FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 24772

FusionGeneSummary for NQO1_JAG1

check button Fusion gene summary
Fusion gene informationFusion gene name: NQO1_JAG1
Fusion gene ID: 24772
HgeneTgene
Gene symbol

NQO1

JAG1

Gene ID

1728

182

Gene nameNAD(P)H quinone dehydrogenase 1jagged 1
SynonymsDHQU|DIA4|DTD|NMOR1|NMORI|QR1AGS|AGS1|AHD|AWS|CD339|HJ1|JAGL1
Cytomap

16q22.1

20p12.2

Type of geneprotein-codingprotein-coding
DescriptionNAD(P)H dehydrogenase [quinone] 1DT-diaphoraseNAD(P)H dehydrogenase, quinone 1NAD(P)H:Quinone acceptor oxidoreductase type 1NAD(P)H:menadione oxidoreductase 1NAD(P)H:quinone oxidoreductase 1NAD(P)H:quinone oxireductaseazoreductasediaphorase (NADH/protein jagged-1
Modification date2018052320180522
UniProtAcc

P15559

P78504

Ensembl transtripts involved in fusion geneENST00000561500, ENST00000379047, 
ENST00000320623, ENST00000379046, 
ENST00000439109, ENST00000564043, 
ENST00000254958, ENST00000423891, 
ENST00000488480, 
Fusion gene scores* DoF score6 X 5 X 3=903 X 3 X 2=18
# samples 73
** MAII scorelog2(7/90*10)=-0.362570079384708
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(3/18*10)=0.736965594166206
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: NQO1 [Title/Abstract] AND JAG1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneJAG1

GO:0001953

negative regulation of cell-matrix adhesion

11549580

TgeneJAG1

GO:0022408

negative regulation of cell-cell adhesion

11549580

TgeneJAG1

GO:0030336

negative regulation of cell migration

11549580


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDLUADTCGA-55-6987-01ANQO1chr16

69760336

-JAG1chr20

10621892

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000561500ENST00000254958NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000561500ENST00000423891NQO1chr16

69760336

-JAG1chr20

10621892

-
5CDS-intronENST00000561500ENST00000488480NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000379047ENST00000254958NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000379047ENST00000423891NQO1chr16

69760336

-JAG1chr20

10621892

-
5CDS-intronENST00000379047ENST00000488480NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000320623ENST00000254958NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000320623ENST00000423891NQO1chr16

69760336

-JAG1chr20

10621892

-
5CDS-intronENST00000320623ENST00000488480NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000379046ENST00000254958NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000379046ENST00000423891NQO1chr16

69760336

-JAG1chr20

10621892

-
5CDS-intronENST00000379046ENST00000488480NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000439109ENST00000254958NQO1chr16

69760336

-JAG1chr20

10621892

-
In-frameENST00000439109ENST00000423891NQO1chr16

69760336

-JAG1chr20

10621892

-
5CDS-intronENST00000439109ENST00000488480NQO1chr16

69760336

-JAG1chr20

10621892

-
intron-3CDSENST00000564043ENST00000254958NQO1chr16

69760336

-JAG1chr20

10621892

-
intron-3CDSENST00000564043ENST00000423891NQO1chr16

69760336

-JAG1chr20

10621892

-
intron-intronENST00000564043ENST00000488480NQO1chr16

69760336

-JAG1chr20

10621892

-

Top

FusionProtFeatures for NQO1_JAG1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
NQO1

P15559

JAG1

P78504

The enzyme apparently serves as a quinone reductase inconnection with conjugation reactions of hydroquinons involved indetoxification pathways as well as in biosynthetic processes suchas the vitamin K-dependent gamma-carboxylation of glutamateresidues in prothrombin synthesis. Ligand for multiple Notch receptors and involved in themediation of Notch signaling. May be involved in cell-fatedecisions during hematopoiesis. Seems to be involved in early andlate stages of mammalian cardiovascular development. Inhibitsmyoblast differentiation (By similarity). Enhances fibroblastgrowth factor-induced angiogenesis (in vitro). {ECO:0000250,ECO:0000269|PubMed:18660822, ECO:0000269|PubMed:9462510}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-22261094_12189721219Topological domainCytoplasmic
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-22261068_10939721219TransmembraneHelical

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneNQO1chr16:69760336chr20:10621892ENST00000320623-16104_1072275Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000320623-16148_1512275Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000320623-1618_192275Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000379046-15104_1072237Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000379046-15148_1512237Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000379046-1518_192237Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000379047-15104_1072241Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000379047-15148_1512241Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000379047-1518_192241Nucleotide bindingFAD
HgeneNQO1chr16:69760336chr20:10621892ENST00000320623-16126_1282275RegionNote=Substrate binding
HgeneNQO1chr16:69760336chr20:10621892ENST00000379046-15126_1282237RegionNote=Substrate binding
HgeneNQO1chr16:69760336chr20:10621892ENST00000379047-15126_1282241RegionNote=Substrate binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226185_2299721219DomainDSL
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226230_2639721219DomainEGF-like 1
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226264_2949721219DomainEGF-like 2%3B atypical
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226296_3349721219DomainEGF-like 3
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226336_3729721219DomainEGF-like 4
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226374_4109721219DomainEGF-like 5%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226412_4489721219DomainEGF-like 6%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226450_4859721219DomainEGF-like 7%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226487_5239721219DomainEGF-like 8%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226525_5619721219DomainEGF-like 9
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226586_6279721219DomainEGF-like 10
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226629_6659721219DomainEGF-like 11%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226667_7039721219DomainEGF-like 12%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226705_7419721219DomainEGF-like 13
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226744_7809721219DomainEGF-like 14
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226782_8189721219DomainEGF-like 15%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-2226820_8569721219DomainEGF-like 16%3B calcium-binding
TgeneJAG1chr16:69760336chr20:10621892ENST00000254958-222634_10679721219Topological domainExtracellular


Top

FusionGeneSequence for NQO1_JAG1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_NQO1_ENST00000561500_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000561500_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000379047_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000379047_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000320623_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000320623_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000379046_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000379046_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000439109_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK

>In-frame_NQO1_ENST00000439109_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_249aa
MVGSYYGAHLQ_IEEFETFEECFR_IFNLHRLRAFPFSEQ_NTCGHFC_RTTG_WEPDQGNH_QNNRSC__T_WKQLADCCRCRSKSSEA
ASEEQNRFPCSLAELCLNCGLDLLLGDGLLLVPAEAAEAGQPHTLSL_GQHHQQRAGAAEPDQKPH_ETWGQHGPHQGL_EQELQNV_NK


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_NQO1_ENST00000561500_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000561500_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000379047_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000379047_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000320623_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000320623_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000379046_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000379046_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000439109_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG

>In-frame_NQO1_ENST00000439109_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_748nt
ATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACAT
CGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGA
AATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCG
GCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTA
CTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAA
CCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAG
GACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGA
CAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAG


* Fusion transcript sequences (Full-length transcript).
>In-frame_NQO1_ENST00000561500_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_2629nt
GTTCCGGCCAGGGTCGCCCCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGC
ACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAG
CGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATC
TTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATT
TCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGA
AGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGA
AACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAG
AGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACG
GCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCG
TATAGCAGACCGCGGGCACTGCCGCCGCTAGGTAGAGTCTGAGGGCTTGTAGTTCTTTAAACTGTCGTGTCATACTCGAGTCTGAGGCCG
TTGCTGACTTAGAATCCCTGTGTTAATTTAAGTTTTGACAAGCTGGCTTACACTGGCAATGGTAGTTTCTGTGGTTGGCTGGGAAATCGA
GTGCCGCATCTCACAGCTATGCAAAAAGCTAGTCAACAGTACCCTGGTTGTGTGTCCCCTTGCAGCCGACACGGTCTCGGATCAGGCTCC
CAGGAGCCTGCCCAGCCCCCTGGTCTTTGAGCTCCCACTTCTGCCAGATGTCCTAATGGTGATGCAGTCTTAGATCATAGTTTTATTTAT
ATTTATTGACTCTTGAGTTGTTTTTGTATATTGGTTTTATGATGACGTACAAGTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCAGAAC
CACAGCAACGATCACAAATGACTTTATTATTTATTTTTTTTAATTGTATTTTTGTTGTTGGGGGAGGGGAGACTTTGATGTCAGCAGTTG
CTGGTAAAATGAAGAATTTAAAGAAAAAAATGTCAAAAGTAGAACTTTGTATAGTTATGTAAATAATTCTTTTTTATTAATCACTGTGTA
TATTTGATTTATTAACTTAATAATCAAGAGCCTTAAAACATCATTCCTTTTTATTTATATGTATGTGTTTAGAATTGAAGGTTTTTGATA
GCATTGTAAGCGTATGGCTTTATTTTTTTGAACTCTTCTCATTACTTGTTGCCTATAAGCCAAAATTAAGGTGTTTGAAAATAGTTTATT
TTAAAACAATAGGATGGGCTTCTGTGCCCAGAATACTGATGGAATTTTTTTGTACGACGTCAGATGTTTAAAACACCTTCTATAGCATCA
CTTAAAACACGTTTTAAGGACTGACTGAGGCAGTTTGAGGATTAGTTTAGAACAGGTTTTTTTGTTTGTTTGTTTTTTGTTTTTCTGCTT
TAGACTTGAAAAGAGACAGGCAGGTGATCTGCTGCAGAGCAGTAAGGGAACAAGTTGAGCTATGACTTAACATAGCCAAAATGTGAGTGG
TTGAATATGATTAAAAATATCAAATTAATTGTGTGAACTTGGAAGCACACCAATCTTACTTTGTAAATTCTGATTTCTTTTCACCATTCG
TACATAATACTGAACCACTTGTAGATTTGATTTTTTTTTTTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGAATACTTGAA
CCATAAAATGTCCAGTAAGATCACTGTTTAGATTTGCCATAGAGTACACTGCCTGCCTTAAGTGAGGAAATCAAAGTGCTATTACGAAGT
TCAAGATCAAAAAGGCTTATAAAACAGAGTAATCTTGTTGGTTCACCATTGAGACCGTGAAGATACTTTGTATTGTCCTATTAGTGTTAT
ATGAACATACAAATGCATCTTTGATGTGTTGTTCTTGGCAATAAATTTTGAAAAGTAATATTTATTAAATTTTTTTGTATGAAAACATGG
AACAGTGTGGCCTCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTTCTGGTAATCGGGGT
ATAATAGGCTCTGCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCTCAAAGACCTGGGGC
TGCTGTGAAGCTGGAACTGCGGGAGCCCCATCTAGGGGAGCCTTGATTCCCTTGTTATTCAACAGCAAGTGTGAATACTGCTTGAATAAA

>In-frame_NQO1_ENST00000561500_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_1050nt
GTTCCGGCCAGGGTCGCCCCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGC
ACATTTGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAG
CGAACAATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATC
TTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATT
TCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGA
AGCCGGGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGA
AACATGGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAG
AGGACGACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACG
GCACGCCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCG
TATAGCAGACCGCGGGCACTGCCGCCGCTAGTGTGGCCTCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCT
GCTGAGTCTGTTCTGGTAATCGGGGTATAATAGGCTCTGCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTC

>In-frame_NQO1_ENST00000379047_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_2791nt
ATCCTCCGCCCAGCACCCCAGGATTCAGGCGTTGGGTCCCGCCCTTGTAGGCTGTCCACCTCAAACGGGCCGGACAGGATATATAAGAGA
GAATGCACCGTGCACTACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGGCCAGGGTCGCC
CCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGA
GGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATG
TGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATG
GAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGA
GCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACAC
ACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGG
TCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAAC
ACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACC
CAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAGCAGACCGCGGGCA
CTGCCGCCGCTAGGTAGAGTCTGAGGGCTTGTAGTTCTTTAAACTGTCGTGTCATACTCGAGTCTGAGGCCGTTGCTGACTTAGAATCCC
TGTGTTAATTTAAGTTTTGACAAGCTGGCTTACACTGGCAATGGTAGTTTCTGTGGTTGGCTGGGAAATCGAGTGCCGCATCTCACAGCT
ATGCAAAAAGCTAGTCAACAGTACCCTGGTTGTGTGTCCCCTTGCAGCCGACACGGTCTCGGATCAGGCTCCCAGGAGCCTGCCCAGCCC
CCTGGTCTTTGAGCTCCCACTTCTGCCAGATGTCCTAATGGTGATGCAGTCTTAGATCATAGTTTTATTTATATTTATTGACTCTTGAGT
TGTTTTTGTATATTGGTTTTATGATGACGTACAAGTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCAGAACCACAGCAACGATCACAAA
TGACTTTATTATTTATTTTTTTTAATTGTATTTTTGTTGTTGGGGGAGGGGAGACTTTGATGTCAGCAGTTGCTGGTAAAATGAAGAATT
TAAAGAAAAAAATGTCAAAAGTAGAACTTTGTATAGTTATGTAAATAATTCTTTTTTATTAATCACTGTGTATATTTGATTTATTAACTT
AATAATCAAGAGCCTTAAAACATCATTCCTTTTTATTTATATGTATGTGTTTAGAATTGAAGGTTTTTGATAGCATTGTAAGCGTATGGC
TTTATTTTTTTGAACTCTTCTCATTACTTGTTGCCTATAAGCCAAAATTAAGGTGTTTGAAAATAGTTTATTTTAAAACAATAGGATGGG
CTTCTGTGCCCAGAATACTGATGGAATTTTTTTGTACGACGTCAGATGTTTAAAACACCTTCTATAGCATCACTTAAAACACGTTTTAAG
GACTGACTGAGGCAGTTTGAGGATTAGTTTAGAACAGGTTTTTTTGTTTGTTTGTTTTTTGTTTTTCTGCTTTAGACTTGAAAAGAGACA
GGCAGGTGATCTGCTGCAGAGCAGTAAGGGAACAAGTTGAGCTATGACTTAACATAGCCAAAATGTGAGTGGTTGAATATGATTAAAAAT
ATCAAATTAATTGTGTGAACTTGGAAGCACACCAATCTTACTTTGTAAATTCTGATTTCTTTTCACCATTCGTACATAATACTGAACCAC
TTGTAGATTTGATTTTTTTTTTTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGAATACTTGAACCATAAAATGTCCAGTAA
GATCACTGTTTAGATTTGCCATAGAGTACACTGCCTGCCTTAAGTGAGGAAATCAAAGTGCTATTACGAAGTTCAAGATCAAAAAGGCTT
ATAAAACAGAGTAATCTTGTTGGTTCACCATTGAGACCGTGAAGATACTTTGTATTGTCCTATTAGTGTTATATGAACATACAAATGCAT
CTTTGATGTGTTGTTCTTGGCAATAAATTTTGAAAAGTAATATTTATTAAATTTTTTTGTATGAAAACATGGAACAGTGTGGCCTCTTCT
GAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTTCTGGTAATCGGGGTATAATAGGCTCTGCCTGA
CAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCTCAAAGACCTGGGGCTGCTGTGAAGCTGGAACT
GCGGGAGCCCCATCTAGGGGAGCCTTGATTCCCTTGTTATTCAACAGCAAGTGTGAATACTGCTTGAATAAACACCACTGGATTAATGGC

>In-frame_NQO1_ENST00000379047_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_1212nt
ATCCTCCGCCCAGCACCCCAGGATTCAGGCGTTGGGTCCCGCCCTTGTAGGCTGTCCACCTCAAACGGGCCGGACAGGATATATAAGAGA
GAATGCACCGTGCACTACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGGCCAGGGTCGCC
CCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGA
GGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATG
TGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATG
GAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGA
GCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACAC
ACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGG
TCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAAC
ACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACC
CAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAGCAGACCGCGGGCA
CTGCCGCCGCTAGTGTGGCCTCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTTCTGGTA
ATCGGGGTATAATAGGCTCTGCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCTCAAAGA

>In-frame_NQO1_ENST00000320623_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_3074nt
TTTCGTGCCAAGGCTAAAAGGGCATGCCCACTTGATCCCTGGACTCTCTTGGGACGACTTCCACCCTGCATCCTCTTGCACCTCAGGGCA
CAGTGCGCAGATGGGCTTGCCTTAGCACCCCCAGCCAGATTTTTGAGGCCTCTGTCACACACACCCCTACAATCCCCTCCCCCAGCCCCG
AGAGACTTTTCTTGACTTCCACCAGTTGCTCCGGCGGGTGAGAGTGGAGAGGCCCCTCCTTCATCCCCCAGGCTCCCTCCCTTCCTGGAG
CTGCAGCCTCAGCATCCTCCGCCCAGCACCCCAGGATTCAGGCGTTGGGTCCCGCCCTTGTAGGCTGTCCACCTCAAACGGGCCGGACAG
GATATATAAGAGAGAATGCACCGTGCACTACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCC
GGCCAGGGTCGCCCCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATT
TGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAAC
AATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTT
AGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTT
GTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCG
GGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACAT
GGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGAC
GACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACG
CCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAG
CAGACCGCGGGCACTGCCGCCGCTAGGTAGAGTCTGAGGGCTTGTAGTTCTTTAAACTGTCGTGTCATACTCGAGTCTGAGGCCGTTGCT
GACTTAGAATCCCTGTGTTAATTTAAGTTTTGACAAGCTGGCTTACACTGGCAATGGTAGTTTCTGTGGTTGGCTGGGAAATCGAGTGCC
GCATCTCACAGCTATGCAAAAAGCTAGTCAACAGTACCCTGGTTGTGTGTCCCCTTGCAGCCGACACGGTCTCGGATCAGGCTCCCAGGA
GCCTGCCCAGCCCCCTGGTCTTTGAGCTCCCACTTCTGCCAGATGTCCTAATGGTGATGCAGTCTTAGATCATAGTTTTATTTATATTTA
TTGACTCTTGAGTTGTTTTTGTATATTGGTTTTATGATGACGTACAAGTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCAGAACCACAG
CAACGATCACAAATGACTTTATTATTTATTTTTTTTAATTGTATTTTTGTTGTTGGGGGAGGGGAGACTTTGATGTCAGCAGTTGCTGGT
AAAATGAAGAATTTAAAGAAAAAAATGTCAAAAGTAGAACTTTGTATAGTTATGTAAATAATTCTTTTTTATTAATCACTGTGTATATTT
GATTTATTAACTTAATAATCAAGAGCCTTAAAACATCATTCCTTTTTATTTATATGTATGTGTTTAGAATTGAAGGTTTTTGATAGCATT
GTAAGCGTATGGCTTTATTTTTTTGAACTCTTCTCATTACTTGTTGCCTATAAGCCAAAATTAAGGTGTTTGAAAATAGTTTATTTTAAA
ACAATAGGATGGGCTTCTGTGCCCAGAATACTGATGGAATTTTTTTGTACGACGTCAGATGTTTAAAACACCTTCTATAGCATCACTTAA
AACACGTTTTAAGGACTGACTGAGGCAGTTTGAGGATTAGTTTAGAACAGGTTTTTTTGTTTGTTTGTTTTTTGTTTTTCTGCTTTAGAC
TTGAAAAGAGACAGGCAGGTGATCTGCTGCAGAGCAGTAAGGGAACAAGTTGAGCTATGACTTAACATAGCCAAAATGTGAGTGGTTGAA
TATGATTAAAAATATCAAATTAATTGTGTGAACTTGGAAGCACACCAATCTTACTTTGTAAATTCTGATTTCTTTTCACCATTCGTACAT
AATACTGAACCACTTGTAGATTTGATTTTTTTTTTTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGAATACTTGAACCATA
AAATGTCCAGTAAGATCACTGTTTAGATTTGCCATAGAGTACACTGCCTGCCTTAAGTGAGGAAATCAAAGTGCTATTACGAAGTTCAAG
ATCAAAAAGGCTTATAAAACAGAGTAATCTTGTTGGTTCACCATTGAGACCGTGAAGATACTTTGTATTGTCCTATTAGTGTTATATGAA
CATACAAATGCATCTTTGATGTGTTGTTCTTGGCAATAAATTTTGAAAAGTAATATTTATTAAATTTTTTTGTATGAAAACATGGAACAG
TGTGGCCTCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTTCTGGTAATCGGGGTATAAT
AGGCTCTGCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCTCAAAGACCTGGGGCTGCTG
TGAAGCTGGAACTGCGGGAGCCCCATCTAGGGGAGCCTTGATTCCCTTGTTATTCAACAGCAAGTGTGAATACTGCTTGAATAAACACCA

>In-frame_NQO1_ENST00000320623_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_1495nt
TTTCGTGCCAAGGCTAAAAGGGCATGCCCACTTGATCCCTGGACTCTCTTGGGACGACTTCCACCCTGCATCCTCTTGCACCTCAGGGCA
CAGTGCGCAGATGGGCTTGCCTTAGCACCCCCAGCCAGATTTTTGAGGCCTCTGTCACACACACCCCTACAATCCCCTCCCCCAGCCCCG
AGAGACTTTTCTTGACTTCCACCAGTTGCTCCGGCGGGTGAGAGTGGAGAGGCCCCTCCTTCATCCCCCAGGCTCCCTCCCTTCCTGGAG
CTGCAGCCTCAGCATCCTCCGCCCAGCACCCCAGGATTCAGGCGTTGGGTCCCGCCCTTGTAGGCTGTCCACCTCAAACGGGCCGGACAG
GATATATAAGAGAGAATGCACCGTGCACTACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCC
GGCCAGGGTCGCCCCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATT
TGCAGTGAATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAAC
AATGAAATACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTT
AGTAAACGTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTT
GTTCCCTTGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCG
GGCAGCCACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACAT
GGGGCCAACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGAC
GACATGGACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACG
CCGACAAAACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAG
CAGACCGCGGGCACTGCCGCCGCTAGTGTGGCCTCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGA
GTCTGTTCTGGTAATCGGGGTATAATAGGCTCTGCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTG

>In-frame_NQO1_ENST00000379046_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_2707nt
AAGAGAGAATGCACCGTGCACTACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGGCCAGG
GTCGCCCCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATTTGCAGTG
AATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAA
TACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTTAGTAAAC
GTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCT
TGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCC
ACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACATGGGGCCA
ACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGACGACATGG
ACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAA
AACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAGCAGACCG
CGGGCACTGCCGCCGCTAGGTAGAGTCTGAGGGCTTGTAGTTCTTTAAACTGTCGTGTCATACTCGAGTCTGAGGCCGTTGCTGACTTAG
AATCCCTGTGTTAATTTAAGTTTTGACAAGCTGGCTTACACTGGCAATGGTAGTTTCTGTGGTTGGCTGGGAAATCGAGTGCCGCATCTC
ACAGCTATGCAAAAAGCTAGTCAACAGTACCCTGGTTGTGTGTCCCCTTGCAGCCGACACGGTCTCGGATCAGGCTCCCAGGAGCCTGCC
CAGCCCCCTGGTCTTTGAGCTCCCACTTCTGCCAGATGTCCTAATGGTGATGCAGTCTTAGATCATAGTTTTATTTATATTTATTGACTC
TTGAGTTGTTTTTGTATATTGGTTTTATGATGACGTACAAGTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCAGAACCACAGCAACGAT
CACAAATGACTTTATTATTTATTTTTTTTAATTGTATTTTTGTTGTTGGGGGAGGGGAGACTTTGATGTCAGCAGTTGCTGGTAAAATGA
AGAATTTAAAGAAAAAAATGTCAAAAGTAGAACTTTGTATAGTTATGTAAATAATTCTTTTTTATTAATCACTGTGTATATTTGATTTAT
TAACTTAATAATCAAGAGCCTTAAAACATCATTCCTTTTTATTTATATGTATGTGTTTAGAATTGAAGGTTTTTGATAGCATTGTAAGCG
TATGGCTTTATTTTTTTGAACTCTTCTCATTACTTGTTGCCTATAAGCCAAAATTAAGGTGTTTGAAAATAGTTTATTTTAAAACAATAG
GATGGGCTTCTGTGCCCAGAATACTGATGGAATTTTTTTGTACGACGTCAGATGTTTAAAACACCTTCTATAGCATCACTTAAAACACGT
TTTAAGGACTGACTGAGGCAGTTTGAGGATTAGTTTAGAACAGGTTTTTTTGTTTGTTTGTTTTTTGTTTTTCTGCTTTAGACTTGAAAA
GAGACAGGCAGGTGATCTGCTGCAGAGCAGTAAGGGAACAAGTTGAGCTATGACTTAACATAGCCAAAATGTGAGTGGTTGAATATGATT
AAAAATATCAAATTAATTGTGTGAACTTGGAAGCACACCAATCTTACTTTGTAAATTCTGATTTCTTTTCACCATTCGTACATAATACTG
AACCACTTGTAGATTTGATTTTTTTTTTTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGAATACTTGAACCATAAAATGTC
CAGTAAGATCACTGTTTAGATTTGCCATAGAGTACACTGCCTGCCTTAAGTGAGGAAATCAAAGTGCTATTACGAAGTTCAAGATCAAAA
AGGCTTATAAAACAGAGTAATCTTGTTGGTTCACCATTGAGACCGTGAAGATACTTTGTATTGTCCTATTAGTGTTATATGAACATACAA
ATGCATCTTTGATGTGTTGTTCTTGGCAATAAATTTTGAAAAGTAATATTTATTAAATTTTTTTGTATGAAAACATGGAACAGTGTGGCC
TCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTTCTGGTAATCGGGGTATAATAGGCTCT
GCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCTCAAAGACCTGGGGCTGCTGTGAAGCT
GGAACTGCGGGAGCCCCATCTAGGGGAGCCTTGATTCCCTTGTTATTCAACAGCAAGTGTGAATACTGCTTGAATAAACACCACTGGATT

>In-frame_NQO1_ENST00000379046_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_1128nt
AAGAGAGAATGCACCGTGCACTACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGGCCAGG
GTCGCCCCGGCAACCACGAGCCCAGCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATTTGCAGTG
AATTGAGGAATTTGAATATTTTGAAGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAA
TACATGTGGCCATTTCTGCTGAAGATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTTAGTAAAC
GTGATGGAAACAGCTCGCTGATTGCTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCT
TGCTGAGCTCTGTCTTAACTGTGGCTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCC
ACACACACTCAGCCTCTGAGGACAACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACATGGGGCCA
ACACGGTCCCCATCAAGGATTATGAGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGACGACATGG
ACAAACACCAGCAGAAAGCCCGGTTTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAA
AACACCCAAACTGGACAAACAAACAGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAGCAGACCG
CGGGCACTGCCGCCGCTAGTGTGGCCTCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTT
CTGGTAATCGGGGTATAATAGGCTCTGCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCT

>In-frame_NQO1_ENST00000439109_chr16_69760336_-_JAG1_ENST00000254958_chr20_10621892_-_2683nt
ACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGGCCAGGGTCGCCCCGGCAACCACGAGCCCA
GCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGA
AGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAG
ATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTG
CTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGG
CTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACA
ACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATG
AGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGT
TTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAAC
AGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAGCAGACCGCGGGCACTGCCGCCGCTAGGTAGA
GTCTGAGGGCTTGTAGTTCTTTAAACTGTCGTGTCATACTCGAGTCTGAGGCCGTTGCTGACTTAGAATCCCTGTGTTAATTTAAGTTTT
GACAAGCTGGCTTACACTGGCAATGGTAGTTTCTGTGGTTGGCTGGGAAATCGAGTGCCGCATCTCACAGCTATGCAAAAAGCTAGTCAA
CAGTACCCTGGTTGTGTGTCCCCTTGCAGCCGACACGGTCTCGGATCAGGCTCCCAGGAGCCTGCCCAGCCCCCTGGTCTTTGAGCTCCC
ACTTCTGCCAGATGTCCTAATGGTGATGCAGTCTTAGATCATAGTTTTATTTATATTTATTGACTCTTGAGTTGTTTTTGTATATTGGTT
TTATGATGACGTACAAGTAGTTCTGTATTTGAAAGTGCCTTTGCAGCTCAGAACCACAGCAACGATCACAAATGACTTTATTATTTATTT
TTTTTAATTGTATTTTTGTTGTTGGGGGAGGGGAGACTTTGATGTCAGCAGTTGCTGGTAAAATGAAGAATTTAAAGAAAAAAATGTCAA
AAGTAGAACTTTGTATAGTTATGTAAATAATTCTTTTTTATTAATCACTGTGTATATTTGATTTATTAACTTAATAATCAAGAGCCTTAA
AACATCATTCCTTTTTATTTATATGTATGTGTTTAGAATTGAAGGTTTTTGATAGCATTGTAAGCGTATGGCTTTATTTTTTTGAACTCT
TCTCATTACTTGTTGCCTATAAGCCAAAATTAAGGTGTTTGAAAATAGTTTATTTTAAAACAATAGGATGGGCTTCTGTGCCCAGAATAC
TGATGGAATTTTTTTGTACGACGTCAGATGTTTAAAACACCTTCTATAGCATCACTTAAAACACGTTTTAAGGACTGACTGAGGCAGTTT
GAGGATTAGTTTAGAACAGGTTTTTTTGTTTGTTTGTTTTTTGTTTTTCTGCTTTAGACTTGAAAAGAGACAGGCAGGTGATCTGCTGCA
GAGCAGTAAGGGAACAAGTTGAGCTATGACTTAACATAGCCAAAATGTGAGTGGTTGAATATGATTAAAAATATCAAATTAATTGTGTGA
ACTTGGAAGCACACCAATCTTACTTTGTAAATTCTGATTTCTTTTCACCATTCGTACATAATACTGAACCACTTGTAGATTTGATTTTTT
TTTTTAATCTACTGCATTTAGGGAGTATTCTAATAAGCTAGTTGAATACTTGAACCATAAAATGTCCAGTAAGATCACTGTTTAGATTTG
CCATAGAGTACACTGCCTGCCTTAAGTGAGGAAATCAAAGTGCTATTACGAAGTTCAAGATCAAAAAGGCTTATAAAACAGAGTAATCTT
GTTGGTTCACCATTGAGACCGTGAAGATACTTTGTATTGTCCTATTAGTGTTATATGAACATACAAATGCATCTTTGATGTGTTGTTCTT
GGCAATAAATTTTGAAAAGTAATATTTATTAAATTTTTTTGTATGAAAACATGGAACAGTGTGGCCTCTTCTGAGCTTACGTAGTTCTAC
CGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTTCTGGTAATCGGGGTATAATAGGCTCTGCCTGACAGAGGGATGGAGGAAGA
ACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCTCAAAGACCTGGGGCTGCTGTGAAGCTGGAACTGCGGGAGCCCCATCTAGG

>In-frame_NQO1_ENST00000439109_chr16_69760336_-_JAG1_ENST00000423891_chr20_10621892_-_1104nt
ACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGGCCAGGGTCGCCCCGGCAACCACGAGCCCA
GCCAATCAGCGCCCCGGACTGCACCAGAGCCATGGTCGGGTCTTACTACGGAGCACATTTGCAGTGAATTGAGGAATTTGAATATTTTGA
AGAATGTTTCCGCTGAATATTCAATCTACATCGCTTGCGAGCCTTCCCCTTCAGCGAACAATGAAATACATGTGGCCATTTCTGCTGAAG
ATATACGGGATGATGGGAACCCGATCAAGGAAATCACTGACAAAATAATCGATCTTGTTAGTAAACGTGATGGAAACAGCTCGCTGATTG
CTGCCGTTGCAGAAGTAAGAGTTCAGAGGCGGCCTCTGAAGAACAGAACAGATTTCCTTGTTCCCTTGCTGAGCTCTGTCTTAACTGTGG
CTTGGATCTGTTGCTTGGTGACGGCCTTCTACTGGTGCCTGCGGAAGCGGCGGAAGCCGGGCAGCCACACACACTCAGCCTCTGAGGACA
ACACCACCAACAACGTGCGGGAGCAGCTGAACCAGATCAAAAACCCCATTGAGAAACATGGGGCCAACACGGTCCCCATCAAGGATTATG
AGAACAAGAACTCCAAAATGTCTAAAATAAGGACACACAATTCTGAAGTAGAAGAGGACGACATGGACAAACACCAGCAGAAAGCCCGGT
TTGCCAAGCAGCCGGCGTACACGCTGGTAGACAGAGAAGAGAAGCCCCCCAACGGCACGCCGACAAAACACCCAAACTGGACAAACAAAC
AGGACAACAGAGACTTGGAAAGTGCCCAGAGCTTAAACCGAATGGAGTACATCGTATAGCAGACCGCGGGCACTGCCGCCGCTAGTGTGG
CCTCTTCTGAGCTTACGTAGTTCTACCGGCTTTGCCATGTGCTTCTGCCACCCTGCTGAGTCTGTTCTGGTAATCGGGGTATAATAGGCT
CTGCCTGACAGAGGGATGGAGGAAGAACTGAAAGGCTTTTCAACCACAAAACTCATCTGGAGTTCTCAAAGACCTGGGGCTGCTGTGAAG


Top

FusionGenePPI for NQO1_JAG1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
NQO1HSPA4, NQO1, ING1, STUB1, TP53, RPS10P5, LAMB1, POLDIP3, YTHDF1, RPS19, FN1, ITGA4, BAG3, PARP1, NFE2L2, FOS, MOV10, NXF1, NME1, ADK, DAZAP1, FUBP3, GOT1, NDUFS7, TRIM25, UBE2D1JAG1NOTCH2, NOTCH1, NOTCH3, MLLT4, MIB1, HGS, NEURL1, FBXW7, APBB1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for NQO1_JAG1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status
HgeneNQO1P15559DB00266DicoumarolNAD(P)H dehydrogenase [quinone] 1small moleculeapproved
HgeneNQO1P15559DB00170MenadioneNAD(P)H dehydrogenase [quinone] 1small moleculeapproved|nutraceutical

Top

RelatedDiseases for NQO1_JAG1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneNQO1C0028797Occupational Diseases4CTD_human
HgeneNQO1C0036341Schizophrenia3PSYGENET
HgeneNQO1C0007131Non-Small Cell Lung Carcinoma2CTD_human
HgeneNQO1C0023895Liver diseases2CTD_human
HgeneNQO1C0027659Neoplasms, Experimental2CTD_human
HgeneNQO1C0001973Alcoholic Intoxication, Chronic1PSYGENET
HgeneNQO1C0004096Asthma1CTD_human
HgeneNQO1C0005695Bladder Neoplasm1CTD_human
HgeneNQO1C0008370Cholestasis1CTD_human
HgeneNQO1C0009404Colorectal Neoplasms1CTD_human
HgeneNQO1C0011616Contact Dermatitis1CTD_human
HgeneNQO1C0011853Diabetes Mellitus, Experimental1CTD_human
HgeneNQO1C0019061Hemolytic-Uremic Syndrome1CTD_human
HgeneNQO1C0019080Hemorrhage1CTD_human
HgeneNQO1C0020456Hyperglycemia1CTD_human
HgeneNQO1C0022658Kidney Diseases1CTD_human
HgeneNQO1C0023470Myeloid Leukemia1CTD_human
HgeneNQO1C0026764Multiple Myeloma1CTD_human
HgeneNQO1C0028754Obesity1CTD_human
HgeneNQO1C0030354Papilloma1CTD_human
HgeneNQO1C0030567Parkinson Disease1CTD_human
HgeneNQO1C0033578Prostatic Neoplasms1CTD_human
HgeneNQO1C0235032Neurotoxicity Syndromes1CTD_human
HgeneNQO1C0236663Alcohol withdrawal syndrome1PSYGENET
HgeneNQO1C0525045Mood Disorders1PSYGENET
HgeneNQO1C0853193Bipolar I disorder1PSYGENET
HgeneNQO1C1458155Mammary Neoplasms1CTD_human
HgeneNQO1C1846707SPINOCEREBELLAR ATAXIA 171CTD_human
HgeneNQO1C1961102Precursor Cell Lymphoblastic Leukemia Lymphoma1CTD_human
HgeneNQO1C2609414Acute kidney injury1CTD_human
TgeneJAG1C1956125Alagille Syndrome 113ORPHANET;UNIPROT
TgeneJAG1C0015393Eye Abnormalities3CTD_human
TgeneJAG1C0085280Alagille Syndrome3CTD_human
TgeneJAG1C0039685Tetralogy of Fallot2CTD_human;HPO;ORPHANET;UNIPROT
TgeneJAG1C0282631Facies2CTD_human
TgeneJAG1C0005940Bone Diseases1CTD_human
TgeneJAG1C0010038Corneal Opacity1CTD_human
TgeneJAG1C0010606Adenoid Cystic Carcinoma1CTD_human
TgeneJAG1C0011053Deafness1CTD_human
TgeneJAG1C0017636Glioblastoma1CTD_human
TgeneJAG1C0018798Congenital Heart Defects1CTD_human
TgeneJAG1C0024121Lung Neoplasms1CTD_human
TgeneJAG1C0036095Salivary Gland Neoplasms1CTD_human
TgeneJAG1C0036341Schizophrenia1PSYGENET
TgeneJAG1C0887833Carcinoma, Pancreatic Ductal1CTD_human
TgeneJAG1C1458155Mammary Neoplasms1CTD_human