FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 38738

FusionGeneSummary for TMPRSS11D_SPINK2

check button Fusion gene summary
Fusion gene informationFusion gene name: TMPRSS11D_SPINK2
Fusion gene ID: 38738
HgeneTgene
Gene symbol

TMPRSS11D

SPINK2

Gene ID

9407

6691

Gene nametransmembrane serine protease 11Dserine peptidase inhibitor, Kazal type 2
SynonymsHATHUSI-II
Cytomap

4q13.2

4q12

Type of geneprotein-codingprotein-coding
Descriptiontransmembrane protease serine 11Dairway trypsin-like proteasetransmembrane protease, serine 11Dserine protease inhibitor Kazal-type 2epididymis tissue protein Li 172serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Modification date2018040320180523
UniProtAcc

O60235

P20155

Ensembl transtripts involved in fusion geneENST00000283916, ENST00000545541, 
ENST00000509584, 
ENST00000248701, 
ENST00000506738, ENST00000504762, 
Fusion gene scores* DoF score1 X 1 X 1=15 X 3 X 5=75
# samples 15
** MAII scorelog2(1/1*10)=3.32192809488736log2(5/75*10)=-0.584962500721156
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: TMPRSS11D [Title/Abstract] AND SPINK2 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneTMPRSS11D

GO:0006508

proteolysis

24227843


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVHNSCTCGA-F7-7848-01ATMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000283916ENST00000248701TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
In-frameENST00000283916ENST00000506738TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
In-frameENST00000283916ENST00000504762TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
5UTR-3CDSENST00000545541ENST00000248701TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
5UTR-3CDSENST00000545541ENST00000506738TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
5UTR-3CDSENST00000545541ENST00000504762TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
5UTR-3CDSENST00000509584ENST00000248701TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
5UTR-3CDSENST00000509584ENST00000506738TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-
5UTR-3CDSENST00000509584ENST00000504762TMPRSS11Dchr4

68749644

-SPINK2chr4

57677960

-

Top

FusionProtFeatures for TMPRSS11D_SPINK2


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
TMPRSS11D

O60235

SPINK2

P20155

May play some biological role in the host defense systemon the mucous membrane independently of or in cooperation withother substances in airway mucous or bronchial secretions. Plays arole in the proteolytic processing of ACE2. Proteolyticallycleaves and activates the human coronavirus 229E (HCoV-229E) spikeglycoprotein which facilitate virus-cell membrane fusions; spikeproteins are synthesized and maintained in precursor intermediatefolding states and proteolysis permits the refolding and energyrelease required to create stable virus-cell linkages and membranecoalescence. Preferentially cleaves the C-terminal side ofarginine residues at the P1 position of certain peptides, cleavingBoc-Phe-Ser-Arg-4-methylcoumaryl-7-amide most efficiently andhaving an optimum pH of 8.6 with this substrate.{ECO:0000269|PubMed:23536651, ECO:0000269|PubMed:24227843}. Strong inhibitor of acrosin in male and/or femalegenital tract. Also inhibits trypsin.{ECO:0000269|PubMed:19422058}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneSPINK2chr4:68749644chr4:57677960ENST00000248701-1430_843385DomainKazal-like

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneTMPRSS11Dchr4:68749644chr4:57677960ENST00000283916-110187_4172419DomainPeptidase S1
HgeneTMPRSS11Dchr4:68749644chr4:57677960ENST00000283916-11046_1632419DomainSEA
HgeneTMPRSS11Dchr4:68749644chr4:57677960ENST00000283916-1101_202419Topological domainCytoplasmic
HgeneTMPRSS11Dchr4:68749644chr4:57677960ENST00000283916-11042_4182419Topological domainExtracellular
HgeneTMPRSS11Dchr4:68749644chr4:57677960ENST00000283916-11021_412419TransmembraneHelical%3B Signal-anchor for type II membrane protein


Top

FusionGeneSequence for TMPRSS11D_SPINK2


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000248701_chr4_57677960_-_54aa

>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000506738_chr4_57677960_-_54aa

>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000504762_chr4_57677960_-_54aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000248701_chr4_57677960_-_164nt
ATGTATAGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCCACTTATGCCA

>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000506738_chr4_57677960_-_164nt
ATGTATAGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCCACTTATGCCA

>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000504762_chr4_57677960_-_164nt
ATGTATAGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCCACTTATGCCA


* Fusion transcript sequences (Full-length transcript).
>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000248701_chr4_57677960_-_541nt
ACTATAGATCACACGTAATACATGAGAGTCATTCATTTGAGTGGGAATCTCAAAGCAGTTGAGTAGGCAGAAAAAAGAACCTCTTCATTA
AGGATTAAAATGTATAGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCCA
CTTATGCCAATGAATGTACTCTGTGCATGAAAATCAGGGAAGGTGGTCATAATATTAAAATCATTCGAAATGGACCCTGCTGATGGAGCA
GTTTACAGAAAAGAAGATGGAGAGACCACCTTCACTGGCAGACTAGATAAATTGCATTTCCCCTTTTTCTCTTTTCCTGTGTTTCTTTAC
ATGAGATTTGTTAACACACATTTTCTGAGAGCAGGTATGGAAGACAGCCATGTGTAGTGATGGATAATTTAAAGAAAAAAAGAATCCTTG
TTTCTTGGCTTTTGCTCCTGGAGTTAAGCTTACTGCCCAGGTGACTTGTGCATTGCTTTATTTAGTTGAAATAAAATCAGCATTGAATTC

>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000506738_chr4_57677960_-_541nt
ACTATAGATCACACGTAATACATGAGAGTCATTCATTTGAGTGGGAATCTCAAAGCAGTTGAGTAGGCAGAAAAAAGAACCTCTTCATTA
AGGATTAAAATGTATAGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCCA
CTTATGCCAATGAATGTACTCTGTGCATGAAAATCAGGGAAGGTGGTCATAATATTAAAATCATTCGAAATGGACCCTGCTGATGGAGCA
GTTTACAGAAAAGAAGATGGAGAGACCACCTTCACTGGCAGACTAGATAAATTGCATTTCCCCTTTTTCTCTTTTCCTGTGTTTCTTTAC
ATGAGATTTGTTAACACACATTTTCTGAGAGCAGGTATGGAAGACAGCCATGTGTAGTGATGGATAATTTAAAGAAAAAAAGAATCCTTG
TTTCTTGGCTTTTGCTCCTGGAGTTAAGCTTACTGCCCAGGTGACTTGTGCATTGCTTTATTTAGTTGAAATAAAATCAGCATTGAATTC

>In-frame_TMPRSS11D_ENST00000283916_chr4_68749644_-_SPINK2_ENST00000504762_chr4_57677960_-_530nt
ACTATAGATCACACGTAATACATGAGAGTCATTCATTTGAGTGGGAATCTCAAAGCAGTTGAGTAGGCAGAAAAAAGAACCTCTTCATTA
AGGATTAAAATGTATAGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCCA
CTTATGCCAATGAATGTACTCTGTGCATGAAAATCAGGGAAGGTGGTCATAATATTAAAATCATTCGAAATGGACCCTGCTGATGGAGCA
GTTTACAGAAAAGAAGATGGAGAGACCACCTTCACTGGCAGACTAGATAAATTGCATTTCCCCTTTTTCTCTTTTCCTGTGTTTCTTTAC
ATGAGATTTGTTAACACACATTTTCTGAGAGCAGGTATGGAAGACAGCCATGTGTAGTGATGGATAATTTAAAGAAAAAAAGAATCCTTG


Top

FusionGenePPI for TMPRSS11D_SPINK2


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
TMPRSS11DSPINK2KRTAP5-9, ADAMTSL4, KRTAP10-3, NOTCH2NL, MAPK8IP2, GCHFR, ATP5S, NUDT8, MIPEP, DCAF15, CTTNBP2NL, PRTFDC1, UBR2, PDP2, IDE, PMPCB, RSPRY1, PMPCA, MOB4, STRIP1, IKBIP, STRN, UBR1, STRN3, STRN4, ATP6V1D


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for TMPRSS11D_SPINK2


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for TMPRSS11D_SPINK2


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource