FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 38752

FusionGeneSummary for TMPRSS2_FKBP5

check button Fusion gene summary
Fusion gene informationFusion gene name: TMPRSS2_FKBP5
Fusion gene ID: 38752
HgeneTgene
Gene symbol

TMPRSS2

FKBP5

Gene ID

7113

2289

Gene nametransmembrane serine protease 2FK506 binding protein 5
SynonymsPP9284|PRSS10AIG6|FKBP51|FKBP54|P54|PPIase|Ptg-10
Cytomap

21q22.3

6p21.31

Type of geneprotein-codingprotein-coding
Descriptiontransmembrane protease serine 2epitheliasinserine protease 10transmembrane protease, serine 2peptidyl-prolyl cis-trans isomerase FKBP551 kDa FK506-binding protein51 kDa FKBP54 kDa progesterone receptor-associated immunophilinFF1 antigenFKBP-51HSP90-binding immunophilinPPIase FKBP5T-cell FK506-binding proteinandrogen-regulated protein 6p
Modification date2018052320180527
UniProtAcc

O15393

Q13451

Ensembl transtripts involved in fusion geneENST00000332149, ENST00000398585, 
ENST00000458356, ENST00000497881, 
ENST00000539068, ENST00000536438, 
ENST00000357266, ENST00000540787, 
ENST00000542713, 
Fusion gene scores* DoF score29 X 21 X 6=365411 X 11 X 7=847
# samples 22817
** MAII scorelog2(228/3654*10)=-0.680442809575384
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(17/847*10)=-2.3168272231945
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: TMPRSS2 [Title/Abstract] AND FKBP5 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneTMPRSS2

GO:0006508

proteolysis

21068237|24227843

HgeneTMPRSS2

GO:0046598

positive regulation of viral entry into host cell

21068237|24227843

TgeneFKBP5

GO:0061077

chaperone-mediated protein folding

11350175


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1HM245390TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
ChiTaRS3.1HM245387TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
ChiTaRS3.1HM245389TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
ChiTaRS3.1HM245388TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000332149ENST00000539068TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
In-frameENST00000332149ENST00000536438TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
In-frameENST00000332149ENST00000357266TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
5CDS-5UTRENST00000332149ENST00000540787TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
5CDS-5UTRENST00000332149ENST00000542713TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
In-frameENST00000398585ENST00000539068TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
In-frameENST00000398585ENST00000536438TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
In-frameENST00000398585ENST00000357266TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
5CDS-5UTRENST00000398585ENST00000540787TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
5CDS-5UTRENST00000398585ENST00000542713TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
Frame-shitENST00000458356ENST00000539068TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
Frame-shitENST00000458356ENST00000536438TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
Frame-shitENST00000458356ENST00000357266TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
5CDS-5UTRENST00000458356ENST00000540787TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
5CDS-5UTRENST00000458356ENST00000542713TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
intron-3CDSENST00000497881ENST00000539068TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
intron-3CDSENST00000497881ENST00000536438TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
intron-3CDSENST00000497881ENST00000357266TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
intron-5UTRENST00000497881ENST00000540787TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
intron-5UTRENST00000497881ENST00000542713TMPRSS2chr21

42866283

-FKBP5chr6

35565187

-
5UTR-3CDSENST00000332149ENST00000539068TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-3CDSENST00000332149ENST00000536438TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-3CDSENST00000332149ENST00000357266TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-5UTRENST00000332149ENST00000540787TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-5UTRENST00000332149ENST00000542713TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-3CDSENST00000398585ENST00000539068TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-3CDSENST00000398585ENST00000536438TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-3CDSENST00000398585ENST00000357266TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-5UTRENST00000398585ENST00000540787TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-5UTRENST00000398585ENST00000542713TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-3CDSENST00000458356ENST00000539068TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-3CDSENST00000458356ENST00000536438TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-3CDSENST00000458356ENST00000357266TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-5UTRENST00000458356ENST00000540787TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
intron-5UTRENST00000458356ENST00000542713TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-3CDSENST00000497881ENST00000539068TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-3CDSENST00000497881ENST00000536438TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-3CDSENST00000497881ENST00000357266TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-5UTRENST00000497881ENST00000540787TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-
5UTR-5UTRENST00000497881ENST00000542713TMPRSS2chr21

42880008

-FKBP5chr6

35565184

-

Top

FusionProtFeatures for TMPRSS2_FKBP5


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
TMPRSS2

O15393

FKBP5

Q13451

Serine protease that proteolytically cleaves andactivates the viral spike glycoproteins which facilitate virus-cell membrane fusions; spike proteins are synthesized andmaintained in precursor intermediate folding states andproteolysis permits the refolding and energy release required tocreate stable virus-cell linkages and membrane coalescence.Facilitates human SARS coronavirus (SARS-CoV) infection via twoindependent mechanisms, proteolytic cleavage of ACE2, which mightpromote viral uptake, and cleavage of coronavirus spikeglycoprotein which activates the glycoprotein for cathepsin L-independent host cell entry. Proteolytically cleaves and activatesthe spike glycoproteins of human coronavirus 229E (HCoV-229E) andhuman coronavirus EMC (HCoV-EMC) and the fusion glycoproteins F0of Sendai virus (SeV), human metapneumovirus (HMPV), humanparainfluenza 1, 2, 3, 4a and 4b viruses (HPIV). Essential forspread and pathogenesis of influenza A virus (strains H1N1, H3N2and H7N9); involved in proteolytic cleavage and activation ofhemagglutinin (HA) protein which is essential for viralinfectivity. {ECO:0000269|PubMed:21068237,ECO:0000269|PubMed:21325420, ECO:0000269|PubMed:23536651,ECO:0000269|PubMed:23966399, ECO:0000269|PubMed:24027332,ECO:0000269|PubMed:24227843}. Immunophilin protein with PPIase and co-chaperoneactivities. Component of unligated steroid receptorsheterocomplexes through interaction with heat-shock protein 90(HSP90). Plays a role in the intracellular trafficking ofheterooligomeric forms of steroid hormone receptors maintainingthe complex into the cytoplasm when unliganded.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000398585-3141_84116530Topological domainCytoplasmic
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000398585-31485_105116530TransmembraneHelical%3B Signal-anchor for type II membrane protein
TgeneFKBP5chr21:42866283chr6:35565187ENST00000357266-411268_301169458RepeatNote=TPR 1
TgeneFKBP5chr21:42866283chr6:35565187ENST00000357266-411317_350169458RepeatNote=TPR 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000357266-411351_384169458RepeatNote=TPR 3
TgeneFKBP5chr21:42866283chr6:35565187ENST00000536438-512268_301169458RepeatNote=TPR 1
TgeneFKBP5chr21:42866283chr6:35565187ENST00000536438-512317_350169458RepeatNote=TPR 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000536438-512351_384169458RepeatNote=TPR 3
TgeneFKBP5chr21:42866283chr6:35565187ENST00000539068-411268_301169458RepeatNote=TPR 1
TgeneFKBP5chr21:42866283chr6:35565187ENST00000539068-411317_350169458RepeatNote=TPR 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000539068-411351_384169458RepeatNote=TPR 3
TgeneFKBP5chr21:42866283chr6:35565187ENST00000542713-47268_301169269RepeatNote=TPR 1
TgeneFKBP5chr21:42866283chr6:35565187ENST00000542713-47317_350169269RepeatNote=TPR 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000542713-47351_384169269RepeatNote=TPR 3

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000332149-314112_14979493DomainLDL-receptor class A
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000332149-314150_24279493DomainSRCR
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000332149-314256_48979493DomainPeptidase S1
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000398585-314112_149116530DomainLDL-receptor class A
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000398585-314150_242116530DomainSRCR
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000398585-314256_489116530DomainPeptidase S1
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000458356-314112_14979493DomainLDL-receptor class A
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000458356-314150_24279493DomainSRCR
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000458356-314256_48979493DomainPeptidase S1
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000332149-314106_49279493Topological domainExtracellular
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000332149-3141_8479493Topological domainCytoplasmic
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000398585-314106_492116530Topological domainExtracellular
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000458356-314106_49279493Topological domainExtracellular
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000458356-3141_8479493Topological domainCytoplasmic
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000332149-31485_10579493TransmembraneHelical%3B Signal-anchor for type II membrane protein
HgeneTMPRSS2chr21:42866283chr6:35565187ENST00000458356-31485_10579493TransmembraneHelical%3B Signal-anchor for type II membrane protein
TgeneFKBP5chr21:42866283chr6:35565187ENST00000357266-411157_243169458DomainPPIase FKBP-type 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000357266-41142_130169458DomainPPIase FKBP-type 1
TgeneFKBP5chr21:42866283chr6:35565187ENST00000536438-512157_243169458DomainPPIase FKBP-type 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000536438-51242_130169458DomainPPIase FKBP-type 1
TgeneFKBP5chr21:42866283chr6:35565187ENST00000539068-411157_243169458DomainPPIase FKBP-type 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000539068-41142_130169458DomainPPIase FKBP-type 1
TgeneFKBP5chr21:42866283chr6:35565187ENST00000542713-47157_243169269DomainPPIase FKBP-type 2
TgeneFKBP5chr21:42866283chr6:35565187ENST00000542713-4742_130169269DomainPPIase FKBP-type 1


Top

FusionGeneSequence for TMPRSS2_FKBP5


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_TMPRSS2_ENST00000332149_chr21_42866283_-_FKBP5_ENST00000539068_chr6_35565187_-_3489nt
CGAGTAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAA
CATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCAGGGTCACCACCAGCTATTGGACCTTACTAT
GAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTAC
CCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCCCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACA
GTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGAC
CACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGATATGGTTTT
GGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAA
TCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAAGGGAACCGTATACTTCAAGGGAGGCAAATACATG
CAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTT
CTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGA
CTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAG
AAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGAC
CGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAA
GGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGA
GTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGA
TTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCA
CTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCA
AGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTT
TAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAA
GTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAG
ACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTG
GCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTT
CTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTA
TTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTA
AGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTT
TTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAG
TACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGAC
ACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACA
CAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTA
CGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTT
AAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAA
AGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTTTTATAATACTTTTCTTCCCCATGGAACAAATGG
GATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTT
TAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGG
TTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGA
TGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGT
TCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAATTTGT
GTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAA

>In-frame_TMPRSS2_ENST00000332149_chr21_42866283_-_FKBP5_ENST00000536438_chr6_35565187_-_3489nt
CGAGTAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAA
CATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCAGGGTCACCACCAGCTATTGGACCTTACTAT
GAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTAC
CCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCCCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACA
GTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGAC
CACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGATATGGTTTT
GGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAA
TCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAAGGGAACCGTATACTTCAAGGGAGGCAAATACATG
CAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTT
CTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGA
CTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAG
AAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGAC
CGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAA
GGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGA
GTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGA
TTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCA
CTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCA
AGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTT
TAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAA
GTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAG
ACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTG
GCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTT
CTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTA
TTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTA
AGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTT
TTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAG
TACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGAC
ACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACA
CAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTA
CGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTT
AAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAA
AGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTTTTATAATACTTTTCTTCCCCATGGAACAAATGG
GATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTT
TAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGG
TTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGA
TGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGT
TCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAATTTGT
GTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAA

>In-frame_TMPRSS2_ENST00000332149_chr21_42866283_-_FKBP5_ENST00000357266_chr6_35565187_-_3484nt
CGAGTAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAA
CATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCAGGGTCACCACCAGCTATTGGACCTTACTAT
GAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTAC
CCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCCCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACA
GTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGAC
CACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGATATGGTTTT
GGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAA
TCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAAGGGAACCGTATACTTCAAGGGAGGCAAATACATG
CAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTT
CTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGA
CTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAG
AAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGAC
CGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAA
GGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGA
GTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGA
TTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCA
CTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCA
AGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTT
TAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAA
GTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAG
ACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTG
GCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTT
CTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTA
TTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTA
AGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTT
TTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAG
TACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGAC
ACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACA
CAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTA
CGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTT
AAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAA
AGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTTTTATAATACTTTTCTTCCCCATGGAACAAATGG
GATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTT
TAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGG
TTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGA
TGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGT
TCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAATTTGT
GTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAA

>In-frame_TMPRSS2_ENST00000398585_chr21_42866283_-_FKBP5_ENST00000539068_chr6_35565187_-_3526nt
ACCAGGGTCCCGGCTCGGGGTCCGGGCTGGGGAGGGGAACCTGGGCGCCTGGGACCCGCCGATGCCCCCTGCCCCGCCCGGAGGTGAAAG
CGGGTGTGAGGAGCGCGGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTT
GAACTCAGGGTCACCACCAGCTATTGGACCTTACTATGAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGT
CCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCC
CGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTG
CAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGA
ACAATGTATTTTATATCTTGGACCAAGATATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATA
TGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGA
GAAGGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGG
TTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATA
CACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCT
CATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCAT
GTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGA
AGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACC
TGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGA
ACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTG
CTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAG
CTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGG
TTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGG
GGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGG
GGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCC
AAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAA
ACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAA
AGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTAC
TGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTAC
ATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTA
CACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTT
GCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGT
TGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAG
TCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCA
TGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATT
TTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTT
CCTTTTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCT
CATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTT
ACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTT
GCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCA
AAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGT
ATTCTTGTATCAAATTCAATAATCTTAAACAATTTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCC
AAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATCATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAA

>In-frame_TMPRSS2_ENST00000398585_chr21_42866283_-_FKBP5_ENST00000536438_chr6_35565187_-_3526nt
ACCAGGGTCCCGGCTCGGGGTCCGGGCTGGGGAGGGGAACCTGGGCGCCTGGGACCCGCCGATGCCCCCTGCCCCGCCCGGAGGTGAAAG
CGGGTGTGAGGAGCGCGGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTT
GAACTCAGGGTCACCACCAGCTATTGGACCTTACTATGAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGT
CCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCC
CGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTG
CAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGA
ACAATGTATTTTATATCTTGGACCAAGATATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATA
TGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGA
GAAGGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGG
TTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATA
CACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCT
CATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCAT
GTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGA
AGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACC
TGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGA
ACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTG
CTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAG
CTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGG
TTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGG
GGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGG
GGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCC
AAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAA
ACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAA
AGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTAC
TGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTAC
ATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTA
CACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTT
GCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGT
TGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAG
TCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCA
TGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATT
TTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTT
CCTTTTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCT
CATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTT
ACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTT
GCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCA
AAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGT
ATTCTTGTATCAAATTCAATAATCTTAAACAATTTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCC
AAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATCATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAA

>In-frame_TMPRSS2_ENST00000398585_chr21_42866283_-_FKBP5_ENST00000357266_chr6_35565187_-_3521nt
ACCAGGGTCCCGGCTCGGGGTCCGGGCTGGGGAGGGGAACCTGGGCGCCTGGGACCCGCCGATGCCCCCTGCCCCGCCCGGAGGTGAAAG
CGGGTGTGAGGAGCGCGGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTT
GAACTCAGGGTCACCACCAGCTATTGGACCTTACTATGAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGT
CCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCC
CGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTG
CAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGA
ACAATGTATTTTATATCTTGGACCAAGATATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATA
TGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGA
GAAGGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGG
TTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATA
CACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCT
CATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCAT
GTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGA
AGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACC
TGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGA
ACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTG
CTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAG
CTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGG
TTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGG
GGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGG
GGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCC
AAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAA
ACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAA
AGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTAC
TGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTAC
ATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTA
CACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTT
GCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGT
TGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAG
TCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCA
TGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATT
TTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTT
CCTTTTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCT
CATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTT
ACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTT
GCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCA
AAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGT
ATTCTTGTATCAAATTCAATAATCTTAAACAATTTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCC
AAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATCATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAA

>In-frame_TMPRSS2_ENST00000332149_chr21_42866283_-_FKBP5_ENST00000539068_chr6_35565187_-_3489nt
CGAGTAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAA
CATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCAGGGTCACCACCAGCTATTGGACCTTACTAT
GAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTAC
CCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCCCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACA
GTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGAC
CACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGATATGGTTTT
GGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAA
TCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAAGGGAACCGTATACTTCAAGGGAGGCAAATACATG
CAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTT
CTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGA
CTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAG
AAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGAC
CGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAA
GGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGA
GTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGA
TTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCA
CTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCA
AGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTT
TAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAA
GTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAG
ACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTG
GCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTT
CTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTA
TTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTA
AGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTT
TTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAG
TACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGAC
ACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACA
CAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTA
CGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTT
AAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAA
AGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTTTTATAATACTTTTCTTCCCCATGGAACAAATGG
GATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTT
TAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGG
TTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGA
TGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGT
TCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAATTTGT
GTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAA

>In-frame_TMPRSS2_ENST00000332149_chr21_42866283_-_FKBP5_ENST00000536438_chr6_35565187_-_3489nt
CGAGTAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAA
CATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCAGGGTCACCACCAGCTATTGGACCTTACTAT
GAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTAC
CCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCCCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACA
GTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGAC
CACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGATATGGTTTT
GGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAA
TCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAAGGGAACCGTATACTTCAAGGGAGGCAAATACATG
CAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTT
CTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGA
CTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAG
AAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGAC
CGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAA
GGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGA
GTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGA
TTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCA
CTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCA
AGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTT
TAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAA
GTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAG
ACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTG
GCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTT
CTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTA
TTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTA
AGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTT
TTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAG
TACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGAC
ACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACA
CAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTA
CGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTT
AAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAA
AGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTTTTATAATACTTTTCTTCCCCATGGAACAAATGG
GATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTT
TAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGG
TTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGA
TGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGT
TCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAATTTGT
GTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAA

>In-frame_TMPRSS2_ENST00000332149_chr21_42866283_-_FKBP5_ENST00000357266_chr6_35565187_-_3484nt
CGAGTAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAA
CATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCAGGGTCACCACCAGCTATTGGACCTTACTAT
GAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTAC
CCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCCCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACA
GTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTGCAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGAC
CACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGAACAATGTATTTTATATCTTGGACCAAGATATGGTTTT
GGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATATGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAA
TCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGAGAAGGGAACCGTATACTTCAAGGGAGGCAAATACATG
CAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGGTTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTT
CTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATACACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGA
CTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCTCATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAG
AAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCATGTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGAC
CGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGAAGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAA
GGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACCTGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGA
GTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGAACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGA
TTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTGCTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCA
CTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAGCTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCA
AGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGGTTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTT
TAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGGGGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAA
GTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGGGGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAG
ACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCCAAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTG
GCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAAACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTT
CTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAAAGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTA
TTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTACTGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTA
AGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTACATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTT
TTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTACACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAG
TACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTTGCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGAC
ACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGTTGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACA
CAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAGTCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTA
CGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCATGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTT
AAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATTTTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAA
AGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTTCCTTTTATAATACTTTTCTTCCCCATGGAACAAATGG
GATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCTCATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTT
TAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTTACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGG
TTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTTGCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGA
TGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCAAAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGT
TCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGTATTCTTGTATCAAATTCAATAATCTTAAACAATTTGT
GTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCCAAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAA

>In-frame_TMPRSS2_ENST00000398585_chr21_42866283_-_FKBP5_ENST00000539068_chr6_35565187_-_3526nt
ACCAGGGTCCCGGCTCGGGGTCCGGGCTGGGGAGGGGAACCTGGGCGCCTGGGACCCGCCGATGCCCCCTGCCCCGCCCGGAGGTGAAAG
CGGGTGTGAGGAGCGCGGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTT
GAACTCAGGGTCACCACCAGCTATTGGACCTTACTATGAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGT
CCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCC
CGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTG
CAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGA
ACAATGTATTTTATATCTTGGACCAAGATATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATA
TGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGA
GAAGGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGG
TTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATA
CACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCT
CATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCAT
GTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGA
AGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACC
TGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGA
ACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTG
CTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAG
CTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGG
TTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGG
GGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGG
GGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCC
AAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAA
ACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAA
AGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTAC
TGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTAC
ATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTA
CACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTT
GCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGT
TGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAG
TCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCA
TGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATT
TTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTT
CCTTTTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCT
CATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTT
ACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTT
GCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCA
AAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGT
ATTCTTGTATCAAATTCAATAATCTTAAACAATTTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCC
AAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATCATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAA

>In-frame_TMPRSS2_ENST00000398585_chr21_42866283_-_FKBP5_ENST00000536438_chr6_35565187_-_3526nt
ACCAGGGTCCCGGCTCGGGGTCCGGGCTGGGGAGGGGAACCTGGGCGCCTGGGACCCGCCGATGCCCCCTGCCCCGCCCGGAGGTGAAAG
CGGGTGTGAGGAGCGCGGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTT
GAACTCAGGGTCACCACCAGCTATTGGACCTTACTATGAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGT
CCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCC
CGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTG
CAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGA
ACAATGTATTTTATATCTTGGACCAAGATATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATA
TGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGA
GAAGGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGG
TTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATA
CACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCT
CATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCAT
GTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGA
AGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACC
TGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGA
ACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTG
CTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAG
CTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGG
TTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGG
GGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGG
GGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCC
AAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAA
ACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAA
AGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTAC
TGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTAC
ATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTA
CACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTT
GCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGT
TGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAG
TCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCA
TGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATT
TTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTT
CCTTTTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCT
CATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTT
ACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTT
GCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCA
AAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGT
ATTCTTGTATCAAATTCAATAATCTTAAACAATTTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCC
AAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATCATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAA

>In-frame_TMPRSS2_ENST00000398585_chr21_42866283_-_FKBP5_ENST00000357266_chr6_35565187_-_3521nt
ACCAGGGTCCCGGCTCGGGGTCCGGGCTGGGGAGGGGAACCTGGGCGCCTGGGACCCGCCGATGCCCCCTGCCCCGCCCGGAGGTGAAAG
CGGGTGTGAGGAGCGCGGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTT
GAACTCAGGGTCACCACCAGCTATTGGACCTTACTATGAAAACCATGGATACCAACCGGAAAACCCCTATCCCGCACAGCCCACTGTGGT
CCCCACTGTCTACGAGGTGCATCCGGCTCAGTACTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTCCAACCC
CGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAATCCACCTGGAAGGCCGCTGTGGTGGAAGGATGTTTGACTG
CAGAGATGTGGCATTCACTGTGGGCGAAGGAGAAGACCACGACATTCCAATTGGAATTGACAAAGCTCTGGAGAAAATGCAGCGGGAAGA
ACAATGTATTTTATATCTTGGACCAAGATATGGTTTTGGAGAGGCAGGGAAGCCTAAATTTGGCATTGAACCTAATGCTGAGCTTATATA
TGAAGTTACACTTAAGAGCTTCGAAAAGGCCAAAGAATCCTGGGAGATGGATACCAAAGAAAAATTGGAGCAGGCTGCCATTGTCAAAGA
GAAGGGAACCGTATACTTCAAGGGAGGCAAATACATGCAGGCGGTGATTCAGTATGGGAAGATAGTGTCCTGGTTAGAGATGGAATATGG
TTTATCAGAAAAGGAATCGAAAGCTTCTGAATCATTTCTCCTTGCTGCCTTTCTGAACCTGGCCATGTGCTACCTGAAGCTTAGAGAATA
CACCAAAGCTGTTGAATGCTGTGACAAGGCCCTTGGACTGGACAGTGCCAATGAGAAAGGCTTGTATAGGAGGGGTGAAGCCCAGCTGCT
CATGAACGAGTTTGAGTCAGCCAAGGGTGACTTTGAGAAAGTGCTGGAAGTAAACCCCCAGAATAAGGCTGCAAGACTGCAGATCTCCAT
GTGCCAGAAAAAGGCCAAGGAGCACAACGAGCGGGACCGCAGGATATACGCCAACATGTTCAAGAAGTTTGCAGAGCAGGATGCCAAGGA
AGAGGCCAATAAAGCAATGGGCAAGAAGACTTCAGAAGGGGTCACTAATGAAAAAGGAACAGACAGTCAAGCAATGGAAGAAGAGAAACC
TGAGGGCCACGTATGACGCCACGCCAAGGAGGGAAGAGTCCCAGTGAACTCGGCCCCTCCTCAATGGGCTTTCCCCCAACTCAGGACAGA
ACAGTGTTTAATGTAAAGTTTGTTATAGTCTATGTGATTCTGGAAGCAAATGGCAAAACCAGTAGCTTCCCAAAAACAGCCCCCCTGCTG
CTGCCCGGAGGGTTCACTGAGGGGTGGCACGGGACCACTCCAGGTGGAACAAACAGAAATGACTGTGGTGTGGAGGGAGTGAGCCAGCAG
CTTAAGTCCAGCTCATTTCAGTTTCTATCAACCTTCAAGTATCCAATTCAGGGTCCCTGGAGATCATCCTAACAATGTGGGGCTGTTAGG
TTTTACCTTTGAACTTTCATAGCACTGCAGAAACCTTTAAAAAAAAAATGCTTCATGAATTTCTCCTTTCCTACAGTTGGGTAGGGTAGG
GGAAGGAGGATAAGCTTTTGTTTTTTAAATGACTGAAGTGCTATAAATGTAGTCTGTTGCATTTTTAACCAACAGAACCCACAGTAGAGG
GGTCTCATGTCTCCCCAGTTCCACAGCAGTGTCACAGACGTGAAAGCCAGAACCTCAGAGGCCACTTGCTTGCTGACTTAGCCTCCTCCC
AAAGTCCCCCTCCTCAGCCAGCCTCCTTGTGAGAGTGGCTTTCTACCACACACAGCCTGTCCCTGGGGGAGTAATTCTGTCATTCCTAAA
ACACCCTTCAGCAATGATAATGAGCAGATGAGAGTTTCTGGATTAGCTTTTCCTATTTTCGATGAAGTTCTGAGATACTGAAATGTGAAA
AGAGCAATCAGAATTGTGCTTTTTCTCCCCTCCTCTATTCCTTTTAGGGAATAATATTCAATACACAGTACTTCCTCCCAGCATTGCTAC
TGCTCAGCTTCTTCTTTCATTCTAATCCTTGCTATTAAGAATTTAAGACTTGTGCTTACAATATTTTTGACCTGGAGTGGATCTATTTAC
ATAGTCATTTAGGATCCATGCAGCTTTTTTTGTCTTTTTAAGATTATTGGCTCATAAGCATATGTATACTGGTTTATGGAACTTTATTTA
CACTCCTCTATCATGCAAAAAAATTTTGACTTTTTAGTACTAAGCTTAATTTTTAAAAACAAAATCTGTAGGGTTGACAAATAAATAGTT
GCTCTTCTACACTAGGGGTTTCACCTGCAGGTTTGACACGCAGTTGCTCGCTTTTCCTGCCCTGTCAAGCTTCTCTGTTCTGGCGTGAGT
TGTGAAAGAGTTGAAGACAGCTTCCCATGCCGGTACACAGCCAGTAGCCTAAATCTCCAGTACTTGAGCTGACCATTGAACTAGGGCAAG
TCTTAAATGTGTACATGTAGTTGAATTTCAGTCCTTACGGGTAAACAGATTGAGCATGGCTCTCTATTCCCTCAGCCTAAGAAACACTCA
TGGGAATGCATTTGGCAACCCAAGGAACCATTTGCTTAAACCTGGAACATCTCACCTTTTTAAATCCTAAAAAACACTGGCAGTTATATT
TTAAATTAGTTTTTATTTTTATGATGGTTTTATCAAAAGACTTTTATTATTAGATTGGGACCCCCTTCAAACCTAAAAATCAAGTTATTT
CCTTTTATAATACTTTTCTTCCCCATGGAACAAATGGGATCAATTTGTGAGTTTTTTCCTTTAATGATAACTAAAATCCCTCTAATTTCT
CATTTATGCTTTTGTCTTTTTTATGAAATATTTCTTTTAAAAGCCCCAGTCTCACCTACGAAATATGAAGAGCAAAAGCTGATTTTGCTT
ACTTGCTAAACTGTTGGGAAAGCTCTGTAGAGCATGGTTCCAGTGAGGCCAAGATTGAAATTTGATACTAAAAAGGCCACCTAGCTTTTT
GCAGATAACAAACAAGAAAGCTATTCCAAGACTCAGATGATGCCAGCTGTCTCCCACGTGTGTATTATGGTTCACCAGGGGGAACTGGCA
AAAGTGTGTGTGGGGAGGGGAAGGGTGTGTGAGTGGTTCTGAGCAAATAACTACAGGGTGCCCATTACCACTCAAGAAGACACTTCACGT
ATTCTTGTATCAAATTCAATAATCTTAAACAATTTGTGTAGAAGTCCACAGACATCTTTCAACCACCTTTTAGGCTGCATATGGATTGCC
AAGTCAGCATATGAGGAATTAAAGACATTGTTTTTAAAAAAAAAAAATCATTTAGATGCACTTTTTTGTGTGTTCTTTAAATAAATCCAA


Top

FusionGenePPI for TMPRSS2_FKBP5


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
TMPRSS2CLK1FKBP5MAP3K1, IKBKE, ESR1, FES, HSF1, PGR, HSP90AA1, USP49, PHLPP1, CDK9, STK11, STIP1, IKBKB, RIPK3, AKT1, NR3C1, NR3C2, AR, HSPA4, PTGES3, LRRK1, MAGEA11, APP, CLK3, CDK15, MAGED2, MCM3, MCM5, MGEA5, OGFR, TPM3, TRAP1, USP7, PRKAA1, AGO1, AHSA1, CDC37, CDC37L1, SUGT1, NUDCD3, HSP90AB1, ILK, NUDC, AGO2, CACYBP, CHUK, AURKB, ARAF, GLMN, TTC4, CHORDC1, LRRC40, IKBKG, KIAA1279, ANKMY2, EGLN1, HGH1, MCMBP, PDCD2, CDK4, CDK11A, TUBA1A, PNPLA2, DNAJB6, C14orf80, CXorf57, PYGL, MCM4, HSF4, IRS4, LIMK2, SGK2, TSSK6, ULK3, AGO3, MOS, PSKH2, PIPOX, SGK1, CDKL1, CDKL4, AURKC, CDK18, CDK7, CDK13, CDK3, RPS6KB2, DUT, TLE3, NTRK1, XRCC3, TINF2, FBXW7, DUSP2, DUSP8, AMACR, MAP3K6, PRKACB, AKT3, PDIK1L, STK35, NEK11, ABHD15, WDR90, CDK6, ATG7, TRIM25


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for TMPRSS2_FKBP5


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for TMPRSS2_FKBP5


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneTMPRSS2C0033578Prostatic Neoplasms2CTD_human
TgeneFKBP5C0005586Bipolar Disorder5PSYGENET
TgeneFKBP5C0011570Mental Depression5PSYGENET
TgeneFKBP5C0011581Depressive disorder5PSYGENET
TgeneFKBP5C0041696Unipolar Depression5PSYGENET
TgeneFKBP5C0525045Mood Disorders5PSYGENET
TgeneFKBP5C1269683Major Depressive Disorder5CTD_human;PSYGENET
TgeneFKBP5C0001973Alcoholic Intoxication, Chronic1PSYGENET
TgeneFKBP5C0003873Rheumatoid Arthritis1CTD_human
TgeneFKBP5C0014175Endometriosis1CTD_human
TgeneFKBP5C0021290Neonatal disorder1CTD_human
TgeneFKBP5C0033975Psychotic Disorders1PSYGENET
TgeneFKBP5C0349204Nonorganic psychosis1PSYGENET
TgeneFKBP5C0525041Neurobehavioral Manifestations1CTD_human
TgeneFKBP5C2362914clinical depression1PSYGENET