FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 22929

FusionGeneSummary for MXRA8_CDK11A

check button Fusion gene summary
Fusion gene informationFusion gene name: MXRA8_CDK11A
Fusion gene ID: 22929
HgeneTgene
Gene symbol

MXRA8

CDK11A

Gene ID

54587

728642

Gene namematrix remodeling associated 8cyclin dependent kinase 11A
SynonymsASP3CDC2L2|CDC2L3|CDK11-p110|CDK11-p46|CDK11-p58|PITSLRE|p58GTA
Cytomap

1p36.33

1p36.33

Type of geneprotein-codingprotein-coding
Descriptionmatrix remodeling-associated protein 8limitrinmatrix-remodeling-associated protein 8matrix-remodelling associated 8cyclin-dependent kinase 11APITSLRE BPITSLRE protein kinase beta SV1 isoformPITSLRE protein kinase beta SV16 isoformPITSLRE protein kinase beta SV17 isoformPITSLRE protein kinase beta SV18 isoformPITSLRE protein kinase beta SV2 isoformPITSLRE protei
Modification date2018040320180523
UniProtAcc

Q9BRK3

Q9UQ88

Ensembl transtripts involved in fusion geneENST00000309212, ENST00000342753, 
ENST00000445648, ENST00000477278, 
ENST00000356200, ENST00000378638, 
ENST00000378633, ENST00000357760, 
ENST00000404249, ENST00000358779, 
ENST00000495016, ENST00000378635, 
Fusion gene scores* DoF score4 X 2 X 3=242 X 2 X 2=8
# samples 32
** MAII scorelog2(3/24*10)=0.321928094887362
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
log2(2/8*10)=1.32192809488736
Context

PubMed: MXRA8 [Title/Abstract] AND CDK11A [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationKinase involved fusion gene, inframe and retained kinase domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneCDK11A

GO:0006468

protein phosphorylation

12501247

TgeneCDK11A

GO:0050684

regulation of mRNA processing

12501247


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVLUSCTCGA-43-5670-01AMXRA8chr1

1293836

-CDK11Achr1

1654270

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000309212ENST00000356200MXRA8chr1

1293836

-CDK11Achr1

1654270

-
In-frameENST00000309212ENST00000378638MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000309212ENST00000378633MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000309212ENST00000357760MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000309212ENST00000404249MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000309212ENST00000358779MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-intronENST00000309212ENST00000495016MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000309212ENST00000378635MXRA8chr1

1293836

-CDK11Achr1

1654270

-
In-frameENST00000342753ENST00000356200MXRA8chr1

1293836

-CDK11Achr1

1654270

-
In-frameENST00000342753ENST00000378638MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000342753ENST00000378633MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000342753ENST00000357760MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000342753ENST00000404249MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000342753ENST00000358779MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-intronENST00000342753ENST00000495016MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000342753ENST00000378635MXRA8chr1

1293836

-CDK11Achr1

1654270

-
In-frameENST00000445648ENST00000356200MXRA8chr1

1293836

-CDK11Achr1

1654270

-
In-frameENST00000445648ENST00000378638MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000445648ENST00000378633MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000445648ENST00000357760MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000445648ENST00000404249MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000445648ENST00000358779MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-intronENST00000445648ENST00000495016MXRA8chr1

1293836

-CDK11Achr1

1654270

-
5CDS-5UTRENST00000445648ENST00000378635MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-3CDSENST00000477278ENST00000356200MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-3CDSENST00000477278ENST00000378638MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-5UTRENST00000477278ENST00000378633MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-5UTRENST00000477278ENST00000357760MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-5UTRENST00000477278ENST00000404249MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-5UTRENST00000477278ENST00000358779MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-intronENST00000477278ENST00000495016MXRA8chr1

1293836

-CDK11Achr1

1654270

-
intron-5UTRENST00000477278ENST00000378635MXRA8chr1

1293836

-CDK11Achr1

1654270

-

Top

FusionProtFeatures for MXRA8_CDK11A


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
MXRA8

Q9BRK3

CDK11A

Q9UQ88

May play a role in the maturation and maintenance ofblood-brain barrier. {ECO:0000250}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneCDK11Achr1:1293836chr1:1654270ENST00000358779-02015_381-5771Compositional biasNote=Glu-rich
TgeneCDK11Achr1:1293836chr1:1654270ENST00000378633-02015_381-5784Compositional biasNote=Glu-rich
TgeneCDK11Achr1:1293836chr1:1654270ENST00000404249-02015_381-5781Compositional biasNote=Glu-rich
TgeneCDK11Achr1:1293836chr1:1654270ENST00000358779-020427_647-5771DomainProtein kinase
TgeneCDK11Achr1:1293836chr1:1654270ENST00000378633-020427_647-5784DomainProtein kinase
TgeneCDK11Achr1:1293836chr1:1654270ENST00000404249-020427_647-5781DomainProtein kinase
TgeneCDK11Achr1:1293836chr1:1654270ENST00000358779-020432_440-5771Nucleotide bindingATP
TgeneCDK11Achr1:1293836chr1:1654270ENST00000378633-020432_440-5784Nucleotide bindingATP
TgeneCDK11Achr1:1293836chr1:1654270ENST00000404249-020432_440-5781Nucleotide bindingATP

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneMXRA8chr1:1293836chr1:1654270ENST00000309212-110364_36716443Compositional biasNote=Poly-Arg
HgeneMXRA8chr1:1293836chr1:1654270ENST00000445648-110364_36716451Compositional biasNote=Poly-Arg
HgeneMXRA8chr1:1293836chr1:1654270ENST00000309212-110160_28816443DomainNote=Ig-like V-type 2
HgeneMXRA8chr1:1293836chr1:1654270ENST00000309212-11029_15716443DomainNote=Ig-like V-type 1
HgeneMXRA8chr1:1293836chr1:1654270ENST00000445648-110160_28816451DomainNote=Ig-like V-type 2
HgeneMXRA8chr1:1293836chr1:1654270ENST00000445648-11029_15716451DomainNote=Ig-like V-type 1
HgeneMXRA8chr1:1293836chr1:1654270ENST00000309212-11020_34116443Topological domainExtracellular
HgeneMXRA8chr1:1293836chr1:1654270ENST00000309212-110363_44216443Topological domainCytoplasmic
HgeneMXRA8chr1:1293836chr1:1654270ENST00000445648-11020_34116451Topological domainExtracellular
HgeneMXRA8chr1:1293836chr1:1654270ENST00000445648-110363_44216451Topological domainCytoplasmic
HgeneMXRA8chr1:1293836chr1:1654270ENST00000309212-110342_36216443TransmembraneHelical
HgeneMXRA8chr1:1293836chr1:1654270ENST00000445648-110342_36216451TransmembraneHelical


Top

FusionGeneSequence for MXRA8_CDK11A


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_MXRA8_ENST00000309212_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_16aa

>In-frame_MXRA8_ENST00000309212_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_16aa

>In-frame_MXRA8_ENST00000342753_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_16aa

>In-frame_MXRA8_ENST00000342753_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_16aa

>In-frame_MXRA8_ENST00000445648_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_16aa

>In-frame_MXRA8_ENST00000445648_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_16aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_MXRA8_ENST00000309212_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_49nt

>In-frame_MXRA8_ENST00000309212_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_49nt

>In-frame_MXRA8_ENST00000342753_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_49nt

>In-frame_MXRA8_ENST00000342753_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_49nt

>In-frame_MXRA8_ENST00000445648_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_49nt

>In-frame_MXRA8_ENST00000445648_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_49nt


* Fusion transcript sequences (Full-length transcript).
>In-frame_MXRA8_ENST00000309212_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_2733nt
GTGGGACAAAGCCTGGGGCTGGGCGGGGGCCATGGCGCTGCCATCCCGAATCCTGCTTTGGAAACTTGTGCTTCTGCAGATGTTTTAACT
CAAATGGGTGATGAAAAGGACTCTTGGAAAGTGAAAACTTTAGATGAAATTCTTCAGGAAAAGAAACGAAGGAAGGAACAAGAGGAGAAA
GCAGAGATAAAACGCTTAAAAAATGTAAGCCATATTTTTTTAAGTAAGTGGTTTTCTTAAAGGAGATTTAATTTCTTTGCCCTCATTTTT
CCATTAGAACAACGCTTCTTCGGTGAAGTTCTTTTGTACTTCCAAATGTCGCAGTCTGATGACCGGGATTCCAAGCGGGATTCCCTTGAG
GAGGGGGAGCTGAGAGATCACTGCATGGAGATCACAATAAGGAACTCCCCGTATAGAAGAGAAGACTCAATGGAAGACAGAGGAGAAGAA
GATGATTCTTTGGCCATCAAACCACCCCAGCAAATGTCTCGGAAAGAAAAAGTTCATCACAGAAAAGATGAAAAGAGAAAAGAAAAATGT
AGGCATCATAGCCATTCAGCAGAAGGGGGGAAGCATGCTAGAGTGAAAGAAAGAGAGCACGAACGTCGGAAACGACATCGAGAAGAACAG
GATAAAGCTCGCCGGGAATGGGAAAGACAGAAGAGAAGGGAAATGGCAAGGGAGCATTCCAGGAGAGAAAGGGACCGCTTGGAGCAGTTA
GAAAGGAAGCGGGAGCGGGAGCGCAAGATGCGGGAGCAGCAGAAGGAGCAGCGGGAGCAGAAGGAGCGCGAGCGGCGGGCGGAGGAGCGG
CGCAAGGAGCGGGAGGCCCGCAGGGAAGTGTCTGCACATCACCGAACGATGAGAGAGGACTACAGCGACAAAGTGAAAGCCAGCCACTGG
AGTCGCAGCCCGCCTCGGCCGCCGCGGGAGCGGTTCGAGTTGGGAGACGGCCGGAAGCCAGTAAAAGAAGAGAAAATGGAAGAAAGGGAC
CTGCTGTCCGACTTACAGGACATCAGCGACAGCGAGAGGAAGACCAGCTCGGCCGAGTCCTCGTCAGCGGAATCAGGCTCAGGTTCTGAG
GAAGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGGGAGCACCAGTGAAGAATCAGAGGAGGAGGAGGAGGAAGAGGAAGAGGAGGAG
GAGGAGACCGGCAGCAACTCTGAGGAGGCATCAGAGCAGTCTGCCGAAGAAGTAAGTGAGGAAGAAATGAGTGAAGATGAAGAACGAGAA
AATGAAAACCACCTCTTGGTTGTTCCAGAGTCACGGTTCGACCGAGATTCCGGGGAGAGTGAAGAAGCAGAGGAAGAAGTGGGTGAGGGA
ACGCCGCAGAGCAGCGCCCTGACAGAGGGCGACTATGTGCCCGACTCCCCTGCCCTGTTGCCCATCGAGCTCAAGCAGGAGCTGCCCAAG
TACCTGCCGGCCCTGCAGGGCTGCCGGAGCGTCGAGGAGTTCCAGTGCCTGAACAGGATCGAGGAGGGCACCTATGGAGTGGTCTACAGA
GCAAAAGACAAGAAAACAGATGAAATTGTGGCTCTAAAGCGGCTGAAGATGGAGAAGGAGAAGGAGGGCTTCCCGATCACGTCCCTGAGG
GAGATCAACACCATCCTCAAGGCCCAGCATCCCAACATTGTCACCGTTAGAGAGATTGTGGTGGGCAGCAACATGGACAAGATCTACATC
GTGATGAACTACGTGGAGCACGACCTCAAGAGCCTGATGGAGACCATGAAACAGCCCTTCCTGCCAGGGGAGGTGAAGACCCTGATGATC
CAGCTGCTGCGGGGGGTGAAACACCTGCACGACAACTGGATCCTGCACCGTGACCTCAAGACGTCCAACCTGCTGCTGAGCCACGCCGGC
ATCCTCAAGGTGGGTGATTTTGGGCTGGCGCGGGAGTACGGATCCCCTCTGAAGGCCTACACCCCGGTCGTGGTGACCCAGTGGTACCGC
GCCCCAGAGCTGCTGCTTGGTGCCAAGGAATACTCCACGGCCGTGGACATGTGGTCAGTGGGCTGCATCTTCGGGGAGCTGCTGACTCAG
AAGCCTCTGTTCCCCGGGAATTCGGAAATCGATCAGATCAACAAAGTGTTCAAGGAGCTGGGGACCCCCAGTGAGAAAATCTGGCCCGGC
TACAGTGAGCTCCCAGTAGTCAAAAAGATGACCTTCAGCGAGCACCCCTACAACAACCTCCGCAAGCGCTTCGGGGCTCTGCTCTCAGAC
CAGGGCTTCGACCTCATGAACAAGTTCCTGACCTACTTCCCCGGGAGGAGGATCAGCGCTGAGGACGGCCTCAAGCATGAGTATTTCCGC
GAGACCCCCCTCCCCATCGACCCCTCCATGTTCCCCACGTGGCCCGCCAAGAGCGAGCAGCAGCGTGTGAAGCGGGGCACCAGCCCGAGG
CCCCCTGAGGGAGGCCTGGGCTACAGCCAGCTGGGTGACGACGACCTGAAGGAGACGGGCTTCCACCTTACCACCACGAACCAGGGGGCC
TCTGCCGCGGGCCCCGGCTTCAGCCTCAAGTTCTGAAGGTCAGAGTGGACCCCGTCATGGGGAGAACTCAGCCGGGACCACAGGCGTGGC
TACTGCGGCTGGAGCTGCGATGAGACTCGGAACTCCTCGTCTTACTTTGTGCTCCATGTTTTGTTTTTGTATTTTGGTTTGTAAATTTGT

>In-frame_MXRA8_ENST00000309212_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_2509nt
GTGGGACAAAGCCTGGGGCTGGGCGGGGGCCATGGCGCTGCCATCCCGAATCCTGCTTTGGAAACTTGTGCTTCTGCAGATGTTTTAACT
CAAATGGGTGATGAAAAGGACTCTTGGAAAGTGAAAACTTTAGATGAAATTCTTCAGGAAAAGAAACGAAGGAAGGAACAAGAGGAGAAA
GCAGAGATAAAACGCTTAAAAAATAACAACGCTTCTTCGGTGAAGTTCTTTTGTACTTCCAAATGTCGCAGTCTGATGACCGGGATTCCA
AGCGGGATTCCCTTGAGGAGGGGGAGCTGAGAGATCACTGCATGGAGATCACAATAAGGAACTCCCCGTATAGAAGAGAAGACTCAATGG
AAGACAGAGGAGAAGAAGATGATTCTTTGGCCATCAAACCACCCCAGCAAATGTCTCGGAAAGAAAAAGTTCATCACAGAAAAGATGAAA
AGAGAAAAGAAAAATGTAGGCATCATAGCCATTCAGCAGAAGGGGGGAAGCATGCTAGAGTGAAAGAAAGAGAGCACGAACGTCGGAAAC
GACATCGAGAAGAACAGGATAAAGCTCGCCGGGAATGGGAAAGACAGAAGAGAAGGGAAATGGCAAGGGAGCATTCCAGGAGAGAAAGGG
ACCGCTTGGAGCAGTTAGAAAGGAAGCGGGAGCGGGAGCGCAAGATGCGGGAGCAGCAGAAGGAGCAGCGGGAGCAGAAGGAGCGCGAGC
GGCGGGCGGAGGAGCGGCGCAAGGAGCGGGAGGCCCGCAGGGAAGTGTCTGCACATCACCGAACGATGAGAGAGGACTACAGCGACAAAG
TGAAAGCCAGCCACTGGAGTCGCAGCCCGCCTCGGCCGCCGCGGGAGCGGTTCGAGTTGGGAGACGGCCGGAAGCCAGTAAAAGAAGAGA
AAATGGAAGAAAGGGACCTGCTGTCCGACTTACAGGACATCAGCGACAGCGAGAGGAAGACCAGCTCGGCCGAGTCCTCGTCAGCGGAAT
CAGGCTCAGGTTCTGAGGAAGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGGGAGCACCAGTGAAGAATCAGAGGAGGAGGAGGAGG
AAGAGGAAGAGGAGGAGGAGGAGACCGGCAGCAACTCTGAGGAGGCATCAGAGCAGTCTGCCGAAGAAGTAAGTGAGGAAGAAATGAGTG
AAGATGAAGAACGAGAAAATGAAAACCACCTCTTGGTTGTTCCAGAGTCACGGTTCGACCGAGATTCCGGGGAGAGTGAAGAAGCAGAGG
AAGAAGTGGGTGAGGGAACGCCGCAGAGCAGCGCCCTGACAGAGGGCGACTATGTGCCCGACTCCCCTGCCCTGTTGCCCATCGAGCTCA
AGCAGGAGCTGCCCAAGTACCTGCCGGCCCTGCAGGGCTGCCGGAGCGTCGAGGAGTTCCAGTGCCTGAACAGGATCGAGGAGGGCACCT
ATGGAGTGGTCTACAGAGCAAAAGACAAGAAAACAGATGAAATTGTGGCTCTAAAGCGGCTGAAGATGGAGAAGGAGAAGGAGGGCTTCC
CGATCACGTCCCTGAGGGAGATCAACACCATCCTCAAGGCCCAGCATCCCAACATTGTCACCGTTAGAGAGATTGTGGTGGGCAGCAACA
TGGACAAGATCTACATCGTGATGAACTACGTGGAGCACGACCTCAAGAGCCTGATGGAGACCATGAAACAGCCCTTCCTGCCAGGGGAGG
TGAAGACCCTGATGATCCAGCTGCTGCGGGGGGTGAAACACCTGCACGACAACTGGATCCTGCACCGTGACCTCAAGACGTCCAACCTGC
TGCTGAGCCACGCCGGCATCCTCAAGGTGGGTGATTTTGGGCTGGCGCGGGAGTACGGATCCCCTCTGAAGGCCTACACCCCGGTCGTGG
TGACCCAGTGGTACCGCGCCCCAGAGCTGCTGCTTGGTGCCAAGGAATACTCCACGGCCGTGGACATGTGGTCAGTGGGCTGCATCTTCG
GGGAGCTGCTGACTCAGAAGCCTCTGTTCCCCGGGAATTCGGAAATCGATCAGATCAACAAAGTGTTCAAGGAGCTGGGGACCCCCAGTG
AGAAAATCTGGCCCGGCTACAGTGAGCTCCCAGTAGTCAAAAAGATGACCTTCAGCGAGCACCCCTACAACAACCTCCGCAAGCGCTTCG
GGGCTCTGCTCTCAGACCAGGGCTTCGACCTCATGAACAAGTTCCTGACCTACTTCCCCGGGAGGAGGATCAGCGCTGAGGACGGCCTCA
AGCATGAGTATTTCCGCGAGACCCCCCTCCCCATCGACCCCTCCATGTTCCCCACGTGGCCCGCCAAGAGCGAGCAGCAGCGTGTGAAGC
GGGGCACCAGCCCGAGGCCCCCTGAGGGAGGCCTGGGCTACAGCCAGCTGGGTGACGACGACCTGAAGGAGACGGGCTTCCACCTTACCA

>In-frame_MXRA8_ENST00000342753_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_2738nt
GCCGAGTGGGACAAAGCCTGGGGCTGGGCGGGGGCCATGGCGCTGCCATCCCGAATCCTGCTTTGGAAACTTGTGCTTCTGCAGATGTTT
TAACTCAAATGGGTGATGAAAAGGACTCTTGGAAAGTGAAAACTTTAGATGAAATTCTTCAGGAAAAGAAACGAAGGAAGGAACAAGAGG
AGAAAGCAGAGATAAAACGCTTAAAAAATGTAAGCCATATTTTTTTAAGTAAGTGGTTTTCTTAAAGGAGATTTAATTTCTTTGCCCTCA
TTTTTCCATTAGAACAACGCTTCTTCGGTGAAGTTCTTTTGTACTTCCAAATGTCGCAGTCTGATGACCGGGATTCCAAGCGGGATTCCC
TTGAGGAGGGGGAGCTGAGAGATCACTGCATGGAGATCACAATAAGGAACTCCCCGTATAGAAGAGAAGACTCAATGGAAGACAGAGGAG
AAGAAGATGATTCTTTGGCCATCAAACCACCCCAGCAAATGTCTCGGAAAGAAAAAGTTCATCACAGAAAAGATGAAAAGAGAAAAGAAA
AATGTAGGCATCATAGCCATTCAGCAGAAGGGGGGAAGCATGCTAGAGTGAAAGAAAGAGAGCACGAACGTCGGAAACGACATCGAGAAG
AACAGGATAAAGCTCGCCGGGAATGGGAAAGACAGAAGAGAAGGGAAATGGCAAGGGAGCATTCCAGGAGAGAAAGGGACCGCTTGGAGC
AGTTAGAAAGGAAGCGGGAGCGGGAGCGCAAGATGCGGGAGCAGCAGAAGGAGCAGCGGGAGCAGAAGGAGCGCGAGCGGCGGGCGGAGG
AGCGGCGCAAGGAGCGGGAGGCCCGCAGGGAAGTGTCTGCACATCACCGAACGATGAGAGAGGACTACAGCGACAAAGTGAAAGCCAGCC
ACTGGAGTCGCAGCCCGCCTCGGCCGCCGCGGGAGCGGTTCGAGTTGGGAGACGGCCGGAAGCCAGTAAAAGAAGAGAAAATGGAAGAAA
GGGACCTGCTGTCCGACTTACAGGACATCAGCGACAGCGAGAGGAAGACCAGCTCGGCCGAGTCCTCGTCAGCGGAATCAGGCTCAGGTT
CTGAGGAAGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGGGAGCACCAGTGAAGAATCAGAGGAGGAGGAGGAGGAAGAGGAAGAGG
AGGAGGAGGAGACCGGCAGCAACTCTGAGGAGGCATCAGAGCAGTCTGCCGAAGAAGTAAGTGAGGAAGAAATGAGTGAAGATGAAGAAC
GAGAAAATGAAAACCACCTCTTGGTTGTTCCAGAGTCACGGTTCGACCGAGATTCCGGGGAGAGTGAAGAAGCAGAGGAAGAAGTGGGTG
AGGGAACGCCGCAGAGCAGCGCCCTGACAGAGGGCGACTATGTGCCCGACTCCCCTGCCCTGTTGCCCATCGAGCTCAAGCAGGAGCTGC
CCAAGTACCTGCCGGCCCTGCAGGGCTGCCGGAGCGTCGAGGAGTTCCAGTGCCTGAACAGGATCGAGGAGGGCACCTATGGAGTGGTCT
ACAGAGCAAAAGACAAGAAAACAGATGAAATTGTGGCTCTAAAGCGGCTGAAGATGGAGAAGGAGAAGGAGGGCTTCCCGATCACGTCCC
TGAGGGAGATCAACACCATCCTCAAGGCCCAGCATCCCAACATTGTCACCGTTAGAGAGATTGTGGTGGGCAGCAACATGGACAAGATCT
ACATCGTGATGAACTACGTGGAGCACGACCTCAAGAGCCTGATGGAGACCATGAAACAGCCCTTCCTGCCAGGGGAGGTGAAGACCCTGA
TGATCCAGCTGCTGCGGGGGGTGAAACACCTGCACGACAACTGGATCCTGCACCGTGACCTCAAGACGTCCAACCTGCTGCTGAGCCACG
CCGGCATCCTCAAGGTGGGTGATTTTGGGCTGGCGCGGGAGTACGGATCCCCTCTGAAGGCCTACACCCCGGTCGTGGTGACCCAGTGGT
ACCGCGCCCCAGAGCTGCTGCTTGGTGCCAAGGAATACTCCACGGCCGTGGACATGTGGTCAGTGGGCTGCATCTTCGGGGAGCTGCTGA
CTCAGAAGCCTCTGTTCCCCGGGAATTCGGAAATCGATCAGATCAACAAAGTGTTCAAGGAGCTGGGGACCCCCAGTGAGAAAATCTGGC
CCGGCTACAGTGAGCTCCCAGTAGTCAAAAAGATGACCTTCAGCGAGCACCCCTACAACAACCTCCGCAAGCGCTTCGGGGCTCTGCTCT
CAGACCAGGGCTTCGACCTCATGAACAAGTTCCTGACCTACTTCCCCGGGAGGAGGATCAGCGCTGAGGACGGCCTCAAGCATGAGTATT
TCCGCGAGACCCCCCTCCCCATCGACCCCTCCATGTTCCCCACGTGGCCCGCCAAGAGCGAGCAGCAGCGTGTGAAGCGGGGCACCAGCC
CGAGGCCCCCTGAGGGAGGCCTGGGCTACAGCCAGCTGGGTGACGACGACCTGAAGGAGACGGGCTTCCACCTTACCACCACGAACCAGG
GGGCCTCTGCCGCGGGCCCCGGCTTCAGCCTCAAGTTCTGAAGGTCAGAGTGGACCCCGTCATGGGGAGAACTCAGCCGGGACCACAGGC
GTGGCTACTGCGGCTGGAGCTGCGATGAGACTCGGAACTCCTCGTCTTACTTTGTGCTCCATGTTTTGTTTTTGTATTTTGGTTTGTAAA

>In-frame_MXRA8_ENST00000342753_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_2514nt
GCCGAGTGGGACAAAGCCTGGGGCTGGGCGGGGGCCATGGCGCTGCCATCCCGAATCCTGCTTTGGAAACTTGTGCTTCTGCAGATGTTT
TAACTCAAATGGGTGATGAAAAGGACTCTTGGAAAGTGAAAACTTTAGATGAAATTCTTCAGGAAAAGAAACGAAGGAAGGAACAAGAGG
AGAAAGCAGAGATAAAACGCTTAAAAAATAACAACGCTTCTTCGGTGAAGTTCTTTTGTACTTCCAAATGTCGCAGTCTGATGACCGGGA
TTCCAAGCGGGATTCCCTTGAGGAGGGGGAGCTGAGAGATCACTGCATGGAGATCACAATAAGGAACTCCCCGTATAGAAGAGAAGACTC
AATGGAAGACAGAGGAGAAGAAGATGATTCTTTGGCCATCAAACCACCCCAGCAAATGTCTCGGAAAGAAAAAGTTCATCACAGAAAAGA
TGAAAAGAGAAAAGAAAAATGTAGGCATCATAGCCATTCAGCAGAAGGGGGGAAGCATGCTAGAGTGAAAGAAAGAGAGCACGAACGTCG
GAAACGACATCGAGAAGAACAGGATAAAGCTCGCCGGGAATGGGAAAGACAGAAGAGAAGGGAAATGGCAAGGGAGCATTCCAGGAGAGA
AAGGGACCGCTTGGAGCAGTTAGAAAGGAAGCGGGAGCGGGAGCGCAAGATGCGGGAGCAGCAGAAGGAGCAGCGGGAGCAGAAGGAGCG
CGAGCGGCGGGCGGAGGAGCGGCGCAAGGAGCGGGAGGCCCGCAGGGAAGTGTCTGCACATCACCGAACGATGAGAGAGGACTACAGCGA
CAAAGTGAAAGCCAGCCACTGGAGTCGCAGCCCGCCTCGGCCGCCGCGGGAGCGGTTCGAGTTGGGAGACGGCCGGAAGCCAGTAAAAGA
AGAGAAAATGGAAGAAAGGGACCTGCTGTCCGACTTACAGGACATCAGCGACAGCGAGAGGAAGACCAGCTCGGCCGAGTCCTCGTCAGC
GGAATCAGGCTCAGGTTCTGAGGAAGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGGGAGCACCAGTGAAGAATCAGAGGAGGAGGA
GGAGGAAGAGGAAGAGGAGGAGGAGGAGACCGGCAGCAACTCTGAGGAGGCATCAGAGCAGTCTGCCGAAGAAGTAAGTGAGGAAGAAAT
GAGTGAAGATGAAGAACGAGAAAATGAAAACCACCTCTTGGTTGTTCCAGAGTCACGGTTCGACCGAGATTCCGGGGAGAGTGAAGAAGC
AGAGGAAGAAGTGGGTGAGGGAACGCCGCAGAGCAGCGCCCTGACAGAGGGCGACTATGTGCCCGACTCCCCTGCCCTGTTGCCCATCGA
GCTCAAGCAGGAGCTGCCCAAGTACCTGCCGGCCCTGCAGGGCTGCCGGAGCGTCGAGGAGTTCCAGTGCCTGAACAGGATCGAGGAGGG
CACCTATGGAGTGGTCTACAGAGCAAAAGACAAGAAAACAGATGAAATTGTGGCTCTAAAGCGGCTGAAGATGGAGAAGGAGAAGGAGGG
CTTCCCGATCACGTCCCTGAGGGAGATCAACACCATCCTCAAGGCCCAGCATCCCAACATTGTCACCGTTAGAGAGATTGTGGTGGGCAG
CAACATGGACAAGATCTACATCGTGATGAACTACGTGGAGCACGACCTCAAGAGCCTGATGGAGACCATGAAACAGCCCTTCCTGCCAGG
GGAGGTGAAGACCCTGATGATCCAGCTGCTGCGGGGGGTGAAACACCTGCACGACAACTGGATCCTGCACCGTGACCTCAAGACGTCCAA
CCTGCTGCTGAGCCACGCCGGCATCCTCAAGGTGGGTGATTTTGGGCTGGCGCGGGAGTACGGATCCCCTCTGAAGGCCTACACCCCGGT
CGTGGTGACCCAGTGGTACCGCGCCCCAGAGCTGCTGCTTGGTGCCAAGGAATACTCCACGGCCGTGGACATGTGGTCAGTGGGCTGCAT
CTTCGGGGAGCTGCTGACTCAGAAGCCTCTGTTCCCCGGGAATTCGGAAATCGATCAGATCAACAAAGTGTTCAAGGAGCTGGGGACCCC
CAGTGAGAAAATCTGGCCCGGCTACAGTGAGCTCCCAGTAGTCAAAAAGATGACCTTCAGCGAGCACCCCTACAACAACCTCCGCAAGCG
CTTCGGGGCTCTGCTCTCAGACCAGGGCTTCGACCTCATGAACAAGTTCCTGACCTACTTCCCCGGGAGGAGGATCAGCGCTGAGGACGG
CCTCAAGCATGAGTATTTCCGCGAGACCCCCCTCCCCATCGACCCCTCCATGTTCCCCACGTGGCCCGCCAAGAGCGAGCAGCAGCGTGT
GAAGCGGGGCACCAGCCCGAGGCCCCCTGAGGGAGGCCTGGGCTACAGCCAGCTGGGTGACGACGACCTGAAGGAGACGGGCTTCCACCT

>In-frame_MXRA8_ENST00000445648_chr1_1293836_-_CDK11A_ENST00000356200_chr1_1654270_-_2741nt
AGAGCCGAGTGGGACAAAGCCTGGGGCTGGGCGGGGGCCATGGCGCTGCCATCCCGAATCCTGCTTTGGAAACTTGTGCTTCTGCAGATG
TTTTAACTCAAATGGGTGATGAAAAGGACTCTTGGAAAGTGAAAACTTTAGATGAAATTCTTCAGGAAAAGAAACGAAGGAAGGAACAAG
AGGAGAAAGCAGAGATAAAACGCTTAAAAAATGTAAGCCATATTTTTTTAAGTAAGTGGTTTTCTTAAAGGAGATTTAATTTCTTTGCCC
TCATTTTTCCATTAGAACAACGCTTCTTCGGTGAAGTTCTTTTGTACTTCCAAATGTCGCAGTCTGATGACCGGGATTCCAAGCGGGATT
CCCTTGAGGAGGGGGAGCTGAGAGATCACTGCATGGAGATCACAATAAGGAACTCCCCGTATAGAAGAGAAGACTCAATGGAAGACAGAG
GAGAAGAAGATGATTCTTTGGCCATCAAACCACCCCAGCAAATGTCTCGGAAAGAAAAAGTTCATCACAGAAAAGATGAAAAGAGAAAAG
AAAAATGTAGGCATCATAGCCATTCAGCAGAAGGGGGGAAGCATGCTAGAGTGAAAGAAAGAGAGCACGAACGTCGGAAACGACATCGAG
AAGAACAGGATAAAGCTCGCCGGGAATGGGAAAGACAGAAGAGAAGGGAAATGGCAAGGGAGCATTCCAGGAGAGAAAGGGACCGCTTGG
AGCAGTTAGAAAGGAAGCGGGAGCGGGAGCGCAAGATGCGGGAGCAGCAGAAGGAGCAGCGGGAGCAGAAGGAGCGCGAGCGGCGGGCGG
AGGAGCGGCGCAAGGAGCGGGAGGCCCGCAGGGAAGTGTCTGCACATCACCGAACGATGAGAGAGGACTACAGCGACAAAGTGAAAGCCA
GCCACTGGAGTCGCAGCCCGCCTCGGCCGCCGCGGGAGCGGTTCGAGTTGGGAGACGGCCGGAAGCCAGTAAAAGAAGAGAAAATGGAAG
AAAGGGACCTGCTGTCCGACTTACAGGACATCAGCGACAGCGAGAGGAAGACCAGCTCGGCCGAGTCCTCGTCAGCGGAATCAGGCTCAG
GTTCTGAGGAAGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGGGAGCACCAGTGAAGAATCAGAGGAGGAGGAGGAGGAAGAGGAAG
AGGAGGAGGAGGAGACCGGCAGCAACTCTGAGGAGGCATCAGAGCAGTCTGCCGAAGAAGTAAGTGAGGAAGAAATGAGTGAAGATGAAG
AACGAGAAAATGAAAACCACCTCTTGGTTGTTCCAGAGTCACGGTTCGACCGAGATTCCGGGGAGAGTGAAGAAGCAGAGGAAGAAGTGG
GTGAGGGAACGCCGCAGAGCAGCGCCCTGACAGAGGGCGACTATGTGCCCGACTCCCCTGCCCTGTTGCCCATCGAGCTCAAGCAGGAGC
TGCCCAAGTACCTGCCGGCCCTGCAGGGCTGCCGGAGCGTCGAGGAGTTCCAGTGCCTGAACAGGATCGAGGAGGGCACCTATGGAGTGG
TCTACAGAGCAAAAGACAAGAAAACAGATGAAATTGTGGCTCTAAAGCGGCTGAAGATGGAGAAGGAGAAGGAGGGCTTCCCGATCACGT
CCCTGAGGGAGATCAACACCATCCTCAAGGCCCAGCATCCCAACATTGTCACCGTTAGAGAGATTGTGGTGGGCAGCAACATGGACAAGA
TCTACATCGTGATGAACTACGTGGAGCACGACCTCAAGAGCCTGATGGAGACCATGAAACAGCCCTTCCTGCCAGGGGAGGTGAAGACCC
TGATGATCCAGCTGCTGCGGGGGGTGAAACACCTGCACGACAACTGGATCCTGCACCGTGACCTCAAGACGTCCAACCTGCTGCTGAGCC
ACGCCGGCATCCTCAAGGTGGGTGATTTTGGGCTGGCGCGGGAGTACGGATCCCCTCTGAAGGCCTACACCCCGGTCGTGGTGACCCAGT
GGTACCGCGCCCCAGAGCTGCTGCTTGGTGCCAAGGAATACTCCACGGCCGTGGACATGTGGTCAGTGGGCTGCATCTTCGGGGAGCTGC
TGACTCAGAAGCCTCTGTTCCCCGGGAATTCGGAAATCGATCAGATCAACAAAGTGTTCAAGGAGCTGGGGACCCCCAGTGAGAAAATCT
GGCCCGGCTACAGTGAGCTCCCAGTAGTCAAAAAGATGACCTTCAGCGAGCACCCCTACAACAACCTCCGCAAGCGCTTCGGGGCTCTGC
TCTCAGACCAGGGCTTCGACCTCATGAACAAGTTCCTGACCTACTTCCCCGGGAGGAGGATCAGCGCTGAGGACGGCCTCAAGCATGAGT
ATTTCCGCGAGACCCCCCTCCCCATCGACCCCTCCATGTTCCCCACGTGGCCCGCCAAGAGCGAGCAGCAGCGTGTGAAGCGGGGCACCA
GCCCGAGGCCCCCTGAGGGAGGCCTGGGCTACAGCCAGCTGGGTGACGACGACCTGAAGGAGACGGGCTTCCACCTTACCACCACGAACC
AGGGGGCCTCTGCCGCGGGCCCCGGCTTCAGCCTCAAGTTCTGAAGGTCAGAGTGGACCCCGTCATGGGGAGAACTCAGCCGGGACCACA
GGCGTGGCTACTGCGGCTGGAGCTGCGATGAGACTCGGAACTCCTCGTCTTACTTTGTGCTCCATGTTTTGTTTTTGTATTTTGGTTTGT

>In-frame_MXRA8_ENST00000445648_chr1_1293836_-_CDK11A_ENST00000378638_chr1_1654270_-_2517nt
AGAGCCGAGTGGGACAAAGCCTGGGGCTGGGCGGGGGCCATGGCGCTGCCATCCCGAATCCTGCTTTGGAAACTTGTGCTTCTGCAGATG
TTTTAACTCAAATGGGTGATGAAAAGGACTCTTGGAAAGTGAAAACTTTAGATGAAATTCTTCAGGAAAAGAAACGAAGGAAGGAACAAG
AGGAGAAAGCAGAGATAAAACGCTTAAAAAATAACAACGCTTCTTCGGTGAAGTTCTTTTGTACTTCCAAATGTCGCAGTCTGATGACCG
GGATTCCAAGCGGGATTCCCTTGAGGAGGGGGAGCTGAGAGATCACTGCATGGAGATCACAATAAGGAACTCCCCGTATAGAAGAGAAGA
CTCAATGGAAGACAGAGGAGAAGAAGATGATTCTTTGGCCATCAAACCACCCCAGCAAATGTCTCGGAAAGAAAAAGTTCATCACAGAAA
AGATGAAAAGAGAAAAGAAAAATGTAGGCATCATAGCCATTCAGCAGAAGGGGGGAAGCATGCTAGAGTGAAAGAAAGAGAGCACGAACG
TCGGAAACGACATCGAGAAGAACAGGATAAAGCTCGCCGGGAATGGGAAAGACAGAAGAGAAGGGAAATGGCAAGGGAGCATTCCAGGAG
AGAAAGGGACCGCTTGGAGCAGTTAGAAAGGAAGCGGGAGCGGGAGCGCAAGATGCGGGAGCAGCAGAAGGAGCAGCGGGAGCAGAAGGA
GCGCGAGCGGCGGGCGGAGGAGCGGCGCAAGGAGCGGGAGGCCCGCAGGGAAGTGTCTGCACATCACCGAACGATGAGAGAGGACTACAG
CGACAAAGTGAAAGCCAGCCACTGGAGTCGCAGCCCGCCTCGGCCGCCGCGGGAGCGGTTCGAGTTGGGAGACGGCCGGAAGCCAGTAAA
AGAAGAGAAAATGGAAGAAAGGGACCTGCTGTCCGACTTACAGGACATCAGCGACAGCGAGAGGAAGACCAGCTCGGCCGAGTCCTCGTC
AGCGGAATCAGGCTCAGGTTCTGAGGAAGAAGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGGGAGCACCAGTGAAGAATCAGAGGAGGA
GGAGGAGGAAGAGGAAGAGGAGGAGGAGGAGACCGGCAGCAACTCTGAGGAGGCATCAGAGCAGTCTGCCGAAGAAGTAAGTGAGGAAGA
AATGAGTGAAGATGAAGAACGAGAAAATGAAAACCACCTCTTGGTTGTTCCAGAGTCACGGTTCGACCGAGATTCCGGGGAGAGTGAAGA
AGCAGAGGAAGAAGTGGGTGAGGGAACGCCGCAGAGCAGCGCCCTGACAGAGGGCGACTATGTGCCCGACTCCCCTGCCCTGTTGCCCAT
CGAGCTCAAGCAGGAGCTGCCCAAGTACCTGCCGGCCCTGCAGGGCTGCCGGAGCGTCGAGGAGTTCCAGTGCCTGAACAGGATCGAGGA
GGGCACCTATGGAGTGGTCTACAGAGCAAAAGACAAGAAAACAGATGAAATTGTGGCTCTAAAGCGGCTGAAGATGGAGAAGGAGAAGGA
GGGCTTCCCGATCACGTCCCTGAGGGAGATCAACACCATCCTCAAGGCCCAGCATCCCAACATTGTCACCGTTAGAGAGATTGTGGTGGG
CAGCAACATGGACAAGATCTACATCGTGATGAACTACGTGGAGCACGACCTCAAGAGCCTGATGGAGACCATGAAACAGCCCTTCCTGCC
AGGGGAGGTGAAGACCCTGATGATCCAGCTGCTGCGGGGGGTGAAACACCTGCACGACAACTGGATCCTGCACCGTGACCTCAAGACGTC
CAACCTGCTGCTGAGCCACGCCGGCATCCTCAAGGTGGGTGATTTTGGGCTGGCGCGGGAGTACGGATCCCCTCTGAAGGCCTACACCCC
GGTCGTGGTGACCCAGTGGTACCGCGCCCCAGAGCTGCTGCTTGGTGCCAAGGAATACTCCACGGCCGTGGACATGTGGTCAGTGGGCTG
CATCTTCGGGGAGCTGCTGACTCAGAAGCCTCTGTTCCCCGGGAATTCGGAAATCGATCAGATCAACAAAGTGTTCAAGGAGCTGGGGAC
CCCCAGTGAGAAAATCTGGCCCGGCTACAGTGAGCTCCCAGTAGTCAAAAAGATGACCTTCAGCGAGCACCCCTACAACAACCTCCGCAA
GCGCTTCGGGGCTCTGCTCTCAGACCAGGGCTTCGACCTCATGAACAAGTTCCTGACCTACTTCCCCGGGAGGAGGATCAGCGCTGAGGA
CGGCCTCAAGCATGAGTATTTCCGCGAGACCCCCCTCCCCATCGACCCCTCCATGTTCCCCACGTGGCCCGCCAAGAGCGAGCAGCAGCG
TGTGAAGCGGGGCACCAGCCCGAGGCCCCCTGAGGGAGGCCTGGGCTACAGCCAGCTGGGTGACGACGACCTGAAGGAGACGGGCTTCCA


Top

FusionGenePPI for MXRA8_CDK11A


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
MXRA8CDK11ASKIV2L, PAK1, EIF3F, CCNL2, CCNL1, B4GALT1, RNPS1, SMAD3, HSP90AA1, CSNK2A1, SOX2, GADD45A, CSNK2A2, CSNK2B, PRPF40A, RBM25, PSMD1, KPNA2, C18orf25, A2M, KPNB1, HKR1, ZNF267, ZNF460, ZNF510, ZFP14, ZNF33A, CDKN2A, NOP58, PIN1, CDC37, FKBP5, WDR47, DDB2, CDK11B, ZG16B, C12orf43, SPRR3, CRNN, AP3B1, CTR9, DPF2, LEO1, NOLC1, PELP1, SAP30BP, SUPT16H, MED4, AP4M1, FOXK2, HSP90AB3P, HSP90AA5P, HSP90AB1, CCT6B, CCT6A, CCT2, CCT3, CCT4, USP15, SPAG9, MCM2, MCM4, MCM6, EPS15L1, IVNS1ABP, NCL, PDHA1, UHRF2


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for MXRA8_CDK11A


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for MXRA8_CDK11A


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource