACCACAATTAGATAGGAGTAGTGAGAATAATATGGAAT
TACTTGGTTTGAAGTAGTTAAAAATTGGATATGGTTATATCTGAGCTGTAGTCATATTATCTCAAGAAAAATAATACGAGGATTTAACAT
AAGATTTGTTCTATTAATGCCCAAATTTGGCTTTCCTCTACTATCCCCCATAGAGAACCACTAACAAGTGGATGTCTAATATTCCTCTGG
TGAGTTGAAGGCAGGAGAAGTTGAGAATCATTAGTTTCAATGAGTATCCAGGTGACCTATCCTGGCCCTCTACTCAGAAACCGGCAATTT
GTCTTCACTCTGAGATTCATTAAATTGCTGTTGTATAACTGATGGTTATTATGAACACTGACCTGTGAGACATATGGAAGATAAAGTTTG
GTCTTACAGGAAATCTTGAGGAGAGTCAAAAGAGAAATGGGAGATGTCTCTTGAGAGGTGATCAGAGAAGTTTATGCTCACTGTCTGATG
CAAATGTCTGGTCTATTTGTTAGTAAATAACAGGGAAATCATTTTCACTTTTTGTTAAAAATAAGGTATTTACAAGCATACCTTGTAGTT
ATTGTGGGTTCAGTTTCAGACCACTGCAATAAAGTGAATATCTCAATAAAGTGAGTCACATGAAGTTTTTTGGTTTTCCCCTGCATATAA
AAGTTACATTTACACCATCCTGTAGTCTATTAAGTGTGCAGTAGCATTATGGCTAAAAAAAAAAAACACCCAATATACCTATCTTAATTA


Top

FusionGenePPI for TTC39B_SPTSSA


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
TTC39BMEOX2, HSPD1, MTIF2, PREPL, FDXR, VAPB, MCM2SPTSSATUBB3, ELAVL1, VKORC1, MBOAT7, PTAR1, TRIM25


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for TTC39B_SPTSSA


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for TTC39B_SPTSSA


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource