FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 19253

FusionGeneSummary for KRT19_EXOSC10

check button Fusion gene summary
Fusion gene informationFusion gene name: KRT19_EXOSC10
Fusion gene ID: 19253
HgeneTgene
Gene symbol

KRT19

EXOSC10

Gene ID

3880

5394

Gene namekeratin 19exosome component 10
SynonymsCK19|K19|K1CSPM-Scl|PM/Scl-100|PMSCL|PMSCL2|RRP6|Rrp6p|p2|p3|p4
Cytomap

17q21.2

1p36.22

Type of geneprotein-codingprotein-coding
Descriptionkeratin, type I cytoskeletal 1940-kDa keratin intermediate filamentCK-19cytokeratin 19keratin 19, type Ikeratin, type I, 40-kdexosome component 10P100 polymyositis-scleroderma overlap syndrome-associated autoantigenautoantigen PM-SCLpolymyositis/scleroderma autoantigen 100 kDapolymyositis/scleroderma autoantigen 2
Modification date2018052220180522
UniProtAcc

P08727

Q01780

Ensembl transtripts involved in fusion geneENST00000361566, ENST00000304457, 
ENST00000376936, ENST00000544779, 
ENST00000485606, 
Fusion gene scores* DoF score13 X 5 X 9=5857 X 7 X 4=196
# samples 149
** MAII scorelog2(14/585*10)=-2.0630097975258
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(9/196*10)=-1.12285674778553
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: KRT19 [Title/Abstract] AND EXOSC10 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotationTumor suppressor gene involved fusion gene, in-frame but not retained their domain.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneKRT19

GO:0045214

sarcomere organization

16000376


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1BG151239KRT19chr17

39680395

-EXOSC10chr1

11128096

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000361566ENST00000304457KRT19chr17

39680395

-EXOSC10chr1

11128096

-
In-frameENST00000361566ENST00000376936KRT19chr17

39680395

-EXOSC10chr1

11128096

-
5CDS-3UTRENST00000361566ENST00000544779KRT19chr17

39680395

-EXOSC10chr1

11128096

-
5CDS-intronENST00000361566ENST00000485606KRT19chr17

39680395

-EXOSC10chr1

11128096

-

Top

FusionProtFeatures for KRT19_EXOSC10


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
KRT19

P08727

EXOSC10

Q01780

Putative catalytic component of the RNA exosome complexwhich has 3'->5' exoribonuclease activity and participates in amultitude of cellular RNA processing and degradation events. Inthe nucleus, the RNA exosome complex is involved in propermaturation of stable RNA species such as rRNA, snRNA and snoRNA,in the elimination of RNA processing by-products and non-coding'pervasive' transcripts, such as antisense RNA species andpromoter-upstream transcripts (PROMPTs), and of mRNAs withprocessing defects, thereby limiting or excluding their export tothe cytoplasm. The RNA exosome may be involved in Ig class switchrecombination (CSR) and/or Ig variable region somatichypermutation (SHM) by targeting AICDA deamination activity totranscribed dsDNA substrates. In the cytoplasm, the RNA exosomecomplex is involved in general mRNA turnover and specificallydegrades inherently unstable mRNAs containing AU-rich elements(AREs) within their 3' untranslated regions, and in RNAsurveillance pathways, preventing translation of aberrant mRNAs.It seems to be involved in degradation of histone mRNA. EXOSC10has 3'-5' exonuclease activity (By similarity). EXOSC10 isrequired for nucleolar localization of C1D and probably mediatesthe association of MTREX, C1D and MPP6 wth the RNA exosomeinvolved in the maturation of 5.8S rRNA. {ECO:0000250,ECO:0000269|PubMed:14527413, ECO:0000269|PubMed:16455498,ECO:0000269|PubMed:17412707, ECO:0000269|PubMed:17545563,ECO:0000269|PubMed:18172165, ECO:0000269|PubMed:19056938,ECO:0000269|PubMed:20368444, ECO:0000269|PubMed:20699273}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-56116_133316401RegionNote=Linker 1
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-56134_225316401RegionNote=Coil 1B
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-561_79316401RegionNote=Head
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-56226_248316401RegionNote=Linker 12
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-5680_115316401RegionNote=Coil 1A

- In-frame and not-retained protein feature among the 13 regional features.
>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-5680_391316401DomainIF rod
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-56249_387316401RegionNote=Coil 2
HgeneKRT19chr17:39680395chr1:11128096ENST00000361566-56388_400316401RegionNote=Rod-like helical tail


Top

FusionGeneSequence for KRT19_EXOSC10


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_KRT19_ENST00000361566_chr17_39680395_-_EXOSC10_ENST00000304457_chr1_11128096_-_0aa

>In-frame_KRT19_ENST00000361566_chr17_39680395_-_EXOSC10_ENST00000376936_chr1_11128096_-_0aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_KRT19_ENST00000361566_chr17_39680395_-_EXOSC10_ENST00000304457_chr1_11128096_-_0nt

>In-frame_KRT19_ENST00000361566_chr17_39680395_-_EXOSC10_ENST00000376936_chr1_11128096_-_0nt


* Fusion transcript sequences (Full-length transcript).
>In-frame_KRT19_ENST00000361566_chr17_39680395_-_EXOSC10_ENST00000304457_chr1_11128096_-_1009nt
GCTCCTCCCGCGAATCGCAGCTTCTGAGACCAGGGTTGCTCCGTCCGTGCTCCGCCTCGCCATGACTTCCTACAGCTATCGCCAGTCGTC
GGCCACGTCGTCCTTCGGAGGCCTGGGCGGCGGCTCCGTGCGTTTTGGGCCGGGGGTCGCCTTTCGCGCGCCCAGCATTCACGGGGGCTC
CGGCGGCCGCGGCGTATCCGTGTCCTCCGCCCGCTTTGTGTCCTCGTCCTCCTCGGGGGCCTACGGCGGCGGCTACGGCGGCGTCCTGAC
CGCGTCCGACGGGCTGCTGGCGGGCAACGAGAAGCTAACCATGCAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGC
CCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTA
CTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCT
GGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCT
GGATGAGCTGACCCTGGCCAGGACCGACCTGGAGATGCAGATCGAAGGCCTGAAGGAAGAGCTGGCCTACCTGAAGAAGAACCATGAGGA
GGAAATCAGTACGCTGAGGGGCCAAGTGGGAGGCCAGGTCAGTGTGGAGGTGGATTCCGCTCCGGGCACCGATCTCGCCAAGATCCTGAG
TGACATGCGAAGCCAATATGAGGTCATGGCCGAGCAGAACCGGAAGGATGCTGAAGCCTGGTTCACCAGCCGGACTGAAGAATTGAACCG
GGAGGTCGCTGGCCACACGGAGCAGCTCCAGATGAGCAGGTCCGAGGTTACTGACCTGCGGCGCACCCTTCAGGGTCTTGAGATTGAGCT

>In-frame_KRT19_ENST00000361566_chr17_39680395_-_EXOSC10_ENST00000376936_chr1_11128096_-_1009nt
GCTCCTCCCGCGAATCGCAGCTTCTGAGACCAGGGTTGCTCCGTCCGTGCTCCGCCTCGCCATGACTTCCTACAGCTATCGCCAGTCGTC
GGCCACGTCGTCCTTCGGAGGCCTGGGCGGCGGCTCCGTGCGTTTTGGGCCGGGGGTCGCCTTTCGCGCGCCCAGCATTCACGGGGGCTC
CGGCGGCCGCGGCGTATCCGTGTCCTCCGCCCGCTTTGTGTCCTCGTCCTCCTCGGGGGCCTACGGCGGCGGCTACGGCGGCGTCCTGAC
CGCGTCCGACGGGCTGCTGGCGGGCAACGAGAAGCTAACCATGCAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGC
CCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTA
CTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCT
GGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCT
GGATGAGCTGACCCTGGCCAGGACCGACCTGGAGATGCAGATCGAAGGCCTGAAGGAAGAGCTGGCCTACCTGAAGAAGAACCATGAGGA
GGAAATCAGTACGCTGAGGGGCCAAGTGGGAGGCCAGGTCAGTGTGGAGGTGGATTCCGCTCCGGGCACCGATCTCGCCAAGATCCTGAG
TGACATGCGAAGCCAATATGAGGTCATGGCCGAGCAGAACCGGAAGGATGCTGAAGCCTGGTTCACCAGCCGGACTGAAGAATTGAACCG
GGAGGTCGCTGGCCACACGGAGCAGCTCCAGATGAGCAGGTCCGAGGTTACTGACCTGCGGCGCACCCTTCAGGGTCTTGAGATTGAGCT


Top

FusionGenePPI for KRT19_EXOSC10


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for KRT19_EXOSC10


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for KRT19_EXOSC10


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneKRT19C0004096Asthma1CTD_human
HgeneKRT19C0004364Autoimmune Diseases1CTD_human
HgeneKRT19C0007621Neoplastic Cell Transformation1CTD_human
HgeneKRT19C0008311Cholangitis1CTD_human
HgeneKRT19C0019189Hepatitis, Chronic1CTD_human
HgeneKRT19C0023893Liver Cirrhosis, Experimental1CTD_human
HgeneKRT19C0027626Neoplasm Invasiveness1CTD_human
HgeneKRT19C0279626Squamous cell carcinoma of esophagus1CTD_human
HgeneKRT19C1876165Copper-Overload Cirrhosis1CTD_human