FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 19445

FusionGeneSummary for LAPTM4A_PUM2

check button Fusion gene summary
Fusion gene informationFusion gene name: LAPTM4A_PUM2
Fusion gene ID: 19445
HgeneTgene
Gene symbol

LAPTM4A

PUM2

Gene ID

9741

23369

Gene namelysosomal protein transmembrane 4 alphapumilio RNA binding family member 2
SynonymsHUMORF13|LAPTM4|MBNT|MtrpPUMH2|PUML2
Cytomap

2p24.1

2p24.1

Type of geneprotein-codingprotein-coding
Descriptionlysosomal-associated transmembrane protein 4Agolgi 4-transmembrane-spanning transporter MTPlysosomal-associated protein transmembrane 4 alphamembrane nucleoside transporterpumilio homolog 2pumilio-2
Modification date2018052320180522
UniProtAcc

Q15012

Q8TB72

Ensembl transtripts involved in fusion geneENST00000175091, ENST00000338086, 
ENST00000319801, ENST00000361078, 
ENST00000536417, ENST00000403432, 
ENST00000420234, 
Fusion gene scores* DoF score7 X 6 X 4=1688 X 7 X 5=280
# samples 710
** MAII scorelog2(7/168*10)=-1.26303440583379
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(10/280*10)=-1.48542682717024
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: LAPTM4A [Title/Abstract] AND PUM2 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgenePUM2

GO:0010608

posttranscriptional regulation of gene expression

25100735

TgenePUM2

GO:0043488

regulation of mRNA stability

26724866

TgenePUM2

GO:0051983

regulation of chromosome segregation

26724866

TgenePUM2

GO:1900246

positive regulation of RIG-I signaling pathway

25340845


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVSTADTCGA-FP-8631-01ALAPTM4Achr2

20251171

-PUM2chr2

20527139

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000175091ENST00000338086LAPTM4Achr2

20251171

-PUM2chr2

20527139

-
In-frameENST00000175091ENST00000319801LAPTM4Achr2

20251171

-PUM2chr2

20527139

-
In-frameENST00000175091ENST00000361078LAPTM4Achr2

20251171

-PUM2chr2

20527139

-
5CDS-5UTRENST00000175091ENST00000536417LAPTM4Achr2

20251171

-PUM2chr2

20527139

-
5CDS-5UTRENST00000175091ENST00000403432LAPTM4Achr2

20251171

-PUM2chr2

20527139

-
5CDS-5UTRENST00000175091ENST00000420234LAPTM4Achr2

20251171

-PUM2chr2

20527139

-

Top

FusionProtFeatures for LAPTM4A_PUM2


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
LAPTM4A

Q15012

PUM2

Q8TB72

May function in the transport of nucleosides and/ornucleoside derivatives between the cytosol and the lumen of anintracellular membrane-bound compartment. {ECO:0000250}. Sequence-specific RNA-binding protein that acts as apost-transcriptional repressor by binding the 3'-UTR of mRNAtargets. Binds to an RNA consensus sequence, the Pumilio ResponseElement (PRE), 5'-UGUANAUA-3', that is related to the NanosResponse Element (NRE) (, PubMed:21397187). Mediates post-transcriptional repression of transcripts via differentmechanisms: acts via direct recruitment of the CCR4-POP2-NOTdeadenylase leading to translational inhibition and mRNAdegradation (PubMed:22955276). Also mediates deadenylation-independent repression by promoting accessibility of miRNAs(PubMed:18776931, PubMed:22345517). Acts as a post-transcriptionalrepressor of E2F3 mRNAs by binding to its 3'-UTR and facilitatingmiRNA regulation (PubMed:22345517). Plays a role in cytoplasmicsensing of viral infection (PubMed:25340845). Represses a programof genes necessary to maintain genomic stability such as keymitotic, DNA repair and DNA replication factors. Its ability torepress those target mRNAs is regulated by the lncRNA NORAD (non-coding RNA activated by DNA damage) which, due to its highabundance and multitude of PUMILIO binding sites, is able tosequester a significant fraction of PUM1 and PUM2 in the cytoplasm(PubMed:26724866). May regulate DCUN1D3 mRNA levels(PubMed:25349211). May support proliferation and self-renewal ofstem cells. Binds specifically to miRNA MIR199A precursor, withPUM1, regulates miRNA MIR199A expression at a postranscriptionallevel (PubMed:28431233). {ECO:0000269|PubMed:18776931,ECO:0000269|PubMed:21397187, ECO:0000269|PubMed:22345517,ECO:0000269|PubMed:22955276, ECO:0000269|PubMed:25340845,ECO:0000269|PubMed:25349211, ECO:0000269|PubMed:26724866,ECO:0000269|PubMed:28431233}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119278_48817988Compositional biasNote=Ala-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119359_40517988Compositional biasNote=Gln-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119520_68717988Compositional biasNote=Ser-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120278_488171065Compositional biasNote=Ala-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120359_405171065Compositional biasNote=Gln-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120520_687171065Compositional biasNote=Ser-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120278_488171067Compositional biasNote=Ala-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120359_405171067Compositional biasNote=Gln-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120520_687171067Compositional biasNote=Ser-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021278_488-61065Compositional biasNote=Ala-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021359_405-61065Compositional biasNote=Gln-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021520_687-61065Compositional biasNote=Ser-rich
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119706_104817988DomainPUM-HD
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120706_1048171065DomainPUM-HD
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120706_1048171067DomainPUM-HD
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021706_1048-61065DomainPUM-HD
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--1191002_100617988RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119741_74517988RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119777_78117988RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119813_81717988RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119851_85517988RegionNon-specific-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119887_89117988RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119923_92717988RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119959_96317988RegionGuanine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--1201002_1006171065RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120741_745171065RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120777_781171065RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120813_817171065RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120851_855171065RegionNon-specific-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120887_891171065RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120923_927171065RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120959_963171065RegionGuanine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--1201002_1006171067RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120741_745171067RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120777_781171067RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120813_817171067RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120851_855171067RegionNon-specific-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120887_891171067RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120923_927171067RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120959_963171067RegionGuanine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-0211002_1006-61065RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021741_745-61065RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021777_781-61065RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021813_817-61065RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021851_855-61065RegionNon-specific-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021887_891-61065RegionAdenine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021923_927-61065RegionUracil-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021959_963-61065RegionGuanine-nucleotide binding in RNA target
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119726_76117988RepeatPumilio 1
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119762_79717988RepeatPumilio 2
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119798_83517988RepeatPumilio 3
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119836_87117988RepeatPumilio 4
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119872_90717988RepeatPumilio 5
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119908_94317988RepeatPumilio 6
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119944_97917988RepeatPumilio 7
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--119983_102217988RepeatPumilio 8
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120726_761171065RepeatPumilio 1
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120762_797171065RepeatPumilio 2
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120798_835171065RepeatPumilio 3
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120836_871171065RepeatPumilio 4
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120872_907171065RepeatPumilio 5
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120908_943171065RepeatPumilio 6
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120944_979171065RepeatPumilio 7
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--120983_1022171065RepeatPumilio 8
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120726_761171067RepeatPumilio 1
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120762_797171067RepeatPumilio 2
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120798_835171067RepeatPumilio 3
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120836_871171067RepeatPumilio 4
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120872_907171067RepeatPumilio 5
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120908_943171067RepeatPumilio 6
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120944_979171067RepeatPumilio 7
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--120983_1022171067RepeatPumilio 8
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021726_761-61065RepeatPumilio 1
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021762_797-61065RepeatPumilio 2
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021798_835-61065RepeatPumilio 3
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021836_871-61065RepeatPumilio 4
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021872_907-61065RepeatPumilio 5
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021908_943-61065RepeatPumilio 6
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021944_979-61065RepeatPumilio 7
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-021983_1022-61065RepeatPumilio 8

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneLAPTM4Achr2:20251171chr2:20527139ENST00000175091-17226_22937234Compositional biasNote=Poly-Pro
HgeneLAPTM4Achr2:20251171chr2:20527139ENST00000175091-17108_12837234TransmembraneHelical
HgeneLAPTM4Achr2:20251171chr2:20527139ENST00000175091-17160_18037234TransmembraneHelical
HgeneLAPTM4Achr2:20251171chr2:20527139ENST00000175091-1729_4937234TransmembraneHelical
HgeneLAPTM4Achr2:20251171chr2:20527139ENST00000175091-1782_10237234TransmembraneHelical


Top

FusionGeneSequence for LAPTM4A_PUM2


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000338086_chr2_20527139_-_37aa

>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000319801_chr2_20527139_-_37aa

>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000361078_chr2_20527139_-_37aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000338086_chr2_20527139_-_111nt
ATGGTGTCCATGAGTTTCAAGCGGAACCGCAGTGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATC

>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000319801_chr2_20527139_-_111nt
ATGGTGTCCATGAGTTTCAAGCGGAACCGCAGTGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATC

>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000361078_chr2_20527139_-_111nt
ATGGTGTCCATGAGTTTCAAGCGGAACCGCAGTGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATC


* Fusion transcript sequences (Full-length transcript).
>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000338086_chr2_20527139_-_6731nt
ATCCAGTACGTGGCACACATTGCTCAGAAAAGCCCCTTGTGCCCGCTTTCTGCCATCCGCGCTGTCTCGTGTCTCCCTTTTTCCATTAAA
TGCCTCTTTTCTTGCGGGTCTCATCTCGGGAATAGTGCACTACGGGGACATACCTATCCCCAACTATCCTAGGCCCGAGAACCAGCCCTT
GCCTTCGCGTAACAGGCGGAGACTCGCTGAGGCGAGTTGCACTTCTAATTGGGCGTGAGGTCTTGTCAATCCCCAAGTTCTTCCAATCAG
AAGTCCGGTCCATCCAGCCTTCCGCTCCCCATTGGCCTGTGTGGAGGAAGAGGGGTGGGTAAGCCGAAGTCGCTGCGCTCAGTGCGCAGG
CGCGAAGAAGCTGGCAGGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGTTGGGTTTTGGAGGCCGTGAAACAGCCGTTTGAGTTTG
GCTGCGGGTGGAGAACGTTTGTCAGGGGCCCGGCCAAGAAGGAGGCCCGCCTGTTACGATGGTGTCCATGAGTTTCAAGCGGAACCGCAG
TGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATCATCCTGGGGACCTGGTACATGAACAGGTTTGA
TCTGTGGATGAAATGAATCATGATTTTCAAGCTCTTGCATTAGAATCTCGGGGAATGGGAGAGCTTTTGCCTACCAAAAAGTTTTGGGAA
CCTGATGATTCAACAAAAGATGGACAAAAAGGCATATTTCTTGGGGATGATGAATGGAGAGAGACTGCATGGGGAGCTTCTCACCATTCA
ATGTCCCAGCCTATTATGGTACAGAGAAGATCTGGACAGGGTTTTCATGGAAACAGTGAAGTAAATGCAATACTGTCTCCGCGATCAGAA
AGTGGAGGCCTTGGTGTGAGCATGGTAGAATATGTATTAAGTTCTTCTCCTGCTGATAAATTGGATTCTCGATTTAGGAAGGGAAATTTT
GGCACTAGAGATGCTGAAACAGATGGACCTGAGAAAGGAGATCAAAAAGGCAAGGCTTCTCCATTTGAGGAGGACCAAAACAGAGATCTT
AAACAAGGAGATGATGATGATTCTAAAATAAATGGCAGAGGTTTGCCAAATGGAATGGATGCCGATTGCAAAGATTTTAATCGTACTCCT
GGAAGTCGTCAAGCCTCTCCAACTGAAGTAGTTGAGCGCTTGGGCCCCAATACTAATCCCTCAGAAGGACTGGGGCCTCTTCCTAATCCT
ACAGCTAATAAACCACTTGTTGAAGAATTTTCAAATCCTGAAACTCAGAATCTGGATGCCATGGAACAAGTTGGTCTGGAATCCTTACAG
TTTGACTATCCTGGTAATCAGGTACCAATGGACTCTTCAGGAGCTACTGTAGGCCTTTTTGACTACAATTCCCAGCAGCAGCTCTTTCAG
AGGACTAATGCACTAACAGTTCAACAGTTAACTGCAGCTCAACAGCAGCAATATGCATTAGCAGCAGCTCAGCAGCCACATATAGCTGGT
GTATTCTCAGCAGGCCTTGCTCCAGCTGCATTTGTGCCAAATCCATACATTATTAGTGCTGCTCCTCCAGGGACCGATCCGTATACTGCA
GCAGGATTGGCTGCAGCAGCTACATTAGCAGGTCCAGCAGTGGTTCCACCTCAGTATTACGGCGTTCCATGGGGGGTGTATCCAGCCAAC
TTATTTCAGCAGCAAGCTGCAGCTGCGGCAAATAACACAGCCAGTCAGCAAGCAGCATCACAAGCTCAGCCTGGACAGCAACAGGTTCTC
CGTGCTGGAGCAGGTCAGCGTCCTCTTACTCCCAATCAGGGTCAGCAAGGGCAGCAAGCAGAATCACTTGCGGCAGCTGCAGCAGCAAAT
CCAACATTGGCTTTTGGTCAGGGTCTTGCTACTGGCATGCCAGGCTATCAAGTACTAGCTCCAACTGCCTATTATGATCAGACTGGTGCC
TTAGTGGTTGGCCCTGGAGCAAGGACTGGCCTTGGAGCTCCAGTTCGGTTAATGGCTCCAACACCTGTTTTAATTAGTTCAGCAGCAGCA
CAAGCTGCAGCAGCAGCAGCAGCTGGAGGAACTGCAAGTAGCCTTACAGGCAGCACAAATGGTCTGTTTCGGCCAATTGGCACTCAGCCA
CCACAGCAGCAGCAACAGCAGCCAAGCACTAATCTGCAATCTAATTCATTTTATGGAAGCAGTTCTTTGACTAATAGCTCCCAGAGTAGT
TCTTTATTTTCTCATGGACCTGGTCAACCTGGAAGTACATCTCTTGGCTTTGGAAGTGGTAACTCTTTGGGTGCTGCTATAGGCTCAGCC
CTCAGTGGATTTGGTTCATCAGTTGGCAGTTCTGCAAGTAGTAGTGCCACAAGGAGAGAGTCTCTATCTACTAGCTCTGACTTGTACAAA
AGATCTAGTAGCAGCCTAGCACCCATAGGGCAACCATTTTACAATAGTCTGGGATTTTCCTCCTCTCCAAGTCCAATAGGCATGCCTCTG
CCAAGCCAAACTCCAGGACATTCACTTACGCCACCGCCATCACTTTCATCACATGGATCCTCATCCAGTTTGCATTTAGGAGGACTGACA
AATGGTAGTGGTCGATATATCTCTGCAGCACCTGGAGCAGAAGCAAAATATCGAAGTGCTTCAAGCACTTCCAGTCTATTTAGCTCCAGC
AGCCAGCTCTTTCCTCCTTCCCGGCTTCGGTATAATAGGTCTGATATTATGCCTTCTGGCCGCAGTAGATTATTGGAAGATTTCAGAAAC
AACCGCTTCCCAAACCTTCAGCTTAGAGACTTGATTGGACATATAGTTGAGTTTTCTCAAGACCAGCATGGTTCTAGATTCATACAGCAA
AAACTAGAGAGAGCTACTCCAGCTGAGCGACAGATGGTATTTAATGAAATTCTGCAAGCAGCCTATCAATTAATGACTGATGTTTTTGGC
AACTATGTTATACAGAAGTTTTTTGAGTTTGGGAGTCTGGATCAAAAATTAGCCCTGGCTACTCGTATTCGTGGTCATGTTCTACCCTTA
GCCTTGCAGATGTATGGCTGCCGCGTTATTCAGAAAGCATTAGAATCTATTTCTTCTGACCAGCAGAGTGAAATGGTAAAGGAGCTGGAT
GGTCATGTGCTCAAATGTGTGAAAGATCAGAATGGAAACCATGTTGTACAAAAATGTATCGAATGTGTTCAGCCACAGTCACTACAGTTC
ATCATTGATGCTTTCAAGGGACAAGTATTTGTGCTTTCAACTCATCCTTATGGCTGCAGAGTAATTCAGCGCATCCTAGAGCATTGCACT
GCAGAACAGACCTTACCTATCTTAGAAGAACTCCACCAACATACAGAGCAGTTGGTACAGGATCAGTATGGCAATTATGTTATTCAGCAT
GTACTGGAACACGGTCGACCTGAAGACAAGAGCAAAATTGTTTCCGAAATCAGGGGAAAGGTTTTAGCCCTGAGTCAACACAAATTTGCC
AGCAATGTAGTAGAAAAGTGTGTTACTCATGCCTCCCGTGCTGAGAGAGCTTTACTGATTGACGAGGTTTGCTGCCAGAATGATGGTCCT
CACAGTGCCTTATACACCATGATGAAGGACCAGTATGCCAATTACGTGGTTCAAAAGATGATTGATATGGCTGAACCTGCTCAGAGAAAG
ATAATCATGCACAAGATTCGACCTCACATTACTACTTTGCGCAAATACACATACGGGAAGCATATACTGGCCAAGTTGGAAAAGTATTAT
TTGAAGAATAGCCCGGACCTAGGACCTATTGGAGGACCACCAAATGGAATGCTGTAAATTACAGGAGCAAGAGAAAGAAGATAATTTAAC
CATGTGAAAAGAATTTTTTTGTGTGTGAATTATCAAAACACAACTCAACTATGAATCTTCAATTTTTTTTTAAAGCAAAACTATTTATTG
ACTTTATTCATCCATTTGTAAATTTTTTAAGGTTCTTGTGTATATTTGGGGGGTGGGGGATGAATTATAAATTATATTCAGCCCTGAGTG
GAGACCTATCAGATTGGATTGCTGGCAAAGCACAGAATGCCTGTATATGATGTAACTGTATCAAAAATAAAAAGCTGTCACATATTTTGT
AAATTTTTACCTTGTAAAGTCACAAAAATAGTTTTTAAAGGAAAAAGTACAGTATTCTTTTAATAAACTGGCTCACAGTCTGGTAGGTCT
ACAACCCCATAGCACAACAGGTTTATAGAGATGTATATAGAATTATAGTCCTTATTTTTTTCCTTTGCGTGAAACCTTTTATAACAGATT
AACAATCAACTGCATAAATATTATTAATATTTTAAAAAGAGTTAAGTTGTATTTTGATAATTCACAAACTATCATGCAAATAACGAGTAA
GTAGACAAGAATAAAGTGGTTTGAGATGAAAAGAACCTAACATTATTTACAGTAGATGTGGTTTTAATACAATTACTGCCCTAAAATGTC
TCTGGCAATGTACAGAAATATTGTATATACTTACATATGTAATTGTTGTAAGAGTTAAATACAAAATCATGGTGACACTTCCAATTAAGT
GCACTAAATGAAAAGTTAAGTCACTTATTAACTTTTCAGTTTGGTTTGCAATGAGAAAGAGTGGAAATTTGTATTTTGTTTTGCTTATAG
AATTACAGACATGTTGAGGAAGTGTTGAGCTTTATTTTGCTTTTTCATAGAGGCAGAAAGTAGGAACCAGATAGAGATGAAAAGGGGCCA
CTGAAAAGTGAATTTGATAGCTCAGCATTTAAGCATGATTACATATTCAGATAGCTCTTTTTGCTTTCTATAAATATATGCATTGTGTGT
GTAGTAATAGATGTAAGTTTACACTTTGAAAGGAAATCTTGTTTCAATGTTTATTATAAAAGCCTTGCTAATTTAGTAGTGATGCTTTCC
TTGGTTGTACAGGTGTACATTTGTAAACCTTCATGCTGTAAATGGAATTTGTTTTATCTCTTTGGGATACATTTGCATTTTAGTGTACAT
TTACGTCCCTGCCCTCTTTGACCTGGCAATATAGTGTTGTATAATGTAAATTTATTTCTCCAAATCGAGAGTGATTTTTTAAAAATTTTT
TATCTTTATATGGTTTCAGAAGTATGAACCAGCTTTCTTTTTATTATTGTGAGATCATTTTGTTTTATAACATAGTTGTTGACTGTTAAT
ATGGACCTGCTAGAATTTGGATCACTTTCAATTGAAGTCAGGGTATTGTGCATAATAGAAAGTATTGGACTGAGATATTTGGTTACCATG
GAGGCCAATGCTTTTTTCATCTTATTAAATGTGATGTGACTTTTTTCTTTGTACAGAAGAGTACTGTATTTTTGAATAGCCTACTCCCAA
GTAAGAGCAAATCTGTATGATAACATTTTTTCCTCTGGACATAAGACATAACAGTAACACGATGTACATTTACAAGCGGCCTTATGTACA
TTTCCCAACAATCTTTTTAAGGCAAAATTGTGACCATATGTGTATAATTAAAATCGTTTTTAATCCTTTGCCTATGAAAATATTTTGGAA
AAAAACTTGCTGTGTATATTCAGTTTCTGAAAGATAAAGAAAGTGCTTTGTATTTTGTTGAAGTCAGTATTTTGTATAAACATTTATGTT
GACCCACTTATGTTCAGTGCTGAAAACTAAAATGAACATGCTATTCTGTCAGCTGAATATGGAAGAGATCTTTTTTTACTAGAGATCTGC
AGAAGAAACGCAATCTTCTGAGCACAATATGGAATCTAAAGGTTTTATCACTTAGTTGTTCATATTATGAACCTAAAAATAATGGCATAA
AGTTTGGGGATGCCAGGCATACTTTTTCATGTTTGGTGTTGAGTTATTTTACTTTTCTAACCCAACATTCCTTGGTGAGACCATTAAATC
CAAACACTTGTCACCGTTCCTTCTCATAGTCACTCTGGGTCATCAGCATGTCCCAGTCACTGCAGCAACGCCTTGTGTTTGTTTCATTTT
TTTAAAACCCACACAAAGCCGCTGTCTCACTTTTTCCTACTTTACCAACCTCAGAGTATTTCGGCCCGTATCGAACTTTTGTTCTCAGTA
TCAGCCCATGGTTTCAGGATCAAAGCTGTCATGTTGGAGATTGGTAATGGCTTTCCTGTCTTTGTACAGTTGAATTCCTAGTCTTCCTTC
ATCCTTGCCCTCTGTTGGCACAGGCATTATCTCTGCAATTTTAGAAAATGACAAGTAGAGAATACTACATTGAGAAACTAAACCCTCTTC
TTGGGGTCCTGATACTCATTCCCATTTGTCCCAGTGCTGACAACCCAATCTTCCCAATACTTTCAGGCCTGCTCTACAAAAGTACCTGTT
CTTGTAGAAATTTTACAGTCTGCCATTTTGGGTGCCCACCCCAATTTTTACCTTTTAGTAAGTTGGCATGAAATTTTGGTAAAATCTGAA
AATCACATTTCAGAATAAAACAATTGGGCAAAACTACCTAGGCTTTACTCTTGAGTGTCTCCTTTTGATAGGGATTGTTTCTGGACCAGT
TTGTCTAAGTCCTGGCTCTTATTGGTTCATATGAAATAATGTTAACTTCACTTCTTTGTATATTATGTATAAATTAGAAAATGAAAAATG

>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000319801_chr2_20527139_-_6499nt
ATCCAGTACGTGGCACACATTGCTCAGAAAAGCCCCTTGTGCCCGCTTTCTGCCATCCGCGCTGTCTCGTGTCTCCCTTTTTCCATTAAA
TGCCTCTTTTCTTGCGGGTCTCATCTCGGGAATAGTGCACTACGGGGACATACCTATCCCCAACTATCCTAGGCCCGAGAACCAGCCCTT
GCCTTCGCGTAACAGGCGGAGACTCGCTGAGGCGAGTTGCACTTCTAATTGGGCGTGAGGTCTTGTCAATCCCCAAGTTCTTCCAATCAG
AAGTCCGGTCCATCCAGCCTTCCGCTCCCCATTGGCCTGTGTGGAGGAAGAGGGGTGGGTAAGCCGAAGTCGCTGCGCTCAGTGCGCAGG
CGCGAAGAAGCTGGCAGGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGTTGGGTTTTGGAGGCCGTGAAACAGCCGTTTGAGTTTG
GCTGCGGGTGGAGAACGTTTGTCAGGGGCCCGGCCAAGAAGGAGGCCCGCCTGTTACGATGGTGTCCATGAGTTTCAAGCGGAACCGCAG
TGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATCATCCTGGGGACCTGGTACATGAACAGGTTTGA
TCTGTGGATGAAATGAATCATGATTTTCAAGCTCTTGCATTAGAATCTCGGGGAATGGGAGAGCTTTTGCCTACCAAAAAGTTTTGGGAA
CCTGATGATTCAACAAAAGATGGACAAAAAGGCATATTTCTTGGGGATGATGAATGGAGAGAGACTGCATGGGGAGCTTCTCACCATTCA
ATGTCCCAGCCTATTATGGTACAGAGAAGATCTGGACAGGGTTTTCATGGAAACAGTGAAGTAAATGCAATACTGTCTCCGCGATCAGAA
AGTGGAGGCCTTGGTGTGAGCATGGTAGAATATGTATTAAGTTCTTCTCCTGCTGATAAATTGGATTCTCGATTTAGGAAGGGAAATTTT
GGCACTAGAGATGCTGAAACAGATGGACCTGAGAAAGGAGATCAAAAAGGCAAGGCTTCTCCATTTGAGGAGGACCAAAACAGAGATCTT
AAACAAGGAGATGATGATGATTCTAAAATAAATGGCAGAGGTTTGCCAAATGGAATGGATGCCGATTGCAAAGATTTTAATCGTACTCCT
GGAAGTCGTCAAGCCTCTCCAACTGAAGTAGTTGAGCGCTTGGGCCCCAATACTAATCCCTCAGAAGGACTGGGGCCTCTTCCTAATCCT
ACAGCTAATAAACCACTTGTTGAAGAATTTTCAAATCCTGAAACTCAGAATCTGGATGCCATGGAACAAGTTGGTCTGGAATCCTTACAG
TTTGACTATCCTGGTAATCAGGTACCAATGGACTCTTCAGGAGCTACTGTAGGCCTTTTTGACTACAATTCCCAGCAGCAGCTCTTTCAG
AGGACTAATGCACTAACAGTTCAACAGTTAACTGCAGCTCAACAGCAGCAATATGCATTAGCAGCAGCTCAGCAGCCACATATAGCTGGT
GTATTCTCAGCAGGCCTTGCTCCAGCTGCATTTGTGCCAAATCCATACATTATTAGTGCTGCTCCTCCAGGGACCGATCCGTATACTGCA
GCAGGATTGGCTGCAGCAGCTACATTAGCAGGTCCAGCAGTGGTTCCACCTCAGTATTACGGCGTTCCATGGGGGGTGTATCCAGCCAAC
TTATTTCAGCAGCAAGCTGCAGCTGCGGCAAATAACACAGCCAGTCAGCAAGCAGCATCACAAGCTCAGCCTGGACAGCAACAGGTTCTC
CGTGCTGGAGCAGGTCAGCGTCCTCTTACTCCCAATCAGGGTCAGCAAGGGCAGCAAGCAGAATCACTTGCGGCAGCTGCAGCAGCAAAT
CCAACATTGGCTTTTGGTCAGGGTCTTGCTACTGGCATGCCAGGCTATCAAGTACTAGCTCCAACTGCCTATTATGATCAGACTGGTGCC
TTAGTGGTTGGCCCTGGAGCAAGGACTGGCCTTGGAGCTCCAGTTCGGTTAATGGCTCCAACACCTGTTTTAATTAGTTCAGCAGCAGCA
CAAGCTGCAGCAGCAGCAGCAGCTGGAGGAACTGCAAGTAGCCTTACAGGCAGCACAAATGGTCTGTTTCGGCCAATTGGCACTCAGCCA
CCACAGCAGCAGCAACAGCAGCCAAGCACTAATCTGCAATCTAATTCATTTTATGGAAGCAGTTCTTTGACTAATAGCTCCCAGAGTAGT
TCTTTATTTTCTCATGGACCTGGTCAACCTGGAAGTACATCTCTTGGCTTTGGAAGTGGTAACTCTTTGGGTGCTGCTATAGGCTCAGCC
CTCAGTGGATTTGGTTCATCAGGAGGACTGACAAATGGTAGTGGTCGATATATCTCTGCAGCACCTGGAGCAGAAGCAAAATATCGAAGT
GCTTCAAGCACTTCCAGTCTATTTAGCTCCAGCAGCCAGCTCTTTCCTCCTTCCCGGCTTCGGTATAATAGGTCTGATATTATGCCTTCT
GGCCGCAGTAGATTATTGGAAGATTTCAGAAACAACCGCTTCCCAAACCTTCAGCTTAGAGACTTGATTGGACATATAGTTGAGTTTTCT
CAAGACCAGCATGGTTCTAGATTCATACAGCAAAAACTAGAGAGAGCTACTCCAGCTGAGCGACAGATGGTATTTAATGAAATTCTGCAA
GCAGCCTATCAATTAATGACTGATGTTTTTGGCAACTATGTTATACAGAAGTTTTTTGAGTTTGGGAGTCTGGATCAAAAATTAGCCCTG
GCTACTCGTATTCGTGGTCATGTTCTACCCTTAGCCTTGCAGATGTATGGCTGCCGCGTTATTCAGAAAGCATTAGAATCTATTTCTTCT
GACCAGCAGGTAATTAGTGAAATGGTAAAGGAGCTGGATGGTCATGTGCTCAAATGTGTGAAAGATCAGAATGGAAACCATGTTGTACAA
AAATGTATCGAATGTGTTCAGCCACAGTCACTACAGTTCATCATTGATGCTTTCAAGGGACAAGTATTTGTGCTTTCAACTCATCCTTAT
GGCTGCAGAGTAATTCAGCGCATCCTAGAGCATTGCACTGCAGAACAGACCTTACCTATCTTAGAAGAACTCCACCAACATACAGAGCAG
TTGGTACAGGATCAGTATGGCAATTATGTTATTCAGCATGTACTGGAACACGGTCGACCTGAAGACAAGAGCAAAATTGTTTCCGAAATC
AGGGGAAAGGTTTTAGCCCTGAGTCAACACAAATTTGCCAGCAATGTAGTAGAAAAGTGTGTTACTCATGCCTCCCGTGCTGAGAGAGCT
TTACTGATTGACGAGGTTTGCTGCCAGAATGATGGTCCTCACAGTGCCTTATACACCATGATGAAGGACCAGTATGCCAATTACGTGGTT
CAAAAGATGATTGATATGGCTGAACCTGCTCAGAGAAAGATAATCATGCACAAGATTCGACCTCACATTACTACTTTGCGCAAATACACA
TACGGGAAGCATATACTGGCCAAGTTGGAAAAGTATTATTTGAAGAATAGCCCGGACCTAGGACCTATTGGAGGACCACCAAATGGAATG
CTGTAAATTACAGGAGCAAGAGAAAGAAGATAATTTAACCATGTGAAAAGAATTTTTTTGTGTGTGAATTATCAAAACACAACTCAACTA
TGAATCTTCAATTTTTTTTTAAAGCAAAACTATTTATTGACTTTATTCATCCATTTGTAAATTTTTTAAGGTTCTTGTGTATATTTGGGG
GGTGGGGGATGAATTATAAATTATATTCAGCCCTGAGTGGAGACCTATCAGATTGGATTGCTGGCAAAGCACAGAATGCCTGTATATGAT
GTAACTGTATCAAAAATAAAAAGCTGTCACATATTTTGTAAATTTTTACCTTGTAAAGTCACAAAAATAGTTTTTAAAGGAAAAAGTACA
GTATTCTTTTAATAAACTGGCTCACAGTCTGGTAGGTCTACAACCCCATAGCACAACAGGTTTATAGAGATGTATATAGAATTATAGTCC
TTATTTTTTTCCTTTGCGTGAAACCTTTTATAACAGATTAACAATCAACTGCATAAATATTATTAATATTTTAAAAAGAGTTAAGTTGTA
TTTTGATAATTCACAAACTATCATGCAAATAACGAGTAAGTAGACAAGAATAAAGTGGTTTGAGATGAAAAGAACCTAACATTATTTACA
GTAGATGTGGTTTTAATACAATTACTGCCCTAAAATGTCTCTGGCAATGTACAGAAATATTGTATATACTTACATATGTAATTGTTGTAA
GAGTTAAATACAAAATCATGGTGACACTTCCAATTAAGTGCACTAAATGAAAAGTTAAGTCACTTATTAACTTTTCAGTTTGGTTTGCAA
TGAGAAAGAGTGGAAATTTGTATTTTGTTTTGCTTATAGAATTACAGACATGTTGAGGAAGTGTTGAGCTTTATTTTGCTTTTTCATAGA
GGCAGAAAGTAGGAACCAGATAGAGATGAAAAGGGGCCACTGAAAAGTGAATTTGATAGCTCAGCATTTAAGCATGATTACATATTCAGA
TAGCTCTTTTTGCTTTCTATAAATATATGCATTGTGTGTGTAGTAATAGATGTAAGTTTACACTTTGAAAGGAAATCTTGTTTCAATGTT
TATTATAAAAGCCTTGCTAATTTAGTAGTGATGCTTTCCTTGGTTGTACAGGTGTACATTTGTAAACCTTCATGCTGTAAATGGAATTTG
TTTTATCTCTTTGGGATACATTTGCATTTTAGTGTACATTTACGTCCCTGCCCTCTTTGACCTGGCAATATAGTGTTGTATAATGTAAAT
TTATTTCTCCAAATCGAGAGTGATTTTTTAAAAATTTTTTATCTTTATATGGTTTCAGAAGTATGAACCAGCTTTCTTTTTATTATTGTG
AGATCATTTTGTTTTATAACATAGTTGTTGACTGTTAATATGGACCTGCTAGAATTTGGATCACTTTCAATTGAAGTCAGGGTATTGTGC
ATAATAGAAAGTATTGGACTGAGATATTTGGTTACCATGGAGGCCAATGCTTTTTTCATCTTATTAAATGTGATGTGACTTTTTTCTTTG
TACAGAAGAGTACTGTATTTTTGAATAGCCTACTCCCAAGTAAGAGCAAATCTGTATGATAACATTTTTTCCTCTGGACATAAGACATAA
CAGTAACACGATGTACATTTACAAGCGGCCTTATGTACATTTCCCAACAATCTTTTTAAGGCAAAATTGTGACCATATGTGTATAATTAA
AATCGTTTTTAATCCTTTGCCTATGAAAATATTTTGGAAAAAAACTTGCTGTGTATATTCAGTTTCTGAAAGATAAAGAAAGTGCTTTGT
ATTTTGTTGAAGTCAGTATTTTGTATAAACATTTATGTTGACCCACTTATGTTCAGTGCTGAAAACTAAAATGAACATGCTATTCTGTCA
GCTGAATATGGAAGAGATCTTTTTTTACTAGAGATCTGCAGAAGAAACGCAATCTTCTGAGCACAATATGGAATCTAAAGGTTTTATCAC
TTAGTTGTTCATATTATGAACCTAAAAATAATGGCATAAAGTTTGGGGATGCCAGGCATACTTTTTCATGTTTGGTGTTGAGTTATTTTA
CTTTTCTAACCCAACATTCCTTGGTGAGACCATTAAATCCAAACACTTGTCACCGTTCCTTCTCATAGTCACTCTGGGTCATCAGCATGT
CCCAGTCACTGCAGCAACGCCTTGTGTTTGTTTCATTTTTTTAAAACCCACACAAAGCCGCTGTCTCACTTTTTCCTACTTTACCAACCT
CAGAGTATTTCGGCCCGTATCGAACTTTTGTTCTCAGTATCAGCCCATGGTTTCAGGATCAAAGCTGTCATGTTGGAGATTGGTAATGGC
TTTCCTGTCTTTGTACAGTTGAATTCCTAGTCTTCCTTCATCCTTGCCCTCTGTTGGCACAGGCATTATCTCTGCAATTTTAGAAAATGA
CAAGTAGAGAATACTACATTGAGAAACTAAACCCTCTTCTTGGGGTCCTGATACTCATTCCCATTTGTCCCAGTGCTGACAACCCAATCT
TCCCAATACTTTCAGGCCTGCTCTACAAAAGTACCTGTTCTTGTAGAAATTTTACAGTCTGCCATTTTGGGTGCCCACCCCAATTTTTAC
CTTTTAGTAAGTTGGCATGAAATTTTGGTAAAATCTGAAAATCACATTTCAGAATAAAACAATTGGGCAAAACTACCTAGGCTTTACTCT
TGAGTGTCTCCTTTTGATAGGGATTGTTTCTGGACCAGTTTGTCTAAGTCCTGGCTCTTATTGGTTCATATGAAATAATGTTAACTTCAC
TTCTTTGTATATTATGTATAAATTAGAAAATGAAAAATGTGTGAATAACATTGTATGAAATAAACCTGGTCTTGTGTTTTTCTCTAGATA

>In-frame_LAPTM4A_ENST00000175091_chr2_20251171_-_PUM2_ENST00000361078_chr2_20527139_-_6736nt
ATCCAGTACGTGGCACACATTGCTCAGAAAAGCCCCTTGTGCCCGCTTTCTGCCATCCGCGCTGTCTCGTGTCTCCCTTTTTCCATTAAA
TGCCTCTTTTCTTGCGGGTCTCATCTCGGGAATAGTGCACTACGGGGACATACCTATCCCCAACTATCCTAGGCCCGAGAACCAGCCCTT
GCCTTCGCGTAACAGGCGGAGACTCGCTGAGGCGAGTTGCACTTCTAATTGGGCGTGAGGTCTTGTCAATCCCCAAGTTCTTCCAATCAG
AAGTCCGGTCCATCCAGCCTTCCGCTCCCCATTGGCCTGTGTGGAGGAAGAGGGGTGGGTAAGCCGAAGTCGCTGCGCTCAGTGCGCAGG
CGCGAAGAAGCTGGCAGGGGCACGAGCCGGGGGCGGGTTTGAAGACGCGTCGTTGGGTTTTGGAGGCCGTGAAACAGCCGTTTGAGTTTG
GCTGCGGGTGGAGAACGTTTGTCAGGGGCCCGGCCAAGAAGGAGGCCCGCCTGTTACGATGGTGTCCATGAGTTTCAAGCGGAACCGCAG
TGACCGGTTCTACAGCACCCGGTGCTGCGGCTGTTGCCATGTCCGCACCGGGACGATCATCCTGGGGACCTGGTACATGAACAGGTTTGA
TCTGTGGATGAAATGAATCATGATTTTCAAGCTCTTGCATTAGAATCTCGGGGAATGGGAGAGCTTTTGCCTACCAAAAAGTTTTGGGAA
CCTGATGATTCAACAAAAGATGGACAAAAAGGCATATTTCTTGGGGATGATGAATGGAGAGAGACTGCATGGGGAGCTTCTCACCATTCA
ATGTCCCAGCCTATTATGGTACAGAGAAGATCTGGACAGGGTTTTCATGGAAACAGTGAAGTAAATGCAATACTGTCTCCGCGATCAGAA
AGTGGAGGCCTTGGTGTGAGCATGGTAGAATATGTATTAAGTTCTTCTCCTGCTGATAAATTGGATTCTCGATTTAGGAAGGGAAATTTT
GGCACTAGAGATGCTGAAACAGATGGACCTGAGAAAGGAGATCAAAAAGGCAAGGCTTCTCCATTTGAGGAGGACCAAAACAGAGATCTT
AAACAAGGAGATGATGATGATTCTAAAATAAATGGCAGAGGTTTGCCAAATGGAATGGATGCCGATTGCAAAGATTTTAATCGTACTCCT
GGAAGTCGTCAAGCCTCTCCAACTGAAGTAGTTGAGCGCTTGGGCCCCAATACTAATCCCTCAGAAGGACTGGGGCCTCTTCCTAATCCT
ACAGCTAATAAACCACTTGTTGAAGAATTTTCAAATCCTGAAACTCAGAATCTGGATGCCATGGAACAAGTTGGTCTGGAATCCTTACAG
TTTGACTATCCTGGTAATCAGGTACCAATGGACTCTTCAGGAGCTACTGTAGGCCTTTTTGACTACAATTCCCAGCAGCAGCTCTTTCAG
AGGACTAATGCACTAACAGTTCAACAGTTAACTGCAGCTCAACAGCAGCAATATGCATTAGCAGCAGCTCAGCAGCCACATATAGCTGGT
GTATTCTCAGCAGGCCTTGCTCCAGCTGCATTTGTGCCAAATCCATACATTATTAGTGCTGCTCCTCCAGGGACCGATCCGTATACTGCA
GCAGGATTGGCTGCAGCAGCTACATTAGCAGGTCCAGCAGTGGTTCCACCTCAGTATTACGGCGTTCCATGGGGGGTGTATCCAGCCAAC
TTATTTCAGCAGCAAGCTGCAGCTGCGGCAAATAACACAGCCAGTCAGCAAGCAGCATCACAAGCTCAGCCTGGACAGCAACAGGTTCTC
CGTGCTGGAGCAGGTCAGCGTCCTCTTACTCCCAATCAGGGTCAGCAAGGGCAGCAAGCAGAATCACTTGCGGCAGCTGCAGCAGCAAAT
CCAACATTGGCTTTTGGTCAGGGTCTTGCTACTGGCATGCCAGGCTATCAAGTACTAGCTCCAACTGCCTATTATGATCAGACTGGTGCC
TTAGTGGTTGGCCCTGGAGCAAGGACTGGCCTTGGAGCTCCAGTTCGGTTAATGGCTCCAACACCTGTTTTAATTAGTTCAGCAGCAGCA
CAAGCTGCAGCAGCAGCAGCAGCTGGAGGAACTGCAAGTAGCCTTACAGGCAGCACAAATGGTCTGTTTCGGCCAATTGGCACTCAGCCA
CCACAGCAGCAGCAACAGCAGCCAAGCACTAATCTGCAATCTAATTCATTTTATGGAAGCAGTTCTTTGACTAATAGCTCCCAGAGTAGT
TCTTTATTTTCTCATGGACCTGGTCAACCTGGAAGTACATCTCTTGGCTTTGGAAGTGGTAACTCTTTGGGTGCTGCTATAGGCTCAGCC
CTCAGTGGATTTGGTTCATCAGTTGGCAGTTCTGCAAGTAGTAGTGCCACAAGGAGAGAGTCTCTATCTACTAGCTCTGACTTGTACAAA
AGATCTAGTAGCAGCCTAGCACCCATAGGGCAACCATTTTACAATAGTCTGGGATTTTCCTCCTCTCCAAGTCCAATAGGCATGCCTCTG
CCAAGCCAAACTCCAGGACATTCACTTACGCCACCGCCATCACTTTCATCACATGGATCCTCATCCAGTTTGCATTTAGGAGGACTGACA
AATGGTAGTGGTCGATATATCTCTGCAGCACCTGGAGCAGAAGCAAAATATCGAAGTGCTTCAAGCACTTCCAGTCTATTTAGCTCCAGC
AGCCAGCTCTTTCCTCCTTCCCGGCTTCGGTATAATAGGTCTGATATTATGCCTTCTGGCCGCAGTAGATTATTGGAAGATTTCAGAAAC
AACCGCTTCCCAAACCTTCAGCTTAGAGACTTGATTGGACATATAGTTGAGTTTTCTCAAGACCAGCATGGTTCTAGATTCATACAGCAA
AAACTAGAGAGAGCTACTCCAGCTGAGCGACAGATGGTATTTAATGAAATTCTGCAAGCAGCCTATCAATTAATGACTGATGTTTTTGGC
AACTATGTTATACAGAAGTTTTTTGAGTTTGGGAGTCTGGATCAAAAATTAGCCCTGGCTACTCGTATTCGTGGTCATGTTCTACCCTTA
GCCTTGCAGATGTATGGCTGCCGCGTTATTCAGAAAGCATTAGAATCTATTTCTTCTGACCAGCAGGTAATTAGTGAAATGGTAAAGGAG
CTGGATGGTCATGTGCTCAAATGTGTGAAAGATCAGAATGGAAACCATGTTGTACAAAAATGTATCGAATGTGTTCAGCCACAGTCACTA
CAGTTCATCATTGATGCTTTCAAGGGACAAGTATTTGTGCTTTCAACTCATCCTTATGGCTGCAGAGTAATTCAGCGCATCCTAGAGCAT
TGCACTGCAGAACAGACCTTACCTATCTTAGAAGAACTCCACCAACATACAGAGCAGTTGGTACAGGATCAGTATGGCAATTATGTTATT
CAGCATGTACTGGAACACGGTCGACCTGAAGACAAGAGCAAAATTGTTTCCGAAATCAGGGGAAAGGTTTTAGCCCTGAGTCAACACAAA
TTTGCCAGCAATGTAGTAGAAAAGTGTGTTACTCATGCCTCCCGTGCTGAGAGAGCTTTACTGATTGACGAGGTTTGCTGCCAGAATGAT
GGTCCTCACAGTGCCTTATACACCATGATGAAGGACCAGTATGCCAATTACGTGGTTCAAAAGATGATTGATATGGCTGAACCTGCTCAG
AGAAAGATAATCATGCACAAGATTCGACCTCACATTACTACTTTGCGCAAATACACATACGGGAAGCATATACTGGCCAAGTTGGAAAAG
TATTATTTGAAGAATAGCCCGGACCTAGGACCTATTGGAGGACCACCAAATGGAATGCTGTAAATTACAGGAGCAAGAGAAAGAAGATAA
TTTAACCATGTGAAAAGAATTTTTTTGTGTGTGAATTATCAAAACACAACTCAACTATGAATCTTCAATTTTTTTTTAAAGCAAAACTAT
TTATTGACTTTATTCATCCATTTGTAAATTTTTTAAGGTTCTTGTGTATATTTGGGGGGTGGGGGATGAATTATAAATTATATTCAGCCC
TGAGTGGAGACCTATCAGATTGGATTGCTGGCAAAGCACAGAATGCCTGTATATGATGTAACTGTATCAAAAATAAAAAGCTGTCACATA
TTTTGTAAATTTTTACCTTGTAAAGTCACAAAAATAGTTTTTAAAGGAAAAAGTACAGTATTCTTTTAATAAACTGGCTCACAGTCTGGT
AGGTCTACAACCCCATAGCACAACAGGTTTATAGAGATGTATATAGAATTATAGTCCTTATTTTTTTCCTTTGCGTGAAACCTTTTATAA
CAGATTAACAATCAACTGCATAAATATTATTAATATTTTAAAAAGAGTTAAGTTGTATTTTGATAATTCACAAACTATCATGCAAATAAC
GAGTAAGTAGACAAGAATAAAGTGGTTTGAGATGAAAAGAACCTAACATTATTTACAGTAGATGTGGTTTTAATACAATTACTGCCCTAA
AATGTCTCTGGCAATGTACAGAAATATTGTATATACTTACATATGTAATTGTTGTAAGAGTTAAATACAAAATCATGGTGACACTTCCAA
TTAAGTGCACTAAATGAAAAGTTAAGTCACTTATTAACTTTTCAGTTTGGTTTGCAATGAGAAAGAGTGGAAATTTGTATTTTGTTTTGC
TTATAGAATTACAGACATGTTGAGGAAGTGTTGAGCTTTATTTTGCTTTTTCATAGAGGCAGAAAGTAGGAACCAGATAGAGATGAAAAG
GGGCCACTGAAAAGTGAATTTGATAGCTCAGCATTTAAGCATGATTACATATTCAGATAGCTCTTTTTGCTTTCTATAAATATATGCATT
GTGTGTGTAGTAATAGATGTAAGTTTACACTTTGAAAGGAAATCTTGTTTCAATGTTTATTATAAAAGCCTTGCTAATTTAGTAGTGATG
CTTTCCTTGGTTGTACAGGTGTACATTTGTAAACCTTCATGCTGTAAATGGAATTTGTTTTATCTCTTTGGGATACATTTGCATTTTAGT
GTACATTTACGTCCCTGCCCTCTTTGACCTGGCAATATAGTGTTGTATAATGTAAATTTATTTCTCCAAATCGAGAGTGATTTTTTAAAA
ATTTTTTATCTTTATATGGTTTCAGAAGTATGAACCAGCTTTCTTTTTATTATTGTGAGATCATTTTGTTTTATAACATAGTTGTTGACT
GTTAATATGGACCTGCTAGAATTTGGATCACTTTCAATTGAAGTCAGGGTATTGTGCATAATAGAAAGTATTGGACTGAGATATTTGGTT
ACCATGGAGGCCAATGCTTTTTTCATCTTATTAAATGTGATGTGACTTTTTTCTTTGTACAGAAGAGTACTGTATTTTTGAATAGCCTAC
TCCCAAGTAAGAGCAAATCTGTATGATAACATTTTTTCCTCTGGACATAAGACATAACAGTAACACGATGTACATTTACAAGCGGCCTTA
TGTACATTTCCCAACAATCTTTTTAAGGCAAAATTGTGACCATATGTGTATAATTAAAATCGTTTTTAATCCTTTGCCTATGAAAATATT
TTGGAAAAAAACTTGCTGTGTATATTCAGTTTCTGAAAGATAAAGAAAGTGCTTTGTATTTTGTTGAAGTCAGTATTTTGTATAAACATT
TATGTTGACCCACTTATGTTCAGTGCTGAAAACTAAAATGAACATGCTATTCTGTCAGCTGAATATGGAAGAGATCTTTTTTTACTAGAG
ATCTGCAGAAGAAACGCAATCTTCTGAGCACAATATGGAATCTAAAGGTTTTATCACTTAGTTGTTCATATTATGAACCTAAAAATAATG
GCATAAAGTTTGGGGATGCCAGGCATACTTTTTCATGTTTGGTGTTGAGTTATTTTACTTTTCTAACCCAACATTCCTTGGTGAGACCAT
TAAATCCAAACACTTGTCACCGTTCCTTCTCATAGTCACTCTGGGTCATCAGCATGTCCCAGTCACTGCAGCAACGCCTTGTGTTTGTTT
CATTTTTTTAAAACCCACACAAAGCCGCTGTCTCACTTTTTCCTACTTTACCAACCTCAGAGTATTTCGGCCCGTATCGAACTTTTGTTC
TCAGTATCAGCCCATGGTTTCAGGATCAAAGCTGTCATGTTGGAGATTGGTAATGGCTTTCCTGTCTTTGTACAGTTGAATTCCTAGTCT
TCCTTCATCCTTGCCCTCTGTTGGCACAGGCATTATCTCTGCAATTTTAGAAAATGACAAGTAGAGAATACTACATTGAGAAACTAAACC
CTCTTCTTGGGGTCCTGATACTCATTCCCATTTGTCCCAGTGCTGACAACCCAATCTTCCCAATACTTTCAGGCCTGCTCTACAAAAGTA
CCTGTTCTTGTAGAAATTTTACAGTCTGCCATTTTGGGTGCCCACCCCAATTTTTACCTTTTAGTAAGTTGGCATGAAATTTTGGTAAAA
TCTGAAAATCACATTTCAGAATAAAACAATTGGGCAAAACTACCTAGGCTTTACTCTTGAGTGTCTCCTTTTGATAGGGATTGTTTCTGG
ACCAGTTTGTCTAAGTCCTGGCTCTTATTGGTTCATATGAAATAATGTTAACTTCACTTCTTTGTATATTATGTATAAATTAGAAAATGA


Top

FusionGenePPI for LAPTM4A_PUM2


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
LAPTM4ATUBB3, ELAVL1, NEDD4, TFRC, IGF2BP3, HNRNPU, UNK, WWP2, C16orf58, KIAA1467, MTNR1APUM2PUM2, NANOS1, AURKA, MED4, ELAVL1, DAZ1, DAZL, NANOS3, BMI1, RBFOX2, ILF2, NTRK1, SAMD1, RBM45, CLASRP, ELAVL2, CELF5, STRBP, CDX1, LITAF, TRIM25, G3BP1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with
TgenePUM2chr2:20251171chr2:20527139ENST00000403432-0211_260-61065SNAPIN


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with
TgenePUM2chr2:20251171chr2:20527139ENST00000319801--1191_26017988SNAPIN
TgenePUM2chr2:20251171chr2:20527139ENST00000338086--1201_260171065SNAPIN
TgenePUM2chr2:20251171chr2:20527139ENST00000361078--1201_260171067SNAPIN


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for LAPTM4A_PUM2


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for LAPTM4A_PUM2


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource