FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 24659

FusionGeneSummary for NOX4_SMCO4

check button Fusion gene summary
Fusion gene informationFusion gene name: NOX4_SMCO4
Fusion gene ID: 24659
HgeneTgene
Gene symbol

NOX4

SMCO4

Gene ID

50507

56935

Gene nameNADPH oxidase 4single-pass membrane protein with coiled-coil domains 4
SynonymsKOX|KOX-1|RENOXC11orf75|FN5
Cytomap

11q14.3

11q21

Type of geneprotein-codingprotein-coding
DescriptionNADPH oxidase 4kidney oxidase-1kidney superoxide-producing NADPH oxidaserenal NAD(P)H-oxidasesingle-pass membrane and coiled-coil domain-containing protein 4UPF0443 protein C11orf75
Modification date2018051920180519
UniProtAcc

Q9NPH5

Q9NRQ5

Ensembl transtripts involved in fusion geneENST00000535633, ENST00000424319, 
ENST00000343727, ENST00000534731, 
ENST00000525196, ENST00000263317, 
ENST00000532825, ENST00000527956, 
ENST00000542487, ENST00000527626, 
ENST00000528341, ENST00000413594, 
ENST00000375979, ENST00000531342, 
ENST00000393282, 
ENST00000525141, 
ENST00000298966, ENST00000527149, 
Fusion gene scores* DoF score1 X 1 X 1=13 X 2 X 3=18
# samples 13
** MAII scorelog2(1/1*10)=3.32192809488736log2(3/18*10)=0.736965594166206
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: NOX4 [Title/Abstract] AND SMCO4 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneNOX4

GO:0006801

superoxide metabolic process

18760347

HgeneNOX4

GO:0050667

homocysteine metabolic process

20031578

HgeneNOX4

GO:0055114

oxidation-reduction process

10869423

HgeneNOX4

GO:0072593

reactive oxygen species metabolic process

10869423


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGALDTHCATCGA-EM-A2P1-01ANOX4chr11

89223626

-SMCO4chr11

93232514

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000535633ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000535633ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000535633ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
Frame-shiftENST00000424319ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000424319ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000424319ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
Frame-shiftENST00000343727ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000343727ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000343727ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000534731ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000534731ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000534731ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000525196ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000525196ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000525196ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000263317ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000263317ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000263317ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
Frame-shiftENST00000532825ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000532825ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000532825ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000527956ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000527956ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000527956ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
Frame-shiftENST00000542487ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000542487ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000542487ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
5UTR-3CDSENST00000527626ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5UTR-5UTRENST00000527626ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5UTR-5UTRENST00000527626ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
intron-3CDSENST00000528341ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
intron-5UTRENST00000528341ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
intron-5UTRENST00000528341ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000413594ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000413594ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000413594ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000375979ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000375979ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000375979ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000531342ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000531342ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000531342ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-
In-frameENST00000393282ENST00000525141NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000393282ENST00000298966NOX4chr11

89223626

-SMCO4chr11

93232514

-
5CDS-5UTRENST00000393282ENST00000527149NOX4chr11

89223626

-SMCO4chr11

93232514

-

Top

FusionProtFeatures for NOX4_SMCO4


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
NOX4

Q9NPH5

SMCO4

Q9NRQ5


check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-2181_1651579Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-291_1651272Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-231_165155Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-281_1651232Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-2171_1651539Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-21817_3751579TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-2917_3751272TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-2317_375155TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-2817_3751232TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-21717_3751539TransmembraneHelical
TgeneSMCO4chr11:89223626chr11:93232514ENST00000298966-039_31-5160Coiled coilOntology_term=ECO:0000255
TgeneSMCO4chr11:89223626chr11:93232514ENST00000525141--129_31-3260Coiled coilOntology_term=ECO:0000255
TgeneSMCO4chr11:89223626chr11:93232514ENST00000527149-039_31-5160Coiled coilOntology_term=ECO:0000255
TgeneSMCO4chr11:89223626chr11:93232514ENST00000298966-0332_52-5160TransmembraneHelical
TgeneSMCO4chr11:89223626chr11:93232514ENST00000525141--1232_52-3260TransmembraneHelical
TgeneSMCO4chr11:89223626chr11:93232514ENST00000527149-0332_52-5160TransmembraneHelical

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218304_41951579DomainFAD-binding FR-type
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-21858_30351579DomainNote=Ferric oxidoreductase
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29304_41951272DomainFAD-binding FR-type
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-2958_30351272DomainNote=Ferric oxidoreductase
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23304_4195155DomainFAD-binding FR-type
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-2358_3035155DomainNote=Ferric oxidoreductase
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28304_41951232DomainFAD-binding FR-type
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-2858_30351232DomainNote=Ferric oxidoreductase
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217304_41951539DomainFAD-binding FR-type
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-21758_30351539DomainNote=Ferric oxidoreductase
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218125_15451579Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218176_18851579Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218210_42451579Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-21838_6251579Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218446_57851579Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-21884_10351579Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29125_15451272Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29176_18851272Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29210_42451272Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-2938_6251272Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29446_57851272Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-2984_10351272Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23125_1545155Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23176_1885155Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23210_4245155Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-2338_625155Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23446_5785155Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-2384_1035155Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28125_15451232Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28176_18851232Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28210_42451232Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-2838_6251232Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28446_57851232Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-2884_10351232Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217125_15451539Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217176_18851539Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217210_42451539Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-21738_6251539Topological domainExtracellular
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217446_57851539Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-21784_10351539Topological domainCytoplasmic
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218104_12451579TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218155_17551579TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218189_20951579TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-218425_44551579TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000263317-21863_8351579TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29104_12451272TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29155_17551272TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29189_20951272TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-29425_44551272TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000375979-2963_8351272TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23104_1245155TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23155_1755155TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23189_2095155TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-23425_4455155TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000393282-2363_835155TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28104_12451232TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28155_17551232TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28189_20951232TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-28425_44551232TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000531342-2863_8351232TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217104_12451539TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217155_17551539TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217189_20951539TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-217425_44551539TransmembraneHelical
HgeneNOX4chr11:89223626chr11:93232514ENST00000534731-21763_8351539TransmembraneHelical


Top

FusionGeneSequence for NOX4_SMCO4


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_NOX4_ENST00000535633_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_27aa

>In-frame_NOX4_ENST00000534731_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_51aa

>In-frame_NOX4_ENST00000525196_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_51aa

>In-frame_NOX4_ENST00000263317_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_51aa

>In-frame_NOX4_ENST00000527956_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_27aa

>In-frame_NOX4_ENST00000413594_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_72aa

>In-frame_NOX4_ENST00000375979_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_51aa

>In-frame_NOX4_ENST00000531342_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_51aa

>In-frame_NOX4_ENST00000393282_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_51aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_NOX4_ENST00000535633_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_81nt

>In-frame_NOX4_ENST00000534731_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_153nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC

>In-frame_NOX4_ENST00000525196_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_153nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC

>In-frame_NOX4_ENST00000263317_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_153nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC

>In-frame_NOX4_ENST00000527956_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_81nt

>In-frame_NOX4_ENST00000413594_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_216nt
ATGGGAGAGATGTGGAGGAAGAGGGAAGAGGTCATTTTCCGTGAATACAGCTTTTCTTTTTACCCTTTAAACATTTTTGCTCCCTTTGTT
CTTTTCCCAGATTACTTCTGTTTGCTTGGGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTCTGGAAAACCTTCTTGCTGTATAACCAA

>In-frame_NOX4_ENST00000375979_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_153nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC

>In-frame_NOX4_ENST00000531342_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_153nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC

>In-frame_NOX4_ENST00000393282_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_153nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC


* Fusion transcript sequences (Full-length transcript).
>In-frame_NOX4_ENST00000535633_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1281nt
TGAGTGGGCAGAGCTGACCCGGTGCGGGTGGGAGTCAGGGCGCCCGGAAAACCCGGCTCTGGGTAGCAGACCCCGCCCGGGCTGGCTCGG
CGCCGGGCCTTCGGGCTTCCACTCAGTCTTTGACCCTCGGTCCTCGCTCAGCGGCCCGGCAGGCCGCACAACTGTAACCGCTGCCCCGGC
CGCCGCCCGCTCCTTCTCGGTCCGGCGGGCACAGAGCGCAGCGCGGCGGGGCCGGCGGCATGGCTGTGTCCTGGAGGAGCTGGCTCGCCA
ACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTCTGGAAAACCTTCTTGCTGTATAACCAAGGGC
CAGAGTATCACTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTGGAAATCAGTTTGCTGAAATTAATCAACGATT
CTTGAAGTTGAAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGTGTGGCCCTTCCTGGAATCCCTCTGGACACAC
CCTCCTAGCATCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACCTCCAAGGACAAGAAGGAGCGGAAGCAAGCCA
TGCAGGAGGCCCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTGCTCTTGATCGTGGTGTTTGTGTACGTGGCCA
CGCGCCCCACCATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAGAGGAGGCGCGGGAGGGGGACGCAAACAAAAA
ATGGCTTTCATATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCTTCTCTGGTCTTTGACTTGATTAAAGTATCTC
CGCTTTCTTGGGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGGTCCACTTCATGTGCCTTTCAGACTTCAAAGC
GCGCGCGCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTCTCTCCTAAAAATCGATAAGTAGCTCCACCTG
AAGAGGGATGGAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCATTGTTTGGATCATGCTTCTTTCCAACACGTG
TTCACAATCTCCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGTTGAATCAAAGTGAAATATTTATTTTTTGAAT

>In-frame_NOX4_ENST00000534731_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1124nt
ACAACTGTAACCGCTGCCCCGGCCGCCGCCCGCTCCTTCTCGGTCCGGCGGGCACAGAGCGCAGCGCGGCGGGGCCGGCGGCATGGCTGT
GTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTCTGGAAAAC
CTTCTTGCTGTATAACCAAGGGCCAGAGTATCACTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTGGAAATCAG
TTTGCTGAAATTAATCAACGATTCTTGAAGTTGAAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGTGTGGCCCT
TCCTGGAATCCCTCTGGACACACCCTCCTAGCATCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACCTCCAAGGA
CAAGAAGGAGCGGAAGCAAGCCATGCAGGAGGCCCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTGCTCTTGAT
CGTGGTGTTTGTGTACGTGGCCACGCGCCCCACCATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAGAGGAGGCG
CGGGAGGGGGACGCAAACAAAAAATGGCTTTCATATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCTTCTCTGGT
CTTTGACTTGATTAAAGTATCTCCGCTTTCTTGGGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGGTCCACTTC
ATGTGCCTTTCAGACTTCAAAGCGCGCGCGCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTCTCTCCTAA
AAATCGATAAGTAGCTCCACCTGAAGAGGGATGGAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCATTGTTTGG
ATCATGCTTCTTTCCAACACGTGTTCACAATCTCCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGTTGAATCAA

>In-frame_NOX4_ENST00000525196_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1156nt
CTCGGTCCTCGCTCAGCGGCCCGGCAGGCCGCACAACTGTAACCGCTGCCCCGGCCGCCGCCCGCTCCTTCTCGGTCCGGCGGGCACAGA
GCGCAGCGCGGCGGGGCCGGCGGCATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGG
CTCTCCATGAATGTCCTGCTTTTCTGGAAAACCTTCTTGCTGTATAACCAAGGGCCAGAGTATCACTACCTCCACCAGATGTTGGGGCAG
GAATAACTCAAGTCACCTGTACTGGAAATCAGTTTGCTGAAATTAATCAACGATTCTTGAAGTTGAAGAAAAGTTGTTCTCTCTACAGGA
GGTTCCAGCCTTGGCAAGAGGAGTGTGGCCCTTCCTGGAATCCCTCTGGACACACCCTCCTAGCATCCTCTAGGAAAGATGCGGCAGCTC
AAAGGGAAGCCCAAGAAGGAGACCTCCAAGGACAAGAAGGAGCGGAAGCAAGCCATGCAGGAGGCCCGGCAGCAGATCACTACAGTGGTG
CTGCCCACGCTGGCCGTGGTCGTGCTCTTGATCGTGGTGTTTGTGTACGTGGCCACGCGCCCCACCATCACCGAGTGAGCCCCGCAGCCG
GCTGCGGACCCCATCGGCAGGGAGAGGAGGCGCGGGAGGGGGACGCAAACAAAAAATGGCTTTCATATTCAGAGATGTTCATGTTGCTGA
GCTGTAAGCAGGAGCACCCTGTCTTCTCTGGTCTTTGACTTGATTAAAGTATCTCCGCTTTCTTGGGAGGGAATAGGGGATGTTTTATCA
GTGAATGTGCCATACACCTTATGGTCCACTTCATGTGCCTTTCAGACTTCAAAGCGCGCGCGCATGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGCTTCTTTTTCTCTCCTAAAAATCGATAAGTAGCTCCACCTGAAGAGGGATGGAACCTCTGGGTCAGGAAACAGCTG
GAATCCACACTCACCTCATTCCCATTGTTTGGATCATGCTTCTTTCCAACACGTGTTCACAATCTCCAAAGGGACTGTATTTCTTCTCTG

>In-frame_NOX4_ENST00000263317_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1281nt
TGAGTGGGCAGAGCTGACCCGGTGCGGGTGGGAGTCAGGGCGCCCGGAAAACCCGGCTCTGGGTAGCAGACCCCGCCCGGGCTGGCTCGG
CGCCGGGCCTTCGGGCTTCCACTCAGTCTTTGACCCTCGGTCCTCGCTCAGCGGCCCGGCAGGCCGCACAACTGTAACCGCTGCCCCGGC
CGCCGCCCGCTCCTTCTCGGTCCGGCGGGCACAGAGCGCAGCGCGGCGGGGCCGGCGGCATGGCTGTGTCCTGGAGGAGCTGGCTCGCCA
ACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTCTGGAAAACCTTCTTGCTGTATAACCAAGGGC
CAGAGTATCACTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTGGAAATCAGTTTGCTGAAATTAATCAACGATT
CTTGAAGTTGAAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGTGTGGCCCTTCCTGGAATCCCTCTGGACACAC
CCTCCTAGCATCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACCTCCAAGGACAAGAAGGAGCGGAAGCAAGCCA
TGCAGGAGGCCCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTGCTCTTGATCGTGGTGTTTGTGTACGTGGCCA
CGCGCCCCACCATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAGAGGAGGCGCGGGAGGGGGACGCAAACAAAAA
ATGGCTTTCATATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCTTCTCTGGTCTTTGACTTGATTAAAGTATCTC
CGCTTTCTTGGGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGGTCCACTTCATGTGCCTTTCAGACTTCAAAGC
GCGCGCGCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTCTCTCCTAAAAATCGATAAGTAGCTCCACCTG
AAGAGGGATGGAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCATTGTTTGGATCATGCTTCTTTCCAACACGTG
TTCACAATCTCCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGTTGAATCAAAGTGAAATATTTATTTTTTGAAT

>In-frame_NOX4_ENST00000527956_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1275nt
TACTTCTAGTCTAGTTGGAGAAACAACCTAGAAAATGCACCAACAAATGGGGCACAATAACTACTCTGAGAGAGAGTGGCACACAGTGGA
CGCAAAGAAGAGGTTCCTGATGCAGCTGGGAAGAGTCTACATGGGCCTCTAGCAGGAGAAGATACTGGTCTTGAGTTTGGAGACTAAGTA
AGCATCTCCAGTGTCGAATAGGTACCTGGGTCAACTCCACACACTTCTCACTCTTCACTGGACCTCTGGTACAAGATTGAGAGGATTCCT
ATTACTTACAAACAGACTAGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTCTGGAAAACCTTCTTGCTGTATAACCAAGGGCCAGAGT
ATCACTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTGGAAATCAGTTTGCTGAAATTAATCAACGATTCTTGAA
GTTGAAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGTGTGGCCCTTCCTGGAATCCCTCTGGACACACCCTCCT
AGCATCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACCTCCAAGGACAAGAAGGAGCGGAAGCAAGCCATGCAGG
AGGCCCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTGCTCTTGATCGTGGTGTTTGTGTACGTGGCCACGCGCC
CCACCATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAGAGGAGGCGCGGGAGGGGGACGCAAACAAAAAATGGCT
TTCATATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCTTCTCTGGTCTTTGACTTGATTAAAGTATCTCCGCTTT
CTTGGGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGGTCCACTTCATGTGCCTTTCAGACTTCAAAGCGCGCGC
GCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTCTCTCCTAAAAATCGATAAGTAGCTCCACCTGAAGAGG
GATGGAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCATTGTTTGGATCATGCTTCTTTCCAACACGTGTTCACA
ATCTCCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGTTGAATCAAAGTGAAATATTTATTTTTTGAATAAAGGA

>In-frame_NOX4_ENST00000413594_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1111nt
ACATTGATGGGAGAGATGTGGAGGAAGAGGGAAGAGGTCATTTTCCGTGAATACAGCTTTTCTTTTTACCCTTTAAACATTTTTGCTCCC
TTTGTTCTTTTCCCAGATTACTTCTGTTTGCTTGGGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTCTGGAAAACCTTCTTGCTGTAT
AACCAAGGGCCAGAGTATCACTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTGGAAATCAGTTTGCTGAAATTA
ATCAACGATTCTTGAAGTTGAAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGTGTGGCCCTTCCTGGAATCCCT
CTGGACACACCCTCCTAGCATCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACCTCCAAGGACAAGAAGGAGCGG
AAGCAAGCCATGCAGGAGGCCCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTGCTCTTGATCGTGGTGTTTGTG
TACGTGGCCACGCGCCCCACCATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAGAGGAGGCGCGGGAGGGGGACG
CAAACAAAAAATGGCTTTCATATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCTTCTCTGGTCTTTGACTTGATT
AAAGTATCTCCGCTTTCTTGGGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGGTCCACTTCATGTGCCTTTCAG
ACTTCAAAGCGCGCGCGCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTCTCTCCTAAAAATCGATAAGTA
GCTCCACCTGAAGAGGGATGGAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCATTGTTTGGATCATGCTTCTTT
CCAACACGTGTTCACAATCTCCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGTTGAATCAAAGTGAAATATTTA

>In-frame_NOX4_ENST00000375979_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1042nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC
TGGAAAACCTTCTTGCTGTATAACCAAGGGCCAGAGTATCACTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTG
GAAATCAGTTTGCTGAAATTAATCAACGATTCTTGAAGTTGAAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGT
GTGGCCCTTCCTGGAATCCCTCTGGACACACCCTCCTAGCATCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACC
TCCAAGGACAAGAAGGAGCGGAAGCAAGCCATGCAGGAGGCCCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTG
CTCTTGATCGTGGTGTTTGTGTACGTGGCCACGCGCCCCACCATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAG
AGGAGGCGCGGGAGGGGGACGCAAACAAAAAATGGCTTTCATATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCT
TCTCTGGTCTTTGACTTGATTAAAGTATCTCCGCTTTCTTGGGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGG
TCCACTTCATGTGCCTTTCAGACTTCAAAGCGCGCGCGCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTC
TCTCCTAAAAATCGATAAGTAGCTCCACCTGAAGAGGGATGGAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCA
TTGTTTGGATCATGCTTCTTTCCAACACGTGTTCACAATCTCCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGT

>In-frame_NOX4_ENST00000531342_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1042nt
ATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGTTAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTC
TGGAAAACCTTCTTGCTGTATAACCAAGGGCCAGAGTATCACTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTG
GAAATCAGTTTGCTGAAATTAATCAACGATTCTTGAAGTTGAAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGT
GTGGCCCTTCCTGGAATCCCTCTGGACACACCCTCCTAGCATCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACC
TCCAAGGACAAGAAGGAGCGGAAGCAAGCCATGCAGGAGGCCCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTG
CTCTTGATCGTGGTGTTTGTGTACGTGGCCACGCGCCCCACCATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAG
AGGAGGCGCGGGAGGGGGACGCAAACAAAAAATGGCTTTCATATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCT
TCTCTGGTCTTTGACTTGATTAAAGTATCTCCGCTTTCTTGGGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGG
TCCACTTCATGTGCCTTTCAGACTTCAAAGCGCGCGCGCATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTC
TCTCCTAAAAATCGATAAGTAGCTCCACCTGAAGAGGGATGGAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCA
TTGTTTGGATCATGCTTCTTTCCAACACGTGTTCACAATCTCCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGT

>In-frame_NOX4_ENST00000393282_chr11_89223626_-_SMCO4_ENST00000525141_chr11_93232514_-_1361nt
CCTAGACAAAGGGGCCGGCGCGGCGGAGCAGACTGGTGCAGCCTGGGCCGCGCGCTCAGAGCGCTGGGCGTCTGGGCAGCTGAGTGGGCA
GAGCTGACCCGGTGCGGGTGGGAGTCAGGGCGCCCGGAAAACCCGGCTCTGGGTAGCAGACCCCGCCCGGGCTGGCTCGGCGCCGGGCCT
TCGGGCTTCCACTCAGTCTTTGACCCTCGGTCCTCGCTCAGCGGCCCGGCAGGCCGCACAACTGTAACCGCTGCCCCGGCCGCCGCCCGC
TCCTTCTCGGTCCGGCGGGCACAGAGCGCAGCGCGGCGGGGCCGGCGGCATGGCTGTGTCCTGGAGGAGCTGGCTCGCCAACGAAGGGGT
TAAACACCTCTGCCTGTTCATCTGGCTCTCCATGAATGTCCTGCTTTTCTGGAAAACCTTCTTGCTGTATAACCAAGGGCCAGAGTATCA
CTACCTCCACCAGATGTTGGGGCAGGAATAACTCAAGTCACCTGTACTGGAAATCAGTTTGCTGAAATTAATCAACGATTCTTGAAGTTG
AAGAAAAGTTGTTCTCTCTACAGGAGGTTCCAGCCTTGGCAAGAGGAGTGTGGCCCTTCCTGGAATCCCTCTGGACACACCCTCCTAGCA
TCCTCTAGGAAAGATGCGGCAGCTCAAAGGGAAGCCCAAGAAGGAGACCTCCAAGGACAAGAAGGAGCGGAAGCAAGCCATGCAGGAGGC
CCGGCAGCAGATCACTACAGTGGTGCTGCCCACGCTGGCCGTGGTCGTGCTCTTGATCGTGGTGTTTGTGTACGTGGCCACGCGCCCCAC
CATCACCGAGTGAGCCCCGCAGCCGGCTGCGGACCCCATCGGCAGGGAGAGGAGGCGCGGGAGGGGGACGCAAACAAAAAATGGCTTTCA
TATTCAGAGATGTTCATGTTGCTGAGCTGTAAGCAGGAGCACCCTGTCTTCTCTGGTCTTTGACTTGATTAAAGTATCTCCGCTTTCTTG
GGAGGGAATAGGGGATGTTTTATCAGTGAATGTGCCATACACCTTATGGTCCACTTCATGTGCCTTTCAGACTTCAAAGCGCGCGCGCAT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCTTCTTTTTCTCTCCTAAAAATCGATAAGTAGCTCCACCTGAAGAGGGATG
GAACCTCTGGGTCAGGAAACAGCTGGAATCCACACTCACCTCATTCCCATTGTTTGGATCATGCTTCTTTCCAACACGTGTTCACAATCT
CCAAAGGGACTGTATTTCTTCTCTGTGCTTAATGTGATTTGAAATATGTTGAATCAAAGTGAAATATTTATTTTTTGAATAAAGGAGATA


Top

FusionGenePPI for NOX4_SMCO4


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
NOX4ACTBL2, MYO18ASMCO4BNIP3L, KRT40, CCDC155, SYNE4, KRTAP10-7, KRTAP10-3, LMNA


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for NOX4_SMCO4


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for NOX4_SMCO4


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneNOX4C0009375Colonic Neoplasms1CTD_human
HgeneNOX4C0018801Heart failure1CTD_human
HgeneNOX4C0022661Kidney Failure, Chronic1CTD_human
HgeneNOX4C0023893Liver Cirrhosis, Experimental1CTD_human
HgeneNOX4C1565489Renal Insufficiency1CTD_human
HgeneNOX4C4277682Chemical and Drug Induced Liver Injury1CTD_human