FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 25257

FusionGeneSummary for NUP98_HOXC13

check button Fusion gene summary
Fusion gene informationFusion gene name: NUP98_HOXC13
Fusion gene ID: 25257
HgeneTgene
Gene symbol

NUP98

HOXC13

Gene ID

4928

3229

Gene namenucleoporin 98homeobox C13
SynonymsADIR2|NUP196|NUP96ECTD9|HOX3|HOX3G
Cytomap

11p15.4

12q13.13

Type of geneprotein-codingprotein-coding
Descriptionnuclear pore complex protein Nup98-Nup96nuclear pore complex protein Nup98GLFG-repeat containing nucleoporinNUP98/PHF23 fusion 2 proteinNup98-Nup96nucleoporin 98kDnucleoporin 98kDahomeobox protein Hox-C13NUP98/HOXC13homeo box 3Ghomeobox protein Hox-3G
Modification date2018052320180519
UniProtAcc

P52948

P31276

Ensembl transtripts involved in fusion geneENST00000324932, ENST00000359171, 
ENST00000355260, ENST00000397004, 
ENST00000397007, ENST00000488828, 
ENST00000243056, 
Fusion gene scores* DoF score16 X 12 X 7=13442 X 2 X 2=8
# samples 212
** MAII scorelog2(21/1344*10)=-2.67807190511264
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(2/8*10)=1.32192809488736
Context

PubMed: NUP98 [Title/Abstract] AND HOXC13 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationOncogene involved fusion gene, in-frame and retained their domain.
Tumor suppressor gene involved fusion gene, in-frame but not retained their domain.
Transcription factor involved fusion gene, inframe and retained DNA-binding domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID

check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1AJ438986NUP98chr11

3744387

-HOXC13chr12

54338780

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000324932ENST00000243056NUP98chr11

3744387

-HOXC13chr12

54338780

+
Frame-shitENST00000359171ENST00000243056NUP98chr11

3744387

-HOXC13chr12

54338780

+
In-frameENST00000355260ENST00000243056NUP98chr11

3744387

-HOXC13chr12

54338780

+
In-frameENST00000397004ENST00000243056NUP98chr11

3744387

-HOXC13chr12

54338780

+
In-frameENST00000397007ENST00000243056NUP98chr11

3744387

-HOXC13chr12

54338780

+
intron-3CDSENST00000488828ENST00000243056NUP98chr11

3744387

-HOXC13chr12

54338780

+

Top

FusionProtFeatures for NUP98_HOXC13


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
NUP98

P52948

HOXC13

P31276

Transcription factor which plays a role in hair follicledifferentiation. Regulates FOXQ1 expression and that of otherhair-specific genes (By similarity). {ECO:0000250}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneNUP98chr11:3744387chr12:54338780ENST00000324932-16337_4807151801Compositional biasNote=Gly/Thr-rich
HgeneNUP98chr11:3744387chr12:54338780ENST00000355260-16327_4807151727Compositional biasNote=Gly/Thr-rich
HgeneNUP98chr11:3744387chr12:54338780ENST00000397004-16207_480715921Compositional biasNote=Gly/Thr-rich
HgeneNUP98chr11:3744387chr12:54338780ENST00000397007-16207_480732938Compositional biasNote=Gly/Thr-rich
HgeneNUP98chr11:3744387chr12:54338780ENST00000324932-16331_1567151801RegionNote=FG repeats 1
HgeneNUP98chr11:3744387chr12:54338780ENST00000324932-1633214_4807151801RegionNote=FG repeats 2
HgeneNUP98chr11:3744387chr12:54338780ENST00000355260-16321_1567151727RegionNote=FG repeats 1
HgeneNUP98chr11:3744387chr12:54338780ENST00000355260-1632214_4807151727RegionNote=FG repeats 2
HgeneNUP98chr11:3744387chr12:54338780ENST00000397004-16201_156715921RegionNote=FG repeats 1
HgeneNUP98chr11:3744387chr12:54338780ENST00000397004-1620214_480715921RegionNote=FG repeats 2
HgeneNUP98chr11:3744387chr12:54338780ENST00000397007-16201_156732938RegionNote=FG repeats 1
HgeneNUP98chr11:3744387chr12:54338780ENST00000397007-1620214_480732938RegionNote=FG repeats 2
TgeneHOXC13chr11:3744387chr12:54338780ENST00000243056+02260_319245331DNA bindingHomeobox

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneNUP98chr11:3744387chr12:54338780ENST00000324932-1633890_8947151801Compositional biasNote=Poly-Glu
HgeneNUP98chr11:3744387chr12:54338780ENST00000355260-1632890_8947151727Compositional biasNote=Poly-Glu
HgeneNUP98chr11:3744387chr12:54338780ENST00000397004-1620890_894715921Compositional biasNote=Poly-Glu
HgeneNUP98chr11:3744387chr12:54338780ENST00000397007-1620890_894732938Compositional biasNote=Poly-Glu
HgeneNUP98chr11:3744387chr12:54338780ENST00000324932-1633738_8807151801DomainPeptidase S59
HgeneNUP98chr11:3744387chr12:54338780ENST00000355260-1632738_8807151727DomainPeptidase S59
HgeneNUP98chr11:3744387chr12:54338780ENST00000397004-1620738_880715921DomainPeptidase S59
HgeneNUP98chr11:3744387chr12:54338780ENST00000397007-1620738_880732938DomainPeptidase S59
TgeneHOXC13chr11:3744387chr12:54338780ENST00000243056+0227_61245331Compositional biasNote=Gly-rich


Top

FusionGeneSequence for NUP98_HOXC13


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_NUP98_ENST00000324932_chr11_3744387_-_HOXC13_ENST00000243056_chr12_54338780_+_4112nt
AACCGCGGCGGCGAGGGGCGGGACTCCACGGCCCTCTCACCGCTCCTACCCTGTGCCTCCCCGAACTCCTTCTGCCCCTCCTCTTCCCTC
TCGCCCCTTCCCCCTTCAGTTCGGTTTCAAAAGACGCGTTGCCCAATGAATAACAGGGTCGACCCAGAGTGGCGGCCGCGTCCACCAATT
CGCGGACGGCGAGGGCGGAGCGTCCGCAACGAGCCTCTGACGCCGGGCGGCGTGTGACGCAGTCGGGCCCTCTGCGCGCTGCGCCCGAAG
CGGCGGTCGGTGGCAGGGGTGGTAGCGGCGGCGGCGACGGTTTCGTGGGGGCCGCGCGCTGCTCTGTGAGCGGCGGGTGGCAGCAGGGGA
CTCCTGACACTTCCCCTTCCCCACCGAACCGCGCTTTCTGAAACAAAGACTCATTTTGAAGATGTTTAACAAATCATTTGGAACACCCTT
TGGGGGTGGCACAGGTGGCTTTGGCACAACTTCAACATTTGGACAGAATACTGGCTTTGGCACTACTAGTGGAGGGGCATTTGGAACATC
TGCATTTGGTTCTAGCAACAATACTGGAGGCCTCTTTGGAAATTCACAGACTAAACCAGGAGGATTGTTTGGAACCAGTTCATTTAGCCA
GCCAGCTACCTCCACAAGCACTGGCTTTGGGTTTGGTACGTCAACAGGAACAGCAAATACCTTGTTTGGAACTGCAAGCACAGGGACCAG
TCTCTTCTCATCCCAAAACAATGCCTTTGCACAAAATAAACCAACTGGCTTTGGCAATTTTGGAACCAGTACTAGCAGTGGAGGACTCTT
TGGAACCACAAATACCACCTCTAATCCTTTTGGCAGCACATCTGGCTCCCTCTTTGGGCCAAGTAGTTTTACAGCTGCTCCTACTGGGAC
TACTATTAAATTTAACCCTCCAACTGGTACAGATACTATGGTCAAAGCTGGAGTTAGCACTAACATAAGTACCAAGCACCAGTGTATTAC
TGCTATGAAAGAATATGAAAGCAAGTCACTAGAGGAACTTCGTTTAGAGGATTATCAGGCTAACAGGAAGGGCCCACAGAACCAGGTGGG
AGCAGGTACCACAACTGGCTTGTTTGGGTCTTCTCCAGCCACTTCCAGCGCAACAGGACTCTTCAGCTCCTCCACCACTAATTCAGGCTT
TGCATATGGTCAGAACAAAACTGCCTTTGGAACTAGTACAACTGGATTTGGAACAAATCCAGGTGGTCTCTTTGGCCAACAGAATCAGCA
GACTACCAGCCTCTTCAGCAAACCATTTGGCCAGGCTACAACCACCCAGAACACTGGCTTTTCCTTTGGTAATACCAGCACCATAGGACA
GCCAAGCACCAACACCATGGGATTATTTGGAGTAACCCAAGCCTCACAGCCTGGAGGTCTTTTTGGGACAGCTACAAACACCAGCACTGG
GACAGCATTTGGAACAGGAACAGGTCTCTTTGGGCAGACCAATACTGGATTTGGTGCTGTTGGTTCGACCCTGTTTGGCAATAACAAGCT
TACTACATTTGGAAGCAGCACAACCAGTGCACCTTCATTTGGTACAACCAGTGGCGGGCTCTTTGGTTTTGGCACAAATACCAGTGGGAA
TAGTATTTTTGGAAGTAAACCAGCACCTGGGACTCTTGGAACTGGGCTTGGTGCAGGATTTGGAACAGCTCTTGGTGCTGGACAGGCATC
TTTGTTTGGGAACAACCAACCTAAGATTGGAGGGCCTCTTGGTACAGGAGCCTTTGGGGCCCCTGGATTTAATACTACGACAGCCACTTT
GGGCTTTGGAGCCCCCCAGGCCCCAGTAGCTTTGACAGATCCAAATGCTTCTGCTGCCCAGCAGGCTGTTCTCCAGCAGCACATCAATAG
TCTAACATACTCACCTTTTGGAGACTCTCCTCTCTTCCGGAATCCGATGTCAGACCCTAAGAAGAAGGAAGAGAGATTGAAACCAACAAA
TCCAGCAGCCCAGAAGGCTCTTACTACACCTACTCATTATAAACTGACACCCCGCCCTGCCACTAGAGTCCGGCCAAAGGCTTTACAAAC
AACAGGCACAGCCAAGTCACATCTCTTTGATGGGCTGGATGACGATGAACCATCCCTAGCCAATGGAGCATTCATGCCCAAGAAGAGCAT
TAAGAAGTTGGTTTTGAAGAACCTTAATAATAGCAATCTCTTTTCTCCTGTTAATCGTGATTCAGAAAATCTAGCTTCACCATCTGAATA
TCCAGAAAATGGAGAGAGATTTAGTTTCCTAAGCAAACCTGTTGATGAGAATCACCAGCAGGATGGAGATGAAGATTCCCTTGTTTCACA
TTTTTATACTAACCCTATTGCCAAACCTATTCCTCAAACCCCAGAAAGTGCTGGAAATAAACACAGCAACAGCAACAGTGTGGATGATAC
CATTGTTGCATTAAACATGCGTGCTGCTTTGCGAAATGGGCTGGAAGGAAGCAGTGAAGAAACGTCTTTTCATGATGAGTCACTTCAGGA
TGACCGAGAAGAAATAGAAAATAATTCTTACCATATGCACCCAGCAGACGTGGTTCCCCTGCAGCCCGAGGTGAGCAGCTACCGGCGCGG
GCGCAAGAAACGCGTGCCCTACACTAAGGTGCAGCTGAAGGAGCTAGAGAAGGAATACGCGGCTAGCAAGTTCATCACCAAAGAGAAGCG
CCGGCGCATCTCCGCCACCACGAACCTCTCTGAGCGCCAGGTAACCATCTGGTTCCAGAACCGGCGGGTCAAAGAGAAGAAGGTGGTCAG
CAAATCGAAAGCGCCTCATCTCCACTCCACCTGACCACCCACCCGCTGCTTGCCCCATCTATTTATGTCTCCGCTTTGTACCATAACCGA
ACCCACGGAAAGACGCTGCGCGGGTGCAGAAGAGTATTTAATGTTAAGGAAAGAGAAGAACCGCGCCGCCCGGAGGCAGAGAGGCTCCAT
GGCCGTGCTGCTGGGCCATCCCCAACTCCCTATCCCATCCCCAGCCTCCACCCCCATCCAGATGGGACTCACGTGGCTTCAACAGCTTTG
GAAATGGGTCCCGAGTGGGCCGTGCGAGGAAGGCTGTCGACCTCTACTCCTCCTTGCGCTCACCTTGCCAGAAAGTCTGGTGGCAGCGCA
GAGCCCAATCATTCCAACCAAAGCAGGGTTGGGGAATCCCGAATGGCCCCAATTCTTGCCTCATCCTATGACCAGGCTTTTAGAGGACCT
TCCCTAAGGGCGCAGCTTCGGAGCAGGATCTGTCCAGCTCATACTTTCCTTCGCTGTCCCTCCCGCACTCCTTAGGCAAGATTTCCCAGT
AAAGATTTTCTGTGCGTATTTTAAAAGTCGTGTTAATACTCATGATAATTATTAGGGACCTGGCAGCGTGATTGGAGTATGGATGTTTCC
GTAAAAGCTGGAATTCCGTAAAAGCATTGACGCAGCCCCTACACTCCATCCCAACCAAGAAACTGCATTTCCTGGGGCCAGGTGGGAGCT
GCCTTTGCCCCACTGCCTCCCCTGTTCTGCTCTCTCAGTCAACATGTGGAAATCCAAGGAGGACAAAGACTCCAGCCACGCTGCTAAATA
GGGCTCCTCTCTCCTCTCTCTCTCTCTAGGTGGTAAGGTTGGGGATTAGTCCAGGTACAGAAGCAGAACTTTTTTCTAAGGATAAACATC
TCTTCCAAGGGGATGGAGAGTGGGTCCCTCAACAAAGTCCCTGTCCAGTCACCTTTCCATCAGGGCACTAGCCCAGGAATGACTCCTCAC
ACTTTCACCTTTACTGATTTCCAGAGGAAAGCTAGAGGATCTAGTTCAAGAGGCAAGAAGATCTGGCCCTCAATTAGCTAGATGTAGATG
CTGCCTAACAGTTCCCTCCTCAAAGGCCACCTTGGTGCTGTGGGGGCCCCTTGCCTCTTCCCTTCCCACTGGTGCATTACAAAACAGTGT
TCTTTTGAAATGTTCATCAGGAATAGGCTTTTTTAAAAAATGTTGTGTATCTGTATATAGTATTGTGATGTCTGAATGACAATGTACTGA

>In-frame_NUP98_ENST00000355260_chr11_3744387_-_HOXC13_ENST00000243056_chr12_54338780_+_3778nt
TGTGAGCGGCGGGTGGCAGCAGGGGACTCCTGACACTTCCCCTTCCCCACCGAACCGCGCTTTCTGAAACAAAGACTCATTTTGAAGATG
TTTAACAAATCATTTGGAACACCCTTTGGGGGTGGCACAGGTGGCTTTGGCACAACTTCAACATTTGGACAGAATACTGGCTTTGGCACT
ACTAGTGGAGGGGCATTTGGAACATCTGCATTTGGTTCTAGCAACAATACTGGAGGCCTCTTTGGAAATTCACAGACTAAACCAGGAGGA
TTGTTTGGAACCAGTTCATTTAGCCAGCCAGCTACCTCCACAAGCACTGGCTTTGGGTTTGGTACGTCAACAGGAACAGCAAATACCTTG
TTTGGAACTGCAAGCACAGGGACCAGTCTCTTCTCATCCCAAAACAATGCCTTTGCACAAAATAAACCAACTGGCTTTGGCAATTTTGGA
ACCAGTACTAGCAGTGGAGGACTCTTTGGAACCACAAATACCACCTCTAATCCTTTTGGCAGCACATCTGGCTCCCTCTTTGGGCCAAGT
AGTTTTACAGCTGCTCCTACTGGGACTACTATTAAATTTAACCCTCCAACTGGTACAGATACTATGGTCAAAGCTGGAGTTAGCACTAAC
ATAAGTACCAAGCACCAGTGTATTACTGCTATGAAAGAATATGAAAGCAAGTCACTAGAGGAACTTCGTTTAGAGGATTATCAGGCTAAC
AGGAAGGGCCCACAGAACCAGGTGGGAGCAGGTACCACAACTGGCTTGTTTGGGTCTTCTCCAGCCACTTCCAGCGCAACAGGACTCTTC
AGCTCCTCCACCACTAATTCAGGCTTTGCATATGGTCAGAACAAAACTGCCTTTGGAACTAGTACAACTGGATTTGGAACAAATCCAGGT
GGTCTCTTTGGCCAACAGAATCAGCAGACTACCAGCCTCTTCAGCAAACCATTTGGCCAGGCTACAACCACCCAGAACACTGGCTTTTCC
TTTGGTAATACCAGCACCATAGGACAGCCAAGCACCAACACCATGGGATTATTTGGAGTAACCCAAGCCTCACAGCCTGGAGGTCTTTTT
GGGACAGCTACAAACACCAGCACTGGGACAGCATTTGGAACAGGAACAGGTCTCTTTGGGCAGACCAATACTGGATTTGGTGCTGTTGGT
TCGACCCTGTTTGGCAATAACAAGCTTACTACATTTGGAAGCAGCACAACCAGTGCACCTTCATTTGGTACAACCAGTGGCGGGCTCTTT
GGTTTTGGCACAAATACCAGTGGGAATAGTATTTTTGGAAGTAAACCAGCACCTGGGACTCTTGGAACTGGGCTTGGTGCAGGATTTGGA
ACAGCTCTTGGTGCTGGACAGGCATCTTTGTTTGGGAACAACCAACCTAAGATTGGAGGGCCTCTTGGTACAGGAGCCTTTGGGGCCCCT
GGATTTAATACTACGACAGCCACTTTGGGCTTTGGAGCCCCCCAGGCCCCAGTAGCTTTGACAGATCCAAATGCTTCTGCTGCCCAGCAG
GCTGTTCTCCAGCAGCACATCAATAGTCTAACATACTCACCTTTTGGAGACTCTCCTCTCTTCCGGAATCCGATGTCAGACCCTAAGAAG
AAGGAAGAGAGATTGAAACCAACAAATCCAGCAGCCCAGAAGGCTCTTACTACACCTACTCATTATAAACTGACACCCCGCCCTGCCACT
AGAGTCCGGCCAAAGGCTTTACAAACAACAGGCACAGCCAAGTCACATCTCTTTGATGGGCTGGATGACGATGAACCATCCCTAGCCAAT
GGAGCATTCATGCCCAAGAAGAGCATTAAGAAGTTGGTTTTGAAGAACCTTAATAATAGCAATCTCTTTTCTCCTGTTAATCGTGATTCA
GAAAATCTAGCTTCACCATCTGAATATCCAGAAAATGGAGAGAGATTTAGTTTCCTAAGCAAACCTGTTGATGAGAATCACCAGCAGGAT
GGAGATGAAGATTCCCTTGTTTCACATTTTTATACTAACCCTATTGCCAAACCTATTCCTCAAACCCCAGAAAGTGCTGGAAATAAACAC
AGCAACAGCAACAGTGTGGATGATACCATTGTTGCATTAAACATGCGTGCTGCTTTGCGAAATGGGCTGGAAGGAAGCAGTGAAGAAACG
TCTTTTCATGATGAGTCACTTCAGGATGACCGAGAAGAAATAGAAAATAATTCTTACCATATGCACCCAGCAGACGTGGTTCCCCTGCAG
CCCGAGGTGAGCAGCTACCGGCGCGGGCGCAAGAAACGCGTGCCCTACACTAAGGTGCAGCTGAAGGAGCTAGAGAAGGAATACGCGGCT
AGCAAGTTCATCACCAAAGAGAAGCGCCGGCGCATCTCCGCCACCACGAACCTCTCTGAGCGCCAGGTAACCATCTGGTTCCAGAACCGG
CGGGTCAAAGAGAAGAAGGTGGTCAGCAAATCGAAAGCGCCTCATCTCCACTCCACCTGACCACCCACCCGCTGCTTGCCCCATCTATTT
ATGTCTCCGCTTTGTACCATAACCGAACCCACGGAAAGACGCTGCGCGGGTGCAGAAGAGTATTTAATGTTAAGGAAAGAGAAGAACCGC
GCCGCCCGGAGGCAGAGAGGCTCCATGGCCGTGCTGCTGGGCCATCCCCAACTCCCTATCCCATCCCCAGCCTCCACCCCCATCCAGATG
GGACTCACGTGGCTTCAACAGCTTTGGAAATGGGTCCCGAGTGGGCCGTGCGAGGAAGGCTGTCGACCTCTACTCCTCCTTGCGCTCACC
TTGCCAGAAAGTCTGGTGGCAGCGCAGAGCCCAATCATTCCAACCAAAGCAGGGTTGGGGAATCCCGAATGGCCCCAATTCTTGCCTCAT
CCTATGACCAGGCTTTTAGAGGACCTTCCCTAAGGGCGCAGCTTCGGAGCAGGATCTGTCCAGCTCATACTTTCCTTCGCTGTCCCTCCC
GCACTCCTTAGGCAAGATTTCCCAGTAAAGATTTTCTGTGCGTATTTTAAAAGTCGTGTTAATACTCATGATAATTATTAGGGACCTGGC
AGCGTGATTGGAGTATGGATGTTTCCGTAAAAGCTGGAATTCCGTAAAAGCATTGACGCAGCCCCTACACTCCATCCCAACCAAGAAACT
GCATTTCCTGGGGCCAGGTGGGAGCTGCCTTTGCCCCACTGCCTCCCCTGTTCTGCTCTCTCAGTCAACATGTGGAAATCCAAGGAGGAC
AAAGACTCCAGCCACGCTGCTAAATAGGGCTCCTCTCTCCTCTCTCTCTCTCTAGGTGGTAAGGTTGGGGATTAGTCCAGGTACAGAAGC
AGAACTTTTTTCTAAGGATAAACATCTCTTCCAAGGGGATGGAGAGTGGGTCCCTCAACAAAGTCCCTGTCCAGTCACCTTTCCATCAGG
GCACTAGCCCAGGAATGACTCCTCACACTTTCACCTTTACTGATTTCCAGAGGAAAGCTAGAGGATCTAGTTCAAGAGGCAAGAAGATCT
GGCCCTCAATTAGCTAGATGTAGATGCTGCCTAACAGTTCCCTCCTCAAAGGCCACCTTGGTGCTGTGGGGGCCCCTTGCCTCTTCCCTT
CCCACTGGTGCATTACAAAACAGTGTTCTTTTGAAATGTTCATCAGGAATAGGCTTTTTTAAAAAATGTTGTGTATCTGTATATAGTATT

>In-frame_NUP98_ENST00000397004_chr11_3744387_-_HOXC13_ENST00000243056_chr12_54338780_+_3861nt
CTGCGCGCTGCGCCCGAAGCGGCGGTCGGTGGCAGGGGTGGTAGCGGCGGCGGCGACGGTTTCGTGGGGGCCGCGCGCTGCTCTGTGAGC
GGCGGGTGGCAGCAGGGGACTCCTGACACTTCCCCTTCCCCACCGAACCGCGCTTTCTGAAACAAAGACTCATTTTGAAGATGTTTAACA
AATCATTTGGAACACCCTTTGGGGGTGGCACAGGTGGCTTTGGCACAACTTCAACATTTGGACAGAATACTGGCTTTGGCACTACTAGTG
GAGGGGCATTTGGAACATCTGCATTTGGTTCTAGCAACAATACTGGAGGCCTCTTTGGAAATTCACAGACTAAACCAGGAGGATTGTTTG
GAACCAGTTCATTTAGCCAGCCAGCTACCTCCACAAGCACTGGCTTTGGGTTTGGTACGTCAACAGGAACAGCAAATACCTTGTTTGGAA
CTGCAAGCACAGGGACCAGTCTCTTCTCATCCCAAAACAATGCCTTTGCACAAAATAAACCAACTGGCTTTGGCAATTTTGGAACCAGTA
CTAGCAGTGGAGGACTCTTTGGAACCACAAATACCACCTCTAATCCTTTTGGCAGCACATCTGGCTCCCTCTTTGGGCCAAGTAGTTTTA
CAGCTGCTCCTACTGGGACTACTATTAAATTTAACCCTCCAACTGGTACAGATACTATGGTCAAAGCTGGAGTTAGCACTAACATAAGTA
CCAAGCACCAGTGTATTACTGCTATGAAAGAATATGAAAGCAAGTCACTAGAGGAACTTCGTTTAGAGGATTATCAGGCTAACAGGAAGG
GCCCACAGAACCAGGTGGGAGCAGGTACCACAACTGGCTTGTTTGGGTCTTCTCCAGCCACTTCCAGCGCAACAGGACTCTTCAGCTCCT
CCACCACTAATTCAGGCTTTGCATATGGTCAGAACAAAACTGCCTTTGGAACTAGTACAACTGGATTTGGAACAAATCCAGGTGGTCTCT
TTGGCCAACAGAATCAGCAGACTACCAGCCTCTTCAGCAAACCATTTGGCCAGGCTACAACCACCCAGAACACTGGCTTTTCCTTTGGTA
ATACCAGCACCATAGGACAGCCAAGCACCAACACCATGGGATTATTTGGAGTAACCCAAGCCTCACAGCCTGGAGGTCTTTTTGGGACAG
CTACAAACACCAGCACTGGGACAGCATTTGGAACAGGAACAGGTCTCTTTGGGCAGACCAATACTGGATTTGGTGCTGTTGGTTCGACCC
TGTTTGGCAATAACAAGCTTACTACATTTGGAAGCAGCACAACCAGTGCACCTTCATTTGGTACAACCAGTGGCGGGCTCTTTGGTTTTG
GCACAAATACCAGTGGGAATAGTATTTTTGGAAGTAAACCAGCACCTGGGACTCTTGGAACTGGGCTTGGTGCAGGATTTGGAACAGCTC
TTGGTGCTGGACAGGCATCTTTGTTTGGGAACAACCAACCTAAGATTGGAGGGCCTCTTGGTACAGGAGCCTTTGGGGCCCCTGGATTTA
ATACTACGACAGCCACTTTGGGCTTTGGAGCCCCCCAGGCCCCAGTAGCTTTGACAGATCCAAATGCTTCTGCTGCCCAGCAGGCTGTTC
TCCAGCAGCACATCAATAGTCTAACATACTCACCTTTTGGAGACTCTCCTCTCTTCCGGAATCCGATGTCAGACCCTAAGAAGAAGGAAG
AGAGATTGAAACCAACAAATCCAGCAGCCCAGAAGGCTCTTACTACACCTACTCATTATAAACTGACACCCCGCCCTGCCACTAGAGTCC
GGCCAAAGGCTTTACAAACAACAGGCACAGCCAAGTCACATCTCTTTGATGGGCTGGATGACGATGAACCATCCCTAGCCAATGGAGCAT
TCATGCCCAAGAAGAGCATTAAGAAGTTGGTTTTGAAGAACCTTAATAATAGCAATCTCTTTTCTCCTGTTAATCGTGATTCAGAAAATC
TAGCTTCACCATCTGAATATCCAGAAAATGGAGAGAGATTTAGTTTCCTAAGCAAACCTGTTGATGAGAATCACCAGCAGGATGGAGATG
AAGATTCCCTTGTTTCACATTTTTATACTAACCCTATTGCCAAACCTATTCCTCAAACCCCAGAAAGTGCTGGAAATAAACACAGCAACA
GCAACAGTGTGGATGATACCATTGTTGCATTAAACATGCGTGCTGCTTTGCGAAATGGGCTGGAAGGAAGCAGTGAAGAAACGTCTTTTC
ATGATGAGTCACTTCAGGATGACCGAGAAGAAATAGAAAATAATTCTTACCATATGCACCCAGCAGACGTGGTTCCCCTGCAGCCCGAGG
TGAGCAGCTACCGGCGCGGGCGCAAGAAACGCGTGCCCTACACTAAGGTGCAGCTGAAGGAGCTAGAGAAGGAATACGCGGCTAGCAAGT
TCATCACCAAAGAGAAGCGCCGGCGCATCTCCGCCACCACGAACCTCTCTGAGCGCCAGGTAACCATCTGGTTCCAGAACCGGCGGGTCA
AAGAGAAGAAGGTGGTCAGCAAATCGAAAGCGCCTCATCTCCACTCCACCTGACCACCCACCCGCTGCTTGCCCCATCTATTTATGTCTC
CGCTTTGTACCATAACCGAACCCACGGAAAGACGCTGCGCGGGTGCAGAAGAGTATTTAATGTTAAGGAAAGAGAAGAACCGCGCCGCCC
GGAGGCAGAGAGGCTCCATGGCCGTGCTGCTGGGCCATCCCCAACTCCCTATCCCATCCCCAGCCTCCACCCCCATCCAGATGGGACTCA
CGTGGCTTCAACAGCTTTGGAAATGGGTCCCGAGTGGGCCGTGCGAGGAAGGCTGTCGACCTCTACTCCTCCTTGCGCTCACCTTGCCAG
AAAGTCTGGTGGCAGCGCAGAGCCCAATCATTCCAACCAAAGCAGGGTTGGGGAATCCCGAATGGCCCCAATTCTTGCCTCATCCTATGA
CCAGGCTTTTAGAGGACCTTCCCTAAGGGCGCAGCTTCGGAGCAGGATCTGTCCAGCTCATACTTTCCTTCGCTGTCCCTCCCGCACTCC
TTAGGCAAGATTTCCCAGTAAAGATTTTCTGTGCGTATTTTAAAAGTCGTGTTAATACTCATGATAATTATTAGGGACCTGGCAGCGTGA
TTGGAGTATGGATGTTTCCGTAAAAGCTGGAATTCCGTAAAAGCATTGACGCAGCCCCTACACTCCATCCCAACCAAGAAACTGCATTTC
CTGGGGCCAGGTGGGAGCTGCCTTTGCCCCACTGCCTCCCCTGTTCTGCTCTCTCAGTCAACATGTGGAAATCCAAGGAGGACAAAGACT
CCAGCCACGCTGCTAAATAGGGCTCCTCTCTCCTCTCTCTCTCTCTAGGTGGTAAGGTTGGGGATTAGTCCAGGTACAGAAGCAGAACTT
TTTTCTAAGGATAAACATCTCTTCCAAGGGGATGGAGAGTGGGTCCCTCAACAAAGTCCCTGTCCAGTCACCTTTCCATCAGGGCACTAG
CCCAGGAATGACTCCTCACACTTTCACCTTTACTGATTTCCAGAGGAAAGCTAGAGGATCTAGTTCAAGAGGCAAGAAGATCTGGCCCTC
AATTAGCTAGATGTAGATGCTGCCTAACAGTTCCCTCCTCAAAGGCCACCTTGGTGCTGTGGGGGCCCCTTGCCTCTTCCCTTCCCACTG
GTGCATTACAAAACAGTGTTCTTTTGAAATGTTCATCAGGAATAGGCTTTTTTAAAAAATGTTGTGTATCTGTATATAGTATTGTGATGT

>In-frame_NUP98_ENST00000397007_chr11_3744387_-_HOXC13_ENST00000243056_chr12_54338780_+_3918nt
GGCCCTCTGCGCGCTGCGCCCGAAGCGGCGGTCGGTGGCAGGGGTGGTAGCGGCGGCGGCGACGGTTTCGTGGGGGCCGCGCGCTGCTCT
GTGAGCGGCGGGTGGCAGCAGGGGACTCCTGACACTTCCCCTTCCCCACCGAACCGCGCTTTCTGAAACAAAGACTCATTTTGAAGATGT
TTAACAAATCATTTGGAACACCCTTTGGGGGTGGCACAGGTGGCTTTGGCACAACTTCAACATTTGGACAGAATACTGGCTTTGGCACTA
CTAGTGGAGGGGCATTTGGAACATCTGCATTTGGTTCTAGCAACAATACTGGAGGCCTCTTTGGAAATTCACAGACTAAACCAGGAGGAT
TGTTTGGAACCAGTTCATTTAGCCAGCCAGCTACCTCCACAAGCACTGGCTTTGGGTTTGGTACGTCAACAGGAACAGCAAATACCTTGT
TTGGAACTGCAAGCACAGGGACCAGTCTCTTCTCATCCCAAAACAATGCCTTTGCACAAAATAAACCAACTGGCTTTGGCAATTTTGGAA
CCAGTACTAGCAGTGGAGGACTCTTTGGAACCACAAATACCACCTCTAATCCTTTTGGCAGCACATCTGGCTCCCTCTTTGGGCCAAGTA
GTTTTACAGCTGCTCCTACTGGGACTACTATTAAATTTAACCCTCCAACTGGTACAGATACTATGGTCAAAGCTGGAGTTAGCACTAACA
TAAGTACCAAGCACCAGTGTATTACTGCTATGAAAGAATATGAAAGCAAGTCACTAGAGGAACTTCGTTTAGAGGATTATCAGGCTAACA
GGAAGGGCCCACAGAACCAGGTGGGAGCAGGTACCACAACTGGCTTGTTTGGGTCTTCTCCAGCCACTTCCAGCGCAACAGGACTCTTCA
GCTCCTCCACCACTAATTCAGGCTTTGCATATGGTCAGAACAAAACTGCCTTTGGAACTAGTACAACTGGATTTGGAACAAATCCAGGTG
GTCTCTTTGGCCAACAGAATCAGCAGACTACCAGCCTCTTCAGCAAACCATTTGGCCAGGCTACAACCACCCAGAACACTGGCTTTTCCT
TTGGTAATACCAGCACCATAGGACAGCCAAGCACCAACACCATGGGATTATTTGGAGTAACCCAAGCCTCACAGCCTGGAGGTCTTTTTG
GGACAGCTACAAACACCAGCACTGGGACAGCATTTGGAACAGGAACAGGTCTCTTTGGGCAGACCAATACTGGATTTGGTGCTGTTGGTT
CGACCCTGTTTGGCAATAACAAGCTTACTACATTTGGAAGCAGCACAACCAGTGCACCTTCATTTGGTACAACCAGTGGCGGGCTCTTTG
GTAACAAACCAACCCTGACTTTAGGAACCAATACAAACACTTCTAATTTTGGTTTTGGCACAAATACCAGTGGGAATAGTATTTTTGGAA
GTAAACCAGCACCTGGGACTCTTGGAACTGGGCTTGGTGCAGGATTTGGAACAGCTCTTGGTGCTGGACAGGCATCTTTGTTTGGGAACA
ACCAACCTAAGATTGGAGGGCCTCTTGGTACAGGAGCCTTTGGGGCCCCTGGATTTAATACTACGACAGCCACTTTGGGCTTTGGAGCCC
CCCAGGCCCCAGTAGCTTTGACAGATCCAAATGCTTCTGCTGCCCAGCAGGCTGTTCTCCAGCAGCACATCAATAGTCTAACATACTCAC
CTTTTGGAGACTCTCCTCTCTTCCGGAATCCGATGTCAGACCCTAAGAAGAAGGAAGAGAGATTGAAACCAACAAATCCAGCAGCCCAGA
AGGCTCTTACTACACCTACTCATTATAAACTGACACCCCGCCCTGCCACTAGAGTCCGGCCAAAGGCTTTACAAACAACAGGCACAGCCA
AGTCACATCTCTTTGATGGGCTGGATGACGATGAACCATCCCTAGCCAATGGAGCATTCATGCCCAAGAAGAGCATTAAGAAGTTGGTTT
TGAAGAACCTTAATAATAGCAATCTCTTTTCTCCTGTTAATCGTGATTCAGAAAATCTAGCTTCACCATCTGAATATCCAGAAAATGGAG
AGAGATTTAGTTTCCTAAGCAAACCTGTTGATGAGAATCACCAGCAGGATGGAGATGAAGATTCCCTTGTTTCACATTTTTATACTAACC
CTATTGCCAAACCTATTCCTCAAACCCCAGAAAGTGCTGGAAATAAACACAGCAACAGCAACAGTGTGGATGATACCATTGTTGCATTAA
ACATGCGTGCTGCTTTGCGAAATGGGCTGGAAGGAAGCAGTGAAGAAACGTCTTTTCATGATGAGTCACTTCAGGATGACCGAGAAGAAA
TAGAAAATAATTCTTACCATATGCACCCAGCAGACGTGGTTCCCCTGCAGCCCGAGGTGAGCAGCTACCGGCGCGGGCGCAAGAAACGCG
TGCCCTACACTAAGGTGCAGCTGAAGGAGCTAGAGAAGGAATACGCGGCTAGCAAGTTCATCACCAAAGAGAAGCGCCGGCGCATCTCCG
CCACCACGAACCTCTCTGAGCGCCAGGTAACCATCTGGTTCCAGAACCGGCGGGTCAAAGAGAAGAAGGTGGTCAGCAAATCGAAAGCGC
CTCATCTCCACTCCACCTGACCACCCACCCGCTGCTTGCCCCATCTATTTATGTCTCCGCTTTGTACCATAACCGAACCCACGGAAAGAC
GCTGCGCGGGTGCAGAAGAGTATTTAATGTTAAGGAAAGAGAAGAACCGCGCCGCCCGGAGGCAGAGAGGCTCCATGGCCGTGCTGCTGG
GCCATCCCCAACTCCCTATCCCATCCCCAGCCTCCACCCCCATCCAGATGGGACTCACGTGGCTTCAACAGCTTTGGAAATGGGTCCCGA
GTGGGCCGTGCGAGGAAGGCTGTCGACCTCTACTCCTCCTTGCGCTCACCTTGCCAGAAAGTCTGGTGGCAGCGCAGAGCCCAATCATTC
CAACCAAAGCAGGGTTGGGGAATCCCGAATGGCCCCAATTCTTGCCTCATCCTATGACCAGGCTTTTAGAGGACCTTCCCTAAGGGCGCA
GCTTCGGAGCAGGATCTGTCCAGCTCATACTTTCCTTCGCTGTCCCTCCCGCACTCCTTAGGCAAGATTTCCCAGTAAAGATTTTCTGTG
CGTATTTTAAAAGTCGTGTTAATACTCATGATAATTATTAGGGACCTGGCAGCGTGATTGGAGTATGGATGTTTCCGTAAAAGCTGGAAT
TCCGTAAAAGCATTGACGCAGCCCCTACACTCCATCCCAACCAAGAAACTGCATTTCCTGGGGCCAGGTGGGAGCTGCCTTTGCCCCACT
GCCTCCCCTGTTCTGCTCTCTCAGTCAACATGTGGAAATCCAAGGAGGACAAAGACTCCAGCCACGCTGCTAAATAGGGCTCCTCTCTCC
TCTCTCTCTCTCTAGGTGGTAAGGTTGGGGATTAGTCCAGGTACAGAAGCAGAACTTTTTTCTAAGGATAAACATCTCTTCCAAGGGGAT
GGAGAGTGGGTCCCTCAACAAAGTCCCTGTCCAGTCACCTTTCCATCAGGGCACTAGCCCAGGAATGACTCCTCACACTTTCACCTTTAC
TGATTTCCAGAGGAAAGCTAGAGGATCTAGTTCAAGAGGCAAGAAGATCTGGCCCTCAATTAGCTAGATGTAGATGCTGCCTAACAGTTC
CCTCCTCAAAGGCCACCTTGGTGCTGTGGGGGCCCCTTGCCTCTTCCCTTCCCACTGGTGCATTACAAAACAGTGTTCTTTTGAAATGTT
CATCAGGAATAGGCTTTTTTAAAAAATGTTGTGTATCTGTATATAGTATTGTGATGTCTGAATGACAATGTACTGAATGCAAAAAGGAAA


Top

FusionGenePPI for NUP98_HOXC13


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
NUP98MOB1A, PARP11, QRICH2, TPR, NUP88, CREBBP, EP300, NUP133, KPNB1, RAE1, TNPO2, NXF1, TNPO1, USP7, NPM1, PTTG1, APC, HDAC1, SIRT7, NUP107, CTNNB1, RAPGEF3, NUMA1, ECT2, CSNK2A1, HNRNPUL1, LMNA, HDAC8, HDAC11, FBXO6, ARFGEF2, CDC73, PAF1, CDC37, CUL7, OBSL1, EED, MAPK8, COMTD1, SEC13, PNKD, NUP43, CLEC11A, RNF166, UNK, NUP54, NUP85, SEH1L, XPO5, KRAS, IFI16, NUP160, NUP35, B9D2, UBE2I, NUPL1, NUP153, PIM2, NUDT21, NCBP2, CHMP4B, GTF2H5, FOXI2, FOXL1, FOXQ1, FAF1, C11orf30, DUSP13, SPAST, FAM136A, UXS1, CD70, VASN, TRIM25, G3BP1, CDC27, ANAPC4, ANAPC10, MAD2L1, CDC20, FZR1, PIN1HOXC13APEX1, HNRNPAB, HOXC9, NR2E3, RHOXF2, ELF1, RBPJ, FOXC1, FOXC2, FOXE1, FOXG1, FOXI2, FOXJ2, FOXN1, FOXP3, FOXS1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for NUP98_HOXC13


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for NUP98_HOXC13


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneNUP98C0023467Leukemia, Myelocytic, Acute1CTD_human
TgeneHOXC13C1865951Ectodermal Dysplasia, Pure Hair-Nail Type1CTD_human