FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 36952

FusionGeneSummary for SYNRG_FBXO47

check button Fusion gene summary
Fusion gene informationFusion gene name: SYNRG_FBXO47
Fusion gene ID: 36952
HgeneTgene
Gene symbol

SYNRG

FBXO47

Gene ID

11276

494188

Gene namesynergin gammaF-box protein 47
SynonymsAP1GBP1|SYNG-
Cytomap

17q12

17q12|17q12

Type of geneprotein-codingprotein-coding
Descriptionsynergin gammaAP1 gamma subunit binding protein 1AP1 subunit gamma-binding protein 1adaptor-related protein complex 1 gamma subunit-binding protein 1gamma-synerginF-box only protein 47
Modification date2018051920180329
UniProtAcc

Q9UMZ2

Q5MNV8

Ensembl transtripts involved in fusion geneENST00000339208, ENST00000346661, 
ENST00000345615, ENST00000502449, 
ENST00000591288, ENST00000394378, 
ENST00000585472, ENST00000588194, 
ENST00000378079, 
Fusion gene scores* DoF score14 X 15 X 9=18905 X 5 X 3=75
# samples 175
** MAII scorelog2(17/1890*10)=-3.47477958297073
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(5/75*10)=-0.584962500721156
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: SYNRG [Title/Abstract] AND FBXO47 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVPRADTCGA-KK-A5A1-01ASYNRGchr17

35969327

-FBXO47chr17

37107942

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000339208ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-
In-frameENST00000346661ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-
In-frameENST00000345615ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-
In-frameENST00000502449ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-
In-frameENST00000591288ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-
In-frameENST00000394378ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-
In-frameENST00000585472ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-
intron-3CDSENST00000588194ENST00000378079SYNRGchr17

35969327

-FBXO47chr17

37107942

-

Top

FusionProtFeatures for SYNRG_FBXO47


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
SYNRG

Q9UMZ2

FBXO47

Q5MNV8

May play a role in endocytosis and/or membranetrafficking at the trans-Golgi network (TGN). May act by linkingthe adapter protein complex AP-1 to other proteins. Probably recognizes and binds to some phosphorylatedproteins and promotes their ubiquitination and degradation.{ECO:0000250}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneSYNRGchr17:35969327chr17:37107942ENST00000339208-122115_155251315Coiled coilOntology_term=ECO:0000255
HgeneSYNRGchr17:35969327chr17:37107942ENST00000345615-120115_155251225Coiled coilOntology_term=ECO:0000255
HgeneSYNRGchr17:35969327chr17:37107942ENST00000346661-121115_155251303Coiled coilOntology_term=ECO:0000255
HgeneSYNRGchr17:35969327chr17:37107942ENST00000585472-121115_155251236Coiled coilOntology_term=ECO:0000255
HgeneSYNRGchr17:35969327chr17:37107942ENST00000591288-120115_155251109Coiled coilOntology_term=ECO:0000255
HgeneSYNRGchr17:35969327chr17:37107942ENST00000339208-122295_388251315DomainEH
HgeneSYNRGchr17:35969327chr17:37107942ENST00000345615-120295_388251225DomainEH
HgeneSYNRGchr17:35969327chr17:37107942ENST00000346661-121295_388251303DomainEH
HgeneSYNRGchr17:35969327chr17:37107942ENST00000585472-121295_388251236DomainEH
HgeneSYNRGchr17:35969327chr17:37107942ENST00000591288-120295_388251109DomainEH
HgeneSYNRGchr17:35969327chr17:37107942ENST00000339208-122457_461251315MotifNote=DFXDF motif 1
HgeneSYNRGchr17:35969327chr17:37107942ENST00000339208-122690_694251315MotifNote=DFXDF motif 2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000339208-122775_779251315MotifNote=DFXDF motif 3
HgeneSYNRGchr17:35969327chr17:37107942ENST00000345615-120457_461251225MotifNote=DFXDF motif 1
HgeneSYNRGchr17:35969327chr17:37107942ENST00000345615-120690_694251225MotifNote=DFXDF motif 2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000345615-120775_779251225MotifNote=DFXDF motif 3
HgeneSYNRGchr17:35969327chr17:37107942ENST00000346661-121457_461251303MotifNote=DFXDF motif 1
HgeneSYNRGchr17:35969327chr17:37107942ENST00000346661-121690_694251303MotifNote=DFXDF motif 2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000346661-121775_779251303MotifNote=DFXDF motif 3
HgeneSYNRGchr17:35969327chr17:37107942ENST00000585472-121457_461251236MotifNote=DFXDF motif 1
HgeneSYNRGchr17:35969327chr17:37107942ENST00000585472-121690_694251236MotifNote=DFXDF motif 2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000585472-121775_779251236MotifNote=DFXDF motif 3
HgeneSYNRGchr17:35969327chr17:37107942ENST00000591288-120457_461251109MotifNote=DFXDF motif 1
HgeneSYNRGchr17:35969327chr17:37107942ENST00000591288-120690_694251109MotifNote=DFXDF motif 2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000591288-120775_779251109MotifNote=DFXDF motif 3
TgeneFBXO47chr17:35969327chr17:37107942ENST00000378079-41141_91169453DomainF-box


Top

FusionGeneSequence for SYNRG_FBXO47


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_SYNRG_ENST00000339208_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_309aa
MALRPGAGSGGGGAAGAGAGSAGGGGPXQQVGMNLSAIAFIISYANXLISAARYKWLSAANQEVPKNWSXESDSSVGMSSLIIGHIEVIL
LFGXREYXNHGQWXIRQDYCISSLGQYLLKMDRWFGRKXXKNLQMNSVXKVWLMPLSYYMTLALKSGQQMMLSVLXMNYQWFPVSGFXRI
MHVSXCXVETTSVSVSWLVKLXMDAPLNWQGSXSFWLWCVRKNCTAWIGQLKXCKKSAKSLALQWKERTSCRMWQMHLHVLXWKCCNQLC

>In-frame_SYNRG_ENST00000346661_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_309aa
MALRPGAGSGGGGAAGAGAGSAGGGGPXQQVGMNLSAIAFIISYANXLISAARYKWLSAANQEVPKNWSXESDSSVGMSSLIIGHIEVIL
LFGXREYXNHGQWXIRQDYCISSLGQYLLKMDRWFGRKXXKNLQMNSVXKVWLMPLSYYMTLALKSGQQMMLSVLXMNYQWFPVSGFXRI
MHVSXCXVETTSVSVSWLVKLXMDAPLNWQGSXSFWLWCVRKNCTAWIGQLKXCKKSAKSLALQWKERTSCRMWQMHLHVLXWKCCNQLC

>In-frame_SYNRG_ENST00000345615_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_309aa
MALRPGAGSGGGGAAGAGAGSAGGGGPXQQVGMNLSAIAFIISYANXLISAARYKWLSAANQEVPKNWSXESDSSVGMSSLIIGHIEVIL
LFGXREYXNHGQWXIRQDYCISSLGQYLLKMDRWFGRKXXKNLQMNSVXKVWLMPLSYYMTLALKSGQQMMLSVLXMNYQWFPVSGFXRI
MHVSXCXVETTSVSVSWLVKLXMDAPLNWQGSXSFWLWCVRKNCTAWIGQLKXCKKSAKSLALQWKERTSCRMWQMHLHVLXWKCCNQLC

>In-frame_SYNRG_ENST00000502449_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_309aa
MALRPGAGSGGGGAAGAGAGSAGGGGPXQQVGMNLSAIAFIISYANXLISAARYKWLSAANQEVPKNWSXESDSSVGMSSLIIGHIEVIL
LFGXREYXNHGQWXIRQDYCISSLGQYLLKMDRWFGRKXXKNLQMNSVXKVWLMPLSYYMTLALKSGQQMMLSVLXMNYQWFPVSGFXRI
MHVSXCXVETTSVSVSWLVKLXMDAPLNWQGSXSFWLWCVRKNCTAWIGQLKXCKKSAKSLALQWKERTSCRMWQMHLHVLXWKCCNQLC

>In-frame_SYNRG_ENST00000591288_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_309aa
MALRPGAGSGGGGAAGAGAGSAGGGGPXQQVGMNLSAIAFIISYANXLISAARYKWLSAANQEVPKNWSXESDSSVGMSSLIIGHIEVIL
LFGXREYXNHGQWXIRQDYCISSLGQYLLKMDRWFGRKXXKNLQMNSVXKVWLMPLSYYMTLALKSGQQMMLSVLXMNYQWFPVSGFXRI
MHVSXCXVETTSVSVSWLVKLXMDAPLNWQGSXSFWLWCVRKNCTAWIGQLKXCKKSAKSLALQWKERTSCRMWQMHLHVLXWKCCNQLC

>In-frame_SYNRG_ENST00000394378_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_309aa
MALRPGAGSGGGGAAGAGAGSAGGGGPXQQVGMNLSAIAFIISYANXLISAARYKWLSAANQEVPKNWSXESDSSVGMSSLIIGHIEVIL
LFGXREYXNHGQWXIRQDYCISSLGQYLLKMDRWFGRKXXKNLQMNSVXKVWLMPLSYYMTLALKSGQQMMLSVLXMNYQWFPVSGFXRI
MHVSXCXVETTSVSVSWLVKLXMDAPLNWQGSXSFWLWCVRKNCTAWIGQLKXCKKSAKSLALQWKERTSCRMWQMHLHVLXWKCCNQLC

>In-frame_SYNRG_ENST00000585472_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_309aa
MALRPGAGSGGGGAAGAGAGSAGGGGPXQQVGMNLSAIAFIISYANXLISAARYKWLSAANQEVPKNWSXESDSSVGMSSLIIGHIEVIL
LFGXREYXNHGQWXIRQDYCISSLGQYLLKMDRWFGRKXXKNLQMNSVXKVWLMPLSYYMTLALKSGQQMMLSVLXMNYQWFPVSGFXRI
MHVSXCXVETTSVSVSWLVKLXMDAPLNWQGSXSFWLWCVRKNCTAWIGQLKXCKKSAKSLALQWKERTSCRMWQMHLHVLXWKCCNQLC


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_SYNRG_ENST00000339208_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_929nt
ATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAG
GTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCA
AACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTG
CTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAG
ATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATG
ACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATA
ATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAA
GGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCT
TTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGT
CTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATT

>In-frame_SYNRG_ENST00000346661_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_929nt
ATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAG
GTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCA
AACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTG
CTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAG
ATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATG
ACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATA
ATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAA
GGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCT
TTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGT
CTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATT

>In-frame_SYNRG_ENST00000345615_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_929nt
ATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAG
GTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCA
AACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTG
CTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAG
ATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATG
ACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATA
ATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAA
GGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCT
TTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGT
CTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATT

>In-frame_SYNRG_ENST00000502449_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_929nt
ATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAG
GTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCA
AACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTG
CTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAG
ATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATG
ACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATA
ATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAA
GGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCT
TTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGT
CTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATT

>In-frame_SYNRG_ENST00000591288_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_929nt
ATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAG
GTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCA
AACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTG
CTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAG
ATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATG
ACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATA
ATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAA
GGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCT
TTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGT
CTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATT

>In-frame_SYNRG_ENST00000394378_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_929nt
ATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAG
GTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCA
AACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTG
CTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAG
ATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATG
ACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATA
ATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAA
GGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCT
TTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGT
CTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATT

>In-frame_SYNRG_ENST00000585472_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_929nt
ATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAG
GTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCA
AACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTG
CTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAG
ATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATG
ACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATA
ATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAA
GGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCT
TTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGT
CTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATT


* Fusion transcript sequences (Full-length transcript).
>In-frame_SYNRG_ENST00000339208_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_1813nt
AGTCACGTGGGCGCGAGGCCCCGCCCCATCGCCCGGTCCGCGGCGAGGTGGGGCCTGGTGTTTGACCCGGAAGTGGCTGTGTTCAGCTGA
CAGCTGCTGATAAGGTGGCGGCGGCGAAGGCAGCGGCAGGTCGGGAGCAAGATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGG
GCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAGGTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCT
TATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCAAACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGAC
TCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTGCTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGG
TGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAGATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTA
CAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATGACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCA
GTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATAATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTT
TCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAAGGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAAC
TGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCTTTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATG
TGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGTCTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATT
TGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATTTGACCATGAATACTCCTCTGTCTACCTAAATCCTCAGAA
AGCCTTGCCTTTAGAGAACGTCACTGAACGAATGATTAGAGGAGTGCTACTTTTTCACTCAAAAAATAGCATCCATGGGACTTTTTATCA
TCTAAGTAACCTAAGAATTCAAAAGCTGGATAGAATTTTAGAAGCAACTACGTACATCATTATTAATATAAAAATAACAGGCAGCCTCAA
GAATGTGCTGAGATTTCTCTGGAAAACAAGCTCTGCCTCTCCGGGTTTTAGTCAACCTAACACCAAACCAAAATAGAATGTTAGCTGTTC
AAGAATCTGGGACCAGCCAACCTGTATGTATGCATTTTTGAAGCAAGAGAAAATTCCATTTTATAGTTAGACCCAAATTCACTAAATAGT
GTGTATGTTCACTTTGTTTAAGTTGTATAGACATAGCCCAGAATGTTTTGTGAAGATTTGCAATATGGTGTTTTGGAATGTGTAGAATAC
AAATCACAGTTTTTACTACCTTCTTGGCATATGCTTACAAAGAACATTATATTTTGTTCATGTTTTACATGAACTAATGGATAAAAAACA
AAGTATACATATATGTCTATATATATATATAGACACACACACACAGACATATATTTCCTTCTTTAAGGTAATCATACAAAAGGTCTATAC
ATACAGGAAGGTATATATTGTCTCAATGCAATCAAATCATCTTTTACTGGGGATTCAAATAAAATGTAGCAAATAAGAGAAAAATAAAAT

>In-frame_SYNRG_ENST00000346661_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_1755nt
TGTTTGACCCGGAAGTGGCTGTGTTCAGCTGACAGCTGCTGATAAGGTGGCGGCGGCGAAGGCAGCGGCAGGTCGGGAGCAAGATGGCGC
TGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAGGTTGGGA
TGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCAAACCAGG
AAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTGCTTTTTG
GTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAGATGGACA
GGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATGACGCTAG
CACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATAATGCACG
TCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAAGGCTCGT
AGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCTTTAGCAC
TCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGTCTGGAGA
CCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATTTGACCAT
GAATACTCCTCTGTCTACCTAAATCCTCAGAAAGCCTTGCCTTTAGAGAACGTCACTGAACGAATGATTAGAGGAGTGCTACTTTTTCAC
TCAAAAAATAGCATCCATGGGACTTTTTATCATCTAAGTAACCTAAGAATTCAAAAGCTGGATAGAATTTTAGAAGCAACTACGTACATC
ATTATTAATATAAAAATAACAGGCAGCCTCAAGAATGTGCTGAGATTTCTCTGGAAAACAAGCTCTGCCTCTCCGGGTTTTAGTCAACCT
AACACCAAACCAAAATAGAATGTTAGCTGTTCAAGAATCTGGGACCAGCCAACCTGTATGTATGCATTTTTGAAGCAAGAGAAAATTCCA
TTTTATAGTTAGACCCAAATTCACTAAATAGTGTGTATGTTCACTTTGTTTAAGTTGTATAGACATAGCCCAGAATGTTTTGTGAAGATT
TGCAATATGGTGTTTTGGAATGTGTAGAATACAAATCACAGTTTTTACTACCTTCTTGGCATATGCTTACAAAGAACATTATATTTTGTT
CATGTTTTACATGAACTAATGGATAAAAAACAAAGTATACATATATGTCTATATATATATATAGACACACACACACAGACATATATTTCC
TTCTTTAAGGTAATCATACAAAAGGTCTATACATACAGGAAGGTATATATTGTCTCAATGCAATCAAATCATCTTTTACTGGGGATTCAA

>In-frame_SYNRG_ENST00000345615_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_1728nt
GCTGACAGCTGCTGATAAGGTGGCGGCGGCGAAGGCAGCGGCAGGTCGGGAGCAAGATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCG
GCGGGGCCGCGGGAGCTGGCGCGGGGTCCGCCGGGGGAGGCGGACCTTAACAGCAGGTTGGGATGAACTTGAGTGCCATCGCGTTTATAA
TTTCTTATGCGAACTGACTAATCTCTGCCGCAAGATACAAATGGCTGTCTGCAGCAAACCAGGAAGTGCCCAAAAACTGGAGTTAAGAAT
CAGACTCTTCTGTAGGAATGTCCTCCTTGATCATTGGACACATCGAAGTGATTCTGCTTTTTGGTTGACGCGAATATTAAAACCATGGCC
AATGGTGAATCAGGCAAGATTACTGTATATCATCTTTGGGCCAATATCTCCTCAAGATGGACAGGTGGTTTGGCAGGAAATGATAGAAGA
ACCTACAGATGAATTCAGTCTGAAAGGTTTGGCTGATGCCATTAAGTTACTATATGACGCTAGCACTAAAGAGTGGACAGCAGATGATGT
TATCAGTCTTGTAGATGAACTATCAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATAATGCACGTCTCCTAATGCTAAGTGGAAACAACAT
CTGTTTCAGTTTCATGGCTAGTAAAGCTGTGAATGGACGCACCATTGAACTGGCAAGGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAA
AGAACTGTACTGCATGGATTGGACAGTTAAAATGATGCAAAAAGTCTGCAAAGTCTTTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCA
GAATGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGCTGCAATCAATTATGTCTGGAGACCGTGATGAAGATGACAGAAGCTTTTT
GAATTTGTTCCATCTTGTACATGCTCAGGCTAACTTCCATAAGGAGGTCCTGTATTTGACCATGAATACTCCTCTGTCTACCTAAATCCT
CAGAAAGCCTTGCCTTTAGAGAACGTCACTGAACGAATGATTAGAGGAGTGCTACTTTTTCACTCAAAAAATAGCATCCATGGGACTTTT
TATCATCTAAGTAACCTAAGAATTCAAAAGCTGGATAGAATTTTAGAAGCAACTACGTACATCATTATTAATATAAAAATAACAGGCAGC
CTCAAGAATGTGCTGAGATTTCTCTGGAAAACAAGCTCTGCCTCTCCGGGTTTTAGTCAACCTAACACCAAACCAAAATAGAATGTTAGC
TGTTCAAGAATCTGGGACCAGCCAACCTGTATGTATGCATTTTTGAAGCAAGAGAAAATTCCATTTTATAGTTAGACCCAAATTCACTAA
ATAGTGTGTATGTTCACTTTGTTTAAGTTGTATAGACATAGCCCAGAATGTTTTGTGAAGATTTGCAATATGGTGTTTTGGAATGTGTAG
AATACAAATCACAGTTTTTACTACCTTCTTGGCATATGCTTACAAAGAACATTATATTTTGTTCATGTTTTACATGAACTAATGGATAAA
AAACAAAGTATACATATATGTCTATATATATATATAGACACACACACACAGACATATATTTCCTTCTTTAAGGTAATCATACAAAAGGTC
TATACATACAGGAAGGTATATATTGTCTCAATGCAATCAAATCATCTTTTACTGGGGATTCAAATAAAATGTAGCAAATAAGAGAAAAAT

>In-frame_SYNRG_ENST00000502449_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_1703nt
GCGGCGAAGGCAGCGGCAGGTCGGGAGCAAGATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGG
GTCCGCCGGGGGAGGCGGACCTTAACAGCAGGTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTC
TGCCGCAAGATACAAATGGCTGTCTGCAGCAAACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTC
CTTGATCATTGGACACATCGAAGTGATTCTGCTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTG
TATATCATCTTTGGGCCAATATCTCCTCAAGATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAA
GGTTTGGCTGATGCCATTAAGTTACTATATGACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCA
GTGGTTCCCCGTGAGTGGCTTCTAGAGAATAATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAA
GCTGTGAATGGACGCACCATTGAACTGGCAAGGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACA
GTTAAAATGATGCAAAAAGTCTGCAAAGTCTTTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGT
GTTATAATGGAAATGCTGCAATCAATTATGTCTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCT
CAGGCTAACTTCCATAAGGAGGTCCTGTATTTGACCATGAATACTCCTCTGTCTACCTAAATCCTCAGAAAGCCTTGCCTTTAGAGAACG
TCACTGAACGAATGATTAGAGGAGTGCTACTTTTTCACTCAAAAAATAGCATCCATGGGACTTTTTATCATCTAAGTAACCTAAGAATTC
AAAAGCTGGATAGAATTTTAGAAGCAACTACGTACATCATTATTAATATAAAAATAACAGGCAGCCTCAAGAATGTGCTGAGATTTCTCT
GGAAAACAAGCTCTGCCTCTCCGGGTTTTAGTCAACCTAACACCAAACCAAAATAGAATGTTAGCTGTTCAAGAATCTGGGACCAGCCAA
CCTGTATGTATGCATTTTTGAAGCAAGAGAAAATTCCATTTTATAGTTAGACCCAAATTCACTAAATAGTGTGTATGTTCACTTTGTTTA
AGTTGTATAGACATAGCCCAGAATGTTTTGTGAAGATTTGCAATATGGTGTTTTGGAATGTGTAGAATACAAATCACAGTTTTTACTACC
TTCTTGGCATATGCTTACAAAGAACATTATATTTTGTTCATGTTTTACATGAACTAATGGATAAAAAACAAAGTATACATATATGTCTAT
ATATATATATAGACACACACACACAGACATATATTTCCTTCTTTAAGGTAATCATACAAAAGGTCTATACATACAGGAAGGTATATATTG

>In-frame_SYNRG_ENST00000591288_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_1698nt
GAAGGCAGCGGCAGGTCGGGAGCAAGATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCG
CCGGGGGAGGCGGACCTTAACAGCAGGTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCG
CAAGATACAAATGGCTGTCTGCAGCAAACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGA
TCATTGGACACATCGAAGTGATTCTGCTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATAT
CATCTTTGGGCCAATATCTCCTCAAGATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTT
GGCTGATGCCATTAAGTTACTATATGACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGT
TCCCCGTGAGTGGCTTCTAGAGAATAATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGT
GAATGGACGCACCATTGAACTGGCAAGGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAA
AATGATGCAAAAAGTCTGCAAAGTCTTTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTAT
AATGGAAATGCTGCAATCAATTATGTCTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGC
TAACTTCCATAAGGAGGTCCTGTATTTGACCATGAATACTCCTCTGTCTACCTAAATCCTCAGAAAGCCTTGCCTTTAGAGAACGTCACT
GAACGAATGATTAGAGGAGTGCTACTTTTTCACTCAAAAAATAGCATCCATGGGACTTTTTATCATCTAAGTAACCTAAGAATTCAAAAG
CTGGATAGAATTTTAGAAGCAACTACGTACATCATTATTAATATAAAAATAACAGGCAGCCTCAAGAATGTGCTGAGATTTCTCTGGAAA
ACAAGCTCTGCCTCTCCGGGTTTTAGTCAACCTAACACCAAACCAAAATAGAATGTTAGCTGTTCAAGAATCTGGGACCAGCCAACCTGT
ATGTATGCATTTTTGAAGCAAGAGAAAATTCCATTTTATAGTTAGACCCAAATTCACTAAATAGTGTGTATGTTCACTTTGTTTAAGTTG
TATAGACATAGCCCAGAATGTTTTGTGAAGATTTGCAATATGGTGTTTTGGAATGTGTAGAATACAAATCACAGTTTTTACTACCTTCTT
GGCATATGCTTACAAAGAACATTATATTTTGTTCATGTTTTACATGAACTAATGGATAAAAAACAAAGTATACATATATGTCTATATATA
TATATAGACACACACACACAGACATATATTTCCTTCTTTAAGGTAATCATACAAAAGGTCTATACATACAGGAAGGTATATATTGTCTCA

>In-frame_SYNRG_ENST00000394378_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_1698nt
GAAGGCAGCGGCAGGTCGGGAGCAAGATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCG
CCGGGGGAGGCGGACCTTAACAGCAGGTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCG
CAAGATACAAATGGCTGTCTGCAGCAAACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGA
TCATTGGACACATCGAAGTGATTCTGCTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATAT
CATCTTTGGGCCAATATCTCCTCAAGATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTT
GGCTGATGCCATTAAGTTACTATATGACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGT
TCCCCGTGAGTGGCTTCTAGAGAATAATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGT
GAATGGACGCACCATTGAACTGGCAAGGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAA
AATGATGCAAAAAGTCTGCAAAGTCTTTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTAT
AATGGAAATGCTGCAATCAATTATGTCTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGC
TAACTTCCATAAGGAGGTCCTGTATTTGACCATGAATACTCCTCTGTCTACCTAAATCCTCAGAAAGCCTTGCCTTTAGAGAACGTCACT
GAACGAATGATTAGAGGAGTGCTACTTTTTCACTCAAAAAATAGCATCCATGGGACTTTTTATCATCTAAGTAACCTAAGAATTCAAAAG
CTGGATAGAATTTTAGAAGCAACTACGTACATCATTATTAATATAAAAATAACAGGCAGCCTCAAGAATGTGCTGAGATTTCTCTGGAAA
ACAAGCTCTGCCTCTCCGGGTTTTAGTCAACCTAACACCAAACCAAAATAGAATGTTAGCTGTTCAAGAATCTGGGACCAGCCAACCTGT
ATGTATGCATTTTTGAAGCAAGAGAAAATTCCATTTTATAGTTAGACCCAAATTCACTAAATAGTGTGTATGTTCACTTTGTTTAAGTTG
TATAGACATAGCCCAGAATGTTTTGTGAAGATTTGCAATATGGTGTTTTGGAATGTGTAGAATACAAATCACAGTTTTTACTACCTTCTT
GGCATATGCTTACAAAGAACATTATATTTTGTTCATGTTTTACATGAACTAATGGATAAAAAACAAAGTATACATATATGTCTATATATA
TATATAGACACACACACACAGACATATATTTCCTTCTTTAAGGTAATCATACAAAAGGTCTATACATACAGGAAGGTATATATTGTCTCA

>In-frame_SYNRG_ENST00000585472_chr17_35969327_-_FBXO47_ENST00000378079_chr17_37107942_-_1698nt
GAAGGCAGCGGCAGGTCGGGAGCAAGATGGCGCTGCGGCCAGGAGCTGGTTCTGGTGGCGGCGGGGCCGCGGGAGCTGGCGCGGGGTCCG
CCGGGGGAGGCGGACCTTAACAGCAGGTTGGGATGAACTTGAGTGCCATCGCGTTTATAATTTCTTATGCGAACTGACTAATCTCTGCCG
CAAGATACAAATGGCTGTCTGCAGCAAACCAGGAAGTGCCCAAAAACTGGAGTTAAGAATCAGACTCTTCTGTAGGAATGTCCTCCTTGA
TCATTGGACACATCGAAGTGATTCTGCTTTTTGGTTGACGCGAATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTATAT
CATCTTTGGGCCAATATCTCCTCAAGATGGACAGGTGGTTTGGCAGGAAATGATAGAAGAACCTACAGATGAATTCAGTCTGAAAGGTTT
GGCTGATGCCATTAAGTTACTATATGACGCTAGCACTAAAGAGTGGACAGCAGATGATGTTATCAGTCTTGTAGATGAACTATCAGTGGT
TCCCCGTGAGTGGCTTCTAGAGAATAATGCACGTCTCCTAATGCTAAGTGGAAACAACATCTGTTTCAGTTTCATGGCTAGTAAAGCTGT
GAATGGACGCACCATTGAACTGGCAAGGCTCGTAGTCTTTTTGGCTTTGGTGTGTGAGAAAGAACTGTACTGCATGGATTGGACAGTTAA
AATGATGCAAAAAGTCTGCAAAGTCTTTAGCACTCCAGTGGAAAGAAAGAACTTCCTGCAGAATGTGGCAAATGCATTTGCATGTGTTAT
AATGGAAATGCTGCAATCAATTATGTCTGGAGACCGTGATGAAGATGACAGAAGCTTTTTGAATTTGTTCCATCTTGTACATGCTCAGGC
TAACTTCCATAAGGAGGTCCTGTATTTGACCATGAATACTCCTCTGTCTACCTAAATCCTCAGAAAGCCTTGCCTTTAGAGAACGTCACT
GAACGAATGATTAGAGGAGTGCTACTTTTTCACTCAAAAAATAGCATCCATGGGACTTTTTATCATCTAAGTAACCTAAGAATTCAAAAG
CTGGATAGAATTTTAGAAGCAACTACGTACATCATTATTAATATAAAAATAACAGGCAGCCTCAAGAATGTGCTGAGATTTCTCTGGAAA
ACAAGCTCTGCCTCTCCGGGTTTTAGTCAACCTAACACCAAACCAAAATAGAATGTTAGCTGTTCAAGAATCTGGGACCAGCCAACCTGT
ATGTATGCATTTTTGAAGCAAGAGAAAATTCCATTTTATAGTTAGACCCAAATTCACTAAATAGTGTGTATGTTCACTTTGTTTAAGTTG
TATAGACATAGCCCAGAATGTTTTGTGAAGATTTGCAATATGGTGTTTTGGAATGTGTAGAATACAAATCACAGTTTTTACTACCTTCTT
GGCATATGCTTACAAAGAACATTATATTTTGTTCATGTTTTACATGAACTAATGGATAAAAAACAAAGTATACATATATGTCTATATATA
TATATAGACACACACACACAGACATATATTTCCTTCTTTAAGGTAATCATACAAAAGGTCTATACATACAGGAAGGTATATATTGTCTCA


Top

FusionGenePPI for SYNRG_FBXO47


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
SYNRGAP1G1, GGA1, AP1G2, SCAMP1, GGA3, GGA2, APPBP2, MLF1, VAPB, AURKA, DYNLT1, XPO1, AP1S2, TUBGCP4, GTSE1, VAPAFBXO47


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with
HgeneSYNRGchr17:35969327chr17:37107942ENST00000339208-122518_786251315A1P1G1 and A1P1G2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000345615-120518_786251225A1P1G1 and A1P1G2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000346661-121518_786251303A1P1G1 and A1P1G2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000585472-121518_786251236A1P1G1 and A1P1G2
HgeneSYNRGchr17:35969327chr17:37107942ENST00000591288-120518_786251109A1P1G1 and A1P1G2


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for SYNRG_FBXO47


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for SYNRG_FBXO47


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneSYNRGC0023893Liver Cirrhosis, Experimental1CTD_human