FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 30956

FusionGeneSummary for REPS2_APOO

check button Fusion gene summary
Fusion gene informationFusion gene name: REPS2_APOO
Fusion gene ID: 30956
HgeneTgene
Gene symbol

REPS2

APOO

Gene ID

9185

79135

Gene nameRALBP1 associated Eps domain containing 2apolipoprotein O
SynonymsPOB1FAM121B|MIC26|Mic23|My025
Cytomap

Xp22.2

Xp22.11

Type of geneprotein-codingprotein-coding
DescriptionralBP1-associated Eps domain-containing protein 2RALBP1-interacting protein 2partner of Ral-binding protein 1partner of RalBP1MICOS complex subunit MIC26MICOS complex subunit MIC23brain my025family with sequence similarity 121B
Modification date2018052220180519
UniProtAcc

Q8NFH8

Q9BUR5

Ensembl transtripts involved in fusion geneENST00000357277, ENST00000303843, 
ENST00000380064, ENST00000469714, 
ENST00000379226, ENST00000476598, 
ENST00000379220, 
Fusion gene scores* DoF score7 X 5 X 8=2805 X 5 X 5=125
# samples 128
** MAII scorelog2(12/280*10)=-1.22239242133645
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(8/125*10)=-0.643856189774725
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: REPS2 [Title/Abstract] AND APOO [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVACCTCGA-OR-A5KV-01AREPS2chrX

16965257

+APOOchrX

23899069

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000357277ENST00000379226REPS2chrX

16965257

+APOOchrX

23899069

-
5CDS-intronENST00000357277ENST00000476598REPS2chrX

16965257

+APOOchrX

23899069

-
5CDS-intronENST00000357277ENST00000379220REPS2chrX

16965257

+APOOchrX

23899069

-
In-frameENST00000303843ENST00000379226REPS2chrX

16965257

+APOOchrX

23899069

-
5CDS-intronENST00000303843ENST00000476598REPS2chrX

16965257

+APOOchrX

23899069

-
5CDS-intronENST00000303843ENST00000379220REPS2chrX

16965257

+APOOchrX

23899069

-
intron-3CDSENST00000380064ENST00000379226REPS2chrX

16965257

+APOOchrX

23899069

-
intron-intronENST00000380064ENST00000476598REPS2chrX

16965257

+APOOchrX

23899069

-
intron-intronENST00000380064ENST00000379220REPS2chrX

16965257

+APOOchrX

23899069

-
intron-3CDSENST00000469714ENST00000379226REPS2chrX

16965257

+APOOchrX

23899069

-
intron-intronENST00000469714ENST00000476598REPS2chrX

16965257

+APOOchrX

23899069

-
intron-intronENST00000469714ENST00000379220REPS2chrX

16965257

+APOOchrX

23899069

-

Top

FusionProtFeatures for REPS2_APOO


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
REPS2

Q8NFH8

APOO

Q9BUR5

Involved in growth factor signaling through itsinfluence on the Ral signaling pathway. Component of the MICOS complex, a large protein complexof the mitochondrial inner membrane that plays crucial roles inthe maintenance of crista junctions, inner membrane architecture,and formation of contact sites to the outer membrane. Plays acrucial role in crista junction formation and mitochondrialfunction (PubMed:25764979). Can promote cardiac lipotoxicity byenhancing mitochondrial respiration and fatty acid metabolism incardiac myoblasts (PubMed:24743151). Promotes cholesterol effluxfrom macrophage cells. Detected in HDL, LDL and VLDL. Secreted bya microsomal triglyceride transfer protein (MTTP)-dependentmechanism, probably as a VLDL-associated protein that issubsequently transferred to HDL (PubMed:16956892).{ECO:0000269|PubMed:16956892, ECO:0000269|PubMed:24743151,ECO:0000269|PubMed:25764979}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+1183_7691660Compositional biasNote=Ala-rich
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+1183_7691661Compositional biasNote=Ala-rich
TgeneAPOOchrX:16965257chrX:23899069ENST00000379226-09108_1283191TransmembraneHelical

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+118328_33991660Calcium bindingOntology_term=ECO:0000255
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+118328_33991661Calcium bindingOntology_term=ECO:0000255
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+118601_65791660Coiled coilOntology_term=ECO:0000255
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+118601_65791661Coiled coilOntology_term=ECO:0000255
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+118477_52491660Compositional biasNote=Pro-rich
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+118477_52491661Compositional biasNote=Pro-rich
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+118282_37391660DomainEH 2
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+118315_35091660DomainEF-hand
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+11834_14791660DomainEH 1
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+118282_37391661DomainEH 2
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+118315_35091661DomainEF-hand
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+11834_14791661DomainEH 1


Top

FusionGeneSequence for REPS2_APOO


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_REPS2_ENST00000357277_chrX_16965257_+_APOO_ENST00000379226_chrX_23899069_-_91aa
MEAAAAAAAAAAAAAAAGGGCGSGPPPLLLSEGEQQCYSELFARCAGAAGGGPGSGPPEAARVAPGTATAAAGPVADLFRASQLPAETLH

>In-frame_REPS2_ENST00000303843_chrX_16965257_+_APOO_ENST00000379226_chrX_23899069_-_91aa
MEAAAAAAAAAAAAAAAGGGCGSGPPPLLLSEGEQQCYSELFARCAGAAGGGPGSGPPEAARVAPGTATAAAGPVADLFRASQLPAETLH


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_REPS2_ENST00000357277_chrX_16965257_+_APOO_ENST00000379226_chrX_23899069_-_273nt
ATGGAGGCGGCAGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCAGCGGCGGGCGGGGGCTGTGGCTCCGGGCCGCCGCCGCTGCTGCTG
AGCGAGGGCGAGCAGCAGTGCTACTCCGAGCTCTTCGCGCGCTGTGCCGGCGCCGCGGGCGGGGGCCCCGGGTCTGGGCCCCCCGAGGCC
GCCAGAGTCGCCCCCGGCACGGCCACTGCGGCCGCCGGCCCCGTGGCTGACCTGTTTCGGGCATCGCAGCTGCCCGCCGAGACGCTGCAC

>In-frame_REPS2_ENST00000303843_chrX_16965257_+_APOO_ENST00000379226_chrX_23899069_-_273nt
ATGGAGGCGGCAGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCAGCGGCGGGCGGGGGCTGTGGCTCCGGGCCGCCGCCGCTGCTGCTG
AGCGAGGGCGAGCAGCAGTGCTACTCCGAGCTCTTCGCGCGCTGTGCCGGCGCCGCGGGCGGGGGCCCCGGGTCTGGGCCCCCCGAGGCC
GCCAGAGTCGCCCCCGGCACGGCCACTGCGGCCGCCGGCCCCGTGGCTGACCTGTTTCGGGCATCGCAGCTGCCCGCCGAGACGCTGCAC


* Fusion transcript sequences (Full-length transcript).
>In-frame_REPS2_ENST00000357277_chrX_16965257_+_APOO_ENST00000379226_chrX_23899069_-_1321nt
CCGGGAGGAAGCGGCCGCGCGGCAGCTGCGGGGCGTGGGGGTGGTGGTGGCGGCGGCGGTGGTGGCGGCGGCGGCGGCGGCGGCAGCTGA
GGCCGAGGAGGCGGTGGCTGTGGCGGACGCAGCAGCACCCCAGCTAGGGACAGGGCTCCGCCGCGCCCCCTTGCTGGCCCCATGGAGGCG
GCAGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCAGCGGCGGGCGGGGGCTGTGGCTCCGGGCCGCCGCCGCTGCTGCTGAGCGAGGGC
GAGCAGCAGTGCTACTCCGAGCTCTTCGCGCGCTGTGCCGGCGCCGCGGGCGGGGGCCCCGGGTCTGGGCCCCCCGAGGCCGCCAGAGTC
GCCCCCGGCACGGCCACTGCGGCCGCCGGCCCCGTGGCTGACCTGTTTCGGGCATCGCAGCTGCCCGCCGAGACGCTGCACCAGGTAATT
CAGAGGTCCGTGGGGCCAGCCAGCCTGAGCTTGCTCACCTTCAAAGTCTATGCAGCACCAAAAAAGGACTCACCTCCCAAAAATTCCGTG
AAGGTTGATGAGCTTTCACTCTACTCAGTTCCTGAGGGTCAATCGAAGTATGTGGAGGAGGCAAGGAGCCAGCTTGAAGAAAGCATCTCA
CAGCTCCGACACTATTGCGAGCCATACACAACCTGGTGTCAGGAAACGTACTCCCAAACTAAGCCCAAGATGCAAAGTTTGGTTCAATGG
GGGTTAGACAGCTATGACTATCTCCAAAATGCACCTCCTGGATTTTTTCCGAGACTTGGTGTTATTGGTTTTGCTGGCCTTATTGGACTC
CTTTTGGCTAGAGGTTCAAAAATAAAGAAGCTAGTGTATCCGCCTGGTTTCATGGGATTAGCTGCCTCCCTCTATTATCCACAACAAGCC
ATCGTGTTTGCCCAGGTCAGTGGGGAGAGATTATATGACTGGGGTTTACGAGGATATATAGTCATAGAAGATTTGTGGAAGGAGAACTTT
CAAAAGCCAGGAAATGTGAAGAATTCACCTGGAACTAAGTAGAAAACTCCATGCTCTGCCATCTTAATCAGTTATAGGTAAACATTGGAA
ACTCCATAGAATAAATCAGTATTTCTACAGAAAAATGGCATAGAAGTCAGTATTGAATGTATTAAATTGGCTTTCTTCTTCAGGAAAAAC
TAGACCAGACCTCTGTTATCTTCTGTGAAATCATCCTACAAGCAAACTAACCTGGAATCCCTTCACCTAGAGATAATGTACAAGCCTTAG

>In-frame_REPS2_ENST00000303843_chrX_16965257_+_APOO_ENST00000379226_chrX_23899069_-_1150nt
ATGGAGGCGGCAGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCAGCGGCGGGCGGGGGCTGTGGCTCCGGGCCGCCGCCGCTGCTGCTG
AGCGAGGGCGAGCAGCAGTGCTACTCCGAGCTCTTCGCGCGCTGTGCCGGCGCCGCGGGCGGGGGCCCCGGGTCTGGGCCCCCCGAGGCC
GCCAGAGTCGCCCCCGGCACGGCCACTGCGGCCGCCGGCCCCGTGGCTGACCTGTTTCGGGCATCGCAGCTGCCCGCCGAGACGCTGCAC
CAGGTAATTCAGAGGTCCGTGGGGCCAGCCAGCCTGAGCTTGCTCACCTTCAAAGTCTATGCAGCACCAAAAAAGGACTCACCTCCCAAA
AATTCCGTGAAGGTTGATGAGCTTTCACTCTACTCAGTTCCTGAGGGTCAATCGAAGTATGTGGAGGAGGCAAGGAGCCAGCTTGAAGAA
AGCATCTCACAGCTCCGACACTATTGCGAGCCATACACAACCTGGTGTCAGGAAACGTACTCCCAAACTAAGCCCAAGATGCAAAGTTTG
GTTCAATGGGGGTTAGACAGCTATGACTATCTCCAAAATGCACCTCCTGGATTTTTTCCGAGACTTGGTGTTATTGGTTTTGCTGGCCTT
ATTGGACTCCTTTTGGCTAGAGGTTCAAAAATAAAGAAGCTAGTGTATCCGCCTGGTTTCATGGGATTAGCTGCCTCCCTCTATTATCCA
CAACAAGCCATCGTGTTTGCCCAGGTCAGTGGGGAGAGATTATATGACTGGGGTTTACGAGGATATATAGTCATAGAAGATTTGTGGAAG
GAGAACTTTCAAAAGCCAGGAAATGTGAAGAATTCACCTGGAACTAAGTAGAAAACTCCATGCTCTGCCATCTTAATCAGTTATAGGTAA
ACATTGGAAACTCCATAGAATAAATCAGTATTTCTACAGAAAAATGGCATAGAAGTCAGTATTGAATGTATTAAATTGGCTTTCTTCTTC
AGGAAAAACTAGACCAGACCTCTGTTATCTTCTGTGAAATCATCCTACAAGCAAACTAACCTGGAATCCCTTCACCTAGAGATAATGTAC


Top

FusionGenePPI for REPS2_APOO


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
REPS2RALBP1, GRB2, EPS15, EPN1, AR, AMPH, AP2A1, CDK1, GNL2, CSNK2A2, CHORDC1, PRMT7, UGGT1, MYO6, REPS1, AP2M1APOOCDK2, TIMMDC1, C19orf70, APOOL


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+118561_66091660ASAP1
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+118561_66091661ASAP1
HgeneREPS2chrX:16965257chrX:23899069ENST00000303843+118514_66091660RALBP1
HgeneREPS2chrX:16965257chrX:23899069ENST00000357277+118514_66091661RALBP1


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for REPS2_APOO


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for REPS2_APOO


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneREPS2C1458155Mammary Neoplasms1CTD_human