FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 18474

FusionGeneSummary for KDM4C_MEIS1

check button Fusion gene summary
Fusion gene informationFusion gene name: KDM4C_MEIS1
Fusion gene ID: 18474
HgeneTgene
Gene symbol

KDM4C

MEIS1

Gene ID

23081

4211

Gene namelysine demethylase 4CMeis homeobox 1
SynonymsGASC1|JHDM3C|JMJD2C|TDRD14C-
Cytomap

9p24.1

2p14

Type of geneprotein-codingprotein-coding
Descriptionlysine-specific demethylase 4CJmjC domain-containing histone demethylation protein 3Cgene amplified in squamous cell carcinoma 1 proteinjumonji domain-containing protein 2Clysine (K)-specific demethylase 4Ctudor domain containing 14Chomeobox protein Meis1Meis1, myeloid ecotropic viral integration site 1 homologWUGSC:H_NH0444B04.1leukemogenic homolog protein
Modification date2018052320180523
UniProtAcc

Q9H3R0

O00470

Ensembl transtripts involved in fusion geneENST00000535193, ENST00000543771, 
ENST00000381306, ENST00000381309, 
ENST00000442236, ENST00000489243, 
ENST00000536108, ENST00000428870, 
ENST00000401787, 
ENST00000560281, 
ENST00000407092, ENST00000272369, 
ENST00000488550, ENST00000398506, 
ENST00000444274, ENST00000495021, 
ENST00000409517, 
Fusion gene scores* DoF score11 X 8 X 10=8803 X 3 X 2=18
# samples 123
** MAII scorelog2(12/880*10)=-2.87446911791614
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(3/18*10)=0.736965594166206
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: KDM4C [Title/Abstract] AND MEIS1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneKDM4C

GO:0006357

regulation of transcription by RNA polymerase II

17277772

HgeneKDM4C

GO:0033169

histone H3-K9 demethylation

18066052|21914792

HgeneKDM4C

GO:0070544

histone H3-K36 demethylation

21914792


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1DA081548KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000535193ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000535193ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000535193ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000535193ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000535193ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000535193ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000535193ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000535193ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
In-frameENST00000543771ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000543771ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000543771ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000543771ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000543771ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000543771ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000543771ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000543771ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
In-frameENST00000381306ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381306ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381306ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381306ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381306ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000381306ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000381306ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000381306ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
In-frameENST00000381309ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381309ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381309ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381309ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000381309ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000381309ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000381309ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000381309ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000442236ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000442236ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000442236ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000442236ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000442236ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3UTRENST00000442236ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3UTRENST00000442236ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3UTRENST00000442236ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3CDSENST00000489243ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3CDSENST00000489243ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3CDSENST00000489243ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3CDSENST00000489243ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3CDSENST00000489243ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3UTRENST00000489243ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3UTRENST00000489243ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
3UTR-3UTRENST00000489243ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000536108ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000536108ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000536108ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000536108ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3CDSENST00000536108ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3UTRENST00000536108ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3UTRENST00000536108ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5UTR-3UTRENST00000536108ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3CDSENST00000428870ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3CDSENST00000428870ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3CDSENST00000428870ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3CDSENST00000428870ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3CDSENST00000428870ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3UTRENST00000428870ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3UTRENST00000428870ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
intron-3UTRENST00000428870ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
In-frameENST00000401787ENST00000560281KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000401787ENST00000407092KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000401787ENST00000272369KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000401787ENST00000488550KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
Frame-shitENST00000401787ENST00000398506KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000401787ENST00000444274KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000401787ENST00000495021KDM4Cchr9

6793134

+MEIS1chr2

66794583

+
5CDS-3UTRENST00000401787ENST00000409517KDM4Cchr9

6793134

+MEIS1chr2

66794583

+

Top

FusionProtFeatures for KDM4C_MEIS1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
KDM4C

Q9H3R0

MEIS1

O00470

Acts as a transcriptional regulator of PAX6. Acts as atranscriptional activator of PF4 in complex with PBX1 or PBX2.Required for hematopoiesis, megakaryocyte lineage development andvascular patterning. May function as a cofactor for HOXA7 andHOXA9 in the induction of myeloid leukemias.{ECO:0000269|PubMed:12609849}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000535193+21816_5870836DomainJmjN
TgeneMEIS1chr9:6793134chr2:66794583ENST00000272369+813335_3903211109RegionRequired for transcriptional activation
TgeneMEIS1chr9:6793134chr2:66794583ENST00000398506+711335_390319464RegionRequired for transcriptional activation

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>>>>>>>>>>>>>>>>>>>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381306+221144_310481048DomainJmjC
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381306+22116_58481048DomainJmjN
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381306+221877_934481048DomainNote=Tudor 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381306+221935_991481048DomainNote=Tudor 2
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381309+222144_310481057DomainJmjC
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381309+22216_58481057DomainJmjN
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381309+222877_934481057DomainNote=Tudor 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381309+222935_991481057DomainNote=Tudor 2
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000535193+218144_31070836DomainJmjC
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000535193+218877_93470836DomainNote=Tudor 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000535193+218935_99170836DomainNote=Tudor 2
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000543771+218144_31048814DomainJmjC
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000543771+21816_5848814DomainJmjN
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000543771+218877_93448814DomainNote=Tudor 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000543771+218935_99148814DomainNote=Tudor 2
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381306+221689_747481048Zinc fingerNote=PHD-type 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381306+221752_785481048Zinc fingerC2HC pre-PHD-type
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381306+221808_865481048Zinc fingerPHD-type 2
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381309+222689_747481057Zinc fingerNote=PHD-type 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381309+222752_785481057Zinc fingerC2HC pre-PHD-type
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000381309+222808_865481057Zinc fingerPHD-type 2
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000535193+218689_74770836Zinc fingerNote=PHD-type 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000535193+218752_78570836Zinc fingerC2HC pre-PHD-type
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000535193+218808_86570836Zinc fingerPHD-type 2
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000543771+218689_74748814Zinc fingerNote=PHD-type 1
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000543771+218752_78548814Zinc fingerC2HC pre-PHD-type
HgeneKDM4Cchr9:6793134chr2:66794583ENST00000543771+218808_86548814Zinc fingerPHD-type 2
TgeneMEIS1chr9:6793134chr2:66794583ENST00000272369+813194_2403211109Compositional biasNote=Ser/Thr-rich
TgeneMEIS1chr9:6793134chr2:66794583ENST00000272369+813242_2693211109Compositional biasNote=Asp/Glu-rich (acidic)
TgeneMEIS1chr9:6793134chr2:66794583ENST00000272369+813262_2693211109Compositional biasNote=Poly-Asp
TgeneMEIS1chr9:6793134chr2:66794583ENST00000398506+711194_240319464Compositional biasNote=Ser/Thr-rich
TgeneMEIS1chr9:6793134chr2:66794583ENST00000398506+711242_269319464Compositional biasNote=Asp/Glu-rich (acidic)
TgeneMEIS1chr9:6793134chr2:66794583ENST00000398506+711262_269319464Compositional biasNote=Poly-Asp
TgeneMEIS1chr9:6793134chr2:66794583ENST00000272369+813272_3343211109DNA bindingHomeobox%3B TALE-type
TgeneMEIS1chr9:6793134chr2:66794583ENST00000398506+711272_334319464DNA bindingHomeobox%3B TALE-type


Top

FusionGeneSequence for KDM4C_MEIS1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_KDM4C_ENST00000535193_chr9_6793134_+_MEIS1_ENST00000560281_chr2_66794583_+_1380nt
ATGGCTGACATGATGGTCTGTGACCTGAAAGTTGTTGAATAGTTGGAGTGTTCTGCATTCATGTGGAAGAGGCTAAAGGATGTTTGATGA
AGCACTATGGGCTGCCCTGGAAGAGGACTGAAGAAGCAGCTGCAGACACTGCCCTAACCATCATGGAGGTGGCCGAGGTGGAAAGTCCTC
TGAACCCCAGCTGTAAGATAATGACCTTCAGACCCTCCATGGAGGAGTTCCGGGAGTTCAACAAATACCTTGCATACATGGAGTCTAAAG
GAGCCCATCGTGCGGGTCTTGCAAAGGTTTATTAATGCCCGGAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGGCAAG
TCCCCCATAGTGACTGTATTCAAGTCACGCAAGCGAAAACCATCCTCAAGCCATTCACCGGGAGGTCCGCTACCTGGTAAATAAACTGGG
AGTGAGTATAGGAACGCCTGGCAATTAAAATTAAACCAGTTTCGTTTCATAACAACACTAATCAATTTAACATCATTATAAAACGTTTGG
AGAAGGTGGAAAAAAAAAGCCAACAGAGAAAAGTAACTCTTAAATAATATGCTCAGTTACAATATTCTTTGTACACATTCAATATATTAA
TGTTATTTTTTTTCTGAGTTTGCCTTCCCAGCTCTTTCTGCTACTATGACCACTCCCTGGTGCATGGCTTGGTGTGGAATTGCTGTAAAC
TTTATTACCTGTCAAAAGGGCAAAGGGGTCAGGATTGCTTGTGGGACTCAGTAAAGTTCAAAGACATTCAATGAGGTAGAGCTTTTGTGT
GCTTTAATAACCCAAGGCAGCTTACTTCTGAAGCAGCTTTTCATGTACAGTTAAAACACGGGATTCAGGTAGTGGTATAAATACATGGTT
CTTATTTCTCAGACCTTCTCTTGTTAATATCCATCTTCTGGTGTTCGACTTTTTTTTTTTTTAATAACAGTCTTTTTGTTTTGTTTTTAA
ATTATGAGCTTAAAATGGCGATACTTCTATGGGATCCTGGCTTGTGGATCTAAAAATCCAAGAAACATCTCTCTAGGATTTGTTTTTGCA
TTATAATATGCCAGTAAGATAACAAGAGTATTTGCTAGGGGTGATGTGAGTCTTTACTTTCTTTATGAAATACTCTCTCATCTCTTAGGG
AGCACTATGGAAAACTATGTTAGCATCGCATTGAGGCAACACACATTTACTCCTGTAACTTTTTTTCTTCCAACACCCATTATGTGGTCA
CCAGACAAAACCCAAGCAGAAAGTTTCCACACCTTAACTGTTCCCTCTTTGAGCTAGATGTTTTAAAAACTCAGTCACAGAGGTGTGTAG

>In-frame_KDM4C_ENST00000543771_chr9_6793134_+_MEIS1_ENST00000560281_chr2_66794583_+_1808nt
GCCATAGGTGCGCGTCGGCGCCCAGGAGGACGTGTGGCGCGTGGACTACATCAGGTCCAGCCCTGCGGGACCCCAGCCAGCGCTTCCGGG
CAAGGTTCTGTGCACCTGTTTTCTCCTTCTACGCGAGTATCTTTCCCCTCCGGAAAGAATGGGATATGCCTGTGTCCAAAGGACAAGAAG
ATGCGCGCCAGCAAGCCTAAGTTAACCACAGCGCGGAAGTTGAGCCCAAAGCAAGAGCGTGCCGGGCACCTTTAAGCTGTTTGTAAGCCC
ACGTGACTCACCAAGTGCGGGCCCCAGCGGTCACGTGACGGCGCGCGCGCCCTCGCGCAGGGAGAGCCGGCGGTGCGCGCGCCTTCGCCG
CTGCCTCCCACCCACCCCCTCGACGGGAGGGTGAGGCGCGGCGCAGTGATCGGGCGGCCGGGGTCCTGTGCGCGTGCGCAGCGAACAGCT
GTCACCTAGTGCGGAACAAGTCTCCCAAATTTCCCAAATCTCCCTGGGCCGGAGGCCACTGTCTTCTCTTCCTCCTCCACCGAGTCGTGC
TCTCGCCCCAACCCGCGCGCCAGACACTGCCCTAACCATCATGGAGGTGGCCGAGGTGGAAAGTCCTCTGAACCCCAGCTGTAAGATAAT
GACCTTCAGACCCTCCATGGAGGAGTTCCGGGAGTTCAACAAATACCTTGCATACATGGAGTCTAAAGGAGCCCATCGTGCGGGTCTTGC
AAAGGTTTATTAATGCCCGGAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGGCAAGTCCCCCATAGTGACTGTATTCA
AGTCACGCAAGCGAAAACCATCCTCAAGCCATTCACCGGGAGGTCCGCTACCTGGTAAATAAACTGGGAGTGAGTATAGGAACGCCTGGC
AATTAAAATTAAACCAGTTTCGTTTCATAACAACACTAATCAATTTAACATCATTATAAAACGTTTGGAGAAGGTGGAAAAAAAAAGCCA
ACAGAGAAAAGTAACTCTTAAATAATATGCTCAGTTACAATATTCTTTGTACACATTCAATATATTAATGTTATTTTTTTTCTGAGTTTG
CCTTCCCAGCTCTTTCTGCTACTATGACCACTCCCTGGTGCATGGCTTGGTGTGGAATTGCTGTAAACTTTATTACCTGTCAAAAGGGCA
AAGGGGTCAGGATTGCTTGTGGGACTCAGTAAAGTTCAAAGACATTCAATGAGGTAGAGCTTTTGTGTGCTTTAATAACCCAAGGCAGCT
TACTTCTGAAGCAGCTTTTCATGTACAGTTAAAACACGGGATTCAGGTAGTGGTATAAATACATGGTTCTTATTTCTCAGACCTTCTCTT
GTTAATATCCATCTTCTGGTGTTCGACTTTTTTTTTTTTTAATAACAGTCTTTTTGTTTTGTTTTTAAATTATGAGCTTAAAATGGCGAT
ACTTCTATGGGATCCTGGCTTGTGGATCTAAAAATCCAAGAAACATCTCTCTAGGATTTGTTTTTGCATTATAATATGCCAGTAAGATAA
CAAGAGTATTTGCTAGGGGTGATGTGAGTCTTTACTTTCTTTATGAAATACTCTCTCATCTCTTAGGGAGCACTATGGAAAACTATGTTA
GCATCGCATTGAGGCAACACACATTTACTCCTGTAACTTTTTTTCTTCCAACACCCATTATGTGGTCACCAGACAAAACCCAAGCAGAAA
GTTTCCACACCTTAACTGTTCCCTCTTTGAGCTAGATGTTTTAAAAACTCAGTCACAGAGGTGTGTAGATCTAGTCTGAGAGAAATTTCA

>In-frame_KDM4C_ENST00000381306_chr9_6793134_+_MEIS1_ENST00000560281_chr2_66794583_+_1793nt
CGGCGCCCAGGAGGACGTGTGGCGCGTGGACTACATCAGGTCCAGCCCTGCGGGACCCCAGCCAGCGCTTCCGGGCAAGGTTCTGTGCAC
CTGTTTTCTCCTTCTACGCGAGTATCTTTCCCCTCCGGAAAGAATGGGATATGCCTGTGTCCAAAGGACAAGAAGATGCGCGCCAGCAAG
CCTAAGTTAACCACAGCGCGGAAGTTGAGCCCAAAGCAAGAGCGTGCCGGGCACCTTTAAGCTGTTTGTAAGCCCACGTGACTCACCAAG
TGCGGGCCCCAGCGGTCACGTGACGGCGCGCGCGCCCTCGCGCAGGGAGAGCCGGCGGTGCGCGCGCCTTCGCCGCTGCCTCCCACCCAC
CCCCTCGACGGGAGGGTGAGGCGCGGCGCAGTGATCGGGCGGCCGGGGTCCTGTGCGCGTGCGCAGCGAACAGCTGTCACCTAGTGCGGA
ACAAGTCTCCCAAATTTCCCAAATCTCCCTGGGCCGGAGGCCACTGTCTTCTCTTCCTCCTCCACCGAGTCGTGCTCTCGCCCCAACCCG
CGCGCCAGACACTGCCCTAACCATCATGGAGGTGGCCGAGGTGGAAAGTCCTCTGAACCCCAGCTGTAAGATAATGACCTTCAGACCCTC
CATGGAGGAGTTCCGGGAGTTCAACAAATACCTTGCATACATGGAGTCTAAAGGAGCCCATCGTGCGGGTCTTGCAAAGGTTTATTAATG
CCCGGAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGGCAAGTCCCCCATAGTGACTGTATTCAAGTCACGCAAGCGAA
AACCATCCTCAAGCCATTCACCGGGAGGTCCGCTACCTGGTAAATAAACTGGGAGTGAGTATAGGAACGCCTGGCAATTAAAATTAAACC
AGTTTCGTTTCATAACAACACTAATCAATTTAACATCATTATAAAACGTTTGGAGAAGGTGGAAAAAAAAAGCCAACAGAGAAAAGTAAC
TCTTAAATAATATGCTCAGTTACAATATTCTTTGTACACATTCAATATATTAATGTTATTTTTTTTCTGAGTTTGCCTTCCCAGCTCTTT
CTGCTACTATGACCACTCCCTGGTGCATGGCTTGGTGTGGAATTGCTGTAAACTTTATTACCTGTCAAAAGGGCAAAGGGGTCAGGATTG
CTTGTGGGACTCAGTAAAGTTCAAAGACATTCAATGAGGTAGAGCTTTTGTGTGCTTTAATAACCCAAGGCAGCTTACTTCTGAAGCAGC
TTTTCATGTACAGTTAAAACACGGGATTCAGGTAGTGGTATAAATACATGGTTCTTATTTCTCAGACCTTCTCTTGTTAATATCCATCTT
CTGGTGTTCGACTTTTTTTTTTTTTAATAACAGTCTTTTTGTTTTGTTTTTAAATTATGAGCTTAAAATGGCGATACTTCTATGGGATCC
TGGCTTGTGGATCTAAAAATCCAAGAAACATCTCTCTAGGATTTGTTTTTGCATTATAATATGCCAGTAAGATAACAAGAGTATTTGCTA
GGGGTGATGTGAGTCTTTACTTTCTTTATGAAATACTCTCTCATCTCTTAGGGAGCACTATGGAAAACTATGTTAGCATCGCATTGAGGC
AACACACATTTACTCCTGTAACTTTTTTTCTTCCAACACCCATTATGTGGTCACCAGACAAAACCCAAGCAGAAAGTTTCCACACCTTAA

>In-frame_KDM4C_ENST00000381309_chr9_6793134_+_MEIS1_ENST00000560281_chr2_66794583_+_1793nt
CGGCGCCCAGGAGGACGTGTGGCGCGTGGACTACATCAGGTCCAGCCCTGCGGGACCCCAGCCAGCGCTTCCGGGCAAGGTTCTGTGCAC
CTGTTTTCTCCTTCTACGCGAGTATCTTTCCCCTCCGGAAAGAATGGGATATGCCTGTGTCCAAAGGACAAGAAGATGCGCGCCAGCAAG
CCTAAGTTAACCACAGCGCGGAAGTTGAGCCCAAAGCAAGAGCGTGCCGGGCACCTTTAAGCTGTTTGTAAGCCCACGTGACTCACCAAG
TGCGGGCCCCAGCGGTCACGTGACGGCGCGCGCGCCCTCGCGCAGGGAGAGCCGGCGGTGCGCGCGCCTTCGCCGCTGCCTCCCACCCAC
CCCCTCGACGGGAGGGTGAGGCGCGGCGCAGTGATCGGGCGGCCGGGGTCCTGTGCGCGTGCGCAGCGAACAGCTGTCACCTAGTGCGGA
ACAAGTCTCCCAAATTTCCCAAATCTCCCTGGGCCGGAGGCCACTGTCTTCTCTTCCTCCTCCACCGAGTCGTGCTCTCGCCCCAACCCG
CGCGCCAGACACTGCCCTAACCATCATGGAGGTGGCCGAGGTGGAAAGTCCTCTGAACCCCAGCTGTAAGATAATGACCTTCAGACCCTC
CATGGAGGAGTTCCGGGAGTTCAACAAATACCTTGCATACATGGAGTCTAAAGGAGCCCATCGTGCGGGTCTTGCAAAGGTTTATTAATG
CCCGGAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGGCAAGTCCCCCATAGTGACTGTATTCAAGTCACGCAAGCGAA
AACCATCCTCAAGCCATTCACCGGGAGGTCCGCTACCTGGTAAATAAACTGGGAGTGAGTATAGGAACGCCTGGCAATTAAAATTAAACC
AGTTTCGTTTCATAACAACACTAATCAATTTAACATCATTATAAAACGTTTGGAGAAGGTGGAAAAAAAAAGCCAACAGAGAAAAGTAAC
TCTTAAATAATATGCTCAGTTACAATATTCTTTGTACACATTCAATATATTAATGTTATTTTTTTTCTGAGTTTGCCTTCCCAGCTCTTT
CTGCTACTATGACCACTCCCTGGTGCATGGCTTGGTGTGGAATTGCTGTAAACTTTATTACCTGTCAAAAGGGCAAAGGGGTCAGGATTG
CTTGTGGGACTCAGTAAAGTTCAAAGACATTCAATGAGGTAGAGCTTTTGTGTGCTTTAATAACCCAAGGCAGCTTACTTCTGAAGCAGC
TTTTCATGTACAGTTAAAACACGGGATTCAGGTAGTGGTATAAATACATGGTTCTTATTTCTCAGACCTTCTCTTGTTAATATCCATCTT
CTGGTGTTCGACTTTTTTTTTTTTTAATAACAGTCTTTTTGTTTTGTTTTTAAATTATGAGCTTAAAATGGCGATACTTCTATGGGATCC
TGGCTTGTGGATCTAAAAATCCAAGAAACATCTCTCTAGGATTTGTTTTTGCATTATAATATGCCAGTAAGATAACAAGAGTATTTGCTA
GGGGTGATGTGAGTCTTTACTTTCTTTATGAAATACTCTCTCATCTCTTAGGGAGCACTATGGAAAACTATGTTAGCATCGCATTGAGGC
AACACACATTTACTCCTGTAACTTTTTTTCTTCCAACACCCATTATGTGGTCACCAGACAAAACCCAAGCAGAAAGTTTCCACACCTTAA

>In-frame_KDM4C_ENST00000401787_chr9_6793134_+_MEIS1_ENST00000560281_chr2_66794583_+_1795nt
GTCGGCGCCCAGGAGGACGTGTGGCGCGTGGACTACATCAGGTCCAGCCCTGCGGGACCCCAGCCAGCGCTTCCGGGCAAGGTTCTGTGC
ACCTGTTTTCTCCTTCTACGCGAGTATCTTTCCCCTCCGGAAAGAATGGGATATGCCTGTGTCCAAAGGACAAGAAGATGCGCGCCAGCA
AGCCTAAGTTAACCACAGCGCGGAAGTTGAGCCCAAAGCAAGAGCGTGCCGGGCACCTTTAAGCTGTTTGTAAGCCCACGTGACTCACCA
AGTGCGGGCCCCAGCGGTCACGTGACGGCGCGCGCGCCCTCGCGCAGGGAGAGCCGGCGGTGCGCGCGCCTTCGCCGCTGCCTCCCACCC
ACCCCCTCGACGGGAGGGTGAGGCGCGGCGCAGTGATCGGGCGGCCGGGGTCCTGTGCGCGTGCGCAGCGAACAGCTGTCACCTAGTGCG
GAACAAGTCTCCCAAATTTCCCAAATCTCCCTGGGCCGGAGGCCACTGTCTTCTCTTCCTCCTCCACCGAGTCGTGCTCTCGCCCCAACC
CGCGCGCCAGACACTGCCCTAACCATCATGGAGGTGGCCGAGGTGGAAAGTCCTCTGAACCCCAGCTGTAAGATAATGACCTTCAGACCC
TCCATGGAGGAGTTCCGGGAGTTCAACAAATACCTTGCATACATGGAGTCTAAAGGAGCCCATCGTGCGGGTCTTGCAAAGGTTTATTAA
TGCCCGGAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGGCAAGTCCCCCATAGTGACTGTATTCAAGTCACGCAAGCG
AAAACCATCCTCAAGCCATTCACCGGGAGGTCCGCTACCTGGTAAATAAACTGGGAGTGAGTATAGGAACGCCTGGCAATTAAAATTAAA
CCAGTTTCGTTTCATAACAACACTAATCAATTTAACATCATTATAAAACGTTTGGAGAAGGTGGAAAAAAAAAGCCAACAGAGAAAAGTA
ACTCTTAAATAATATGCTCAGTTACAATATTCTTTGTACACATTCAATATATTAATGTTATTTTTTTTCTGAGTTTGCCTTCCCAGCTCT
TTCTGCTACTATGACCACTCCCTGGTGCATGGCTTGGTGTGGAATTGCTGTAAACTTTATTACCTGTCAAAAGGGCAAAGGGGTCAGGAT
TGCTTGTGGGACTCAGTAAAGTTCAAAGACATTCAATGAGGTAGAGCTTTTGTGTGCTTTAATAACCCAAGGCAGCTTACTTCTGAAGCA
GCTTTTCATGTACAGTTAAAACACGGGATTCAGGTAGTGGTATAAATACATGGTTCTTATTTCTCAGACCTTCTCTTGTTAATATCCATC
TTCTGGTGTTCGACTTTTTTTTTTTTTAATAACAGTCTTTTTGTTTTGTTTTTAAATTATGAGCTTAAAATGGCGATACTTCTATGGGAT
CCTGGCTTGTGGATCTAAAAATCCAAGAAACATCTCTCTAGGATTTGTTTTTGCATTATAATATGCCAGTAAGATAACAAGAGTATTTGC
TAGGGGTGATGTGAGTCTTTACTTTCTTTATGAAATACTCTCTCATCTCTTAGGGAGCACTATGGAAAACTATGTTAGCATCGCATTGAG
GCAACACACATTTACTCCTGTAACTTTTTTTCTTCCAACACCCATTATGTGGTCACCAGACAAAACCCAAGCAGAAAGTTTCCACACCTT


Top

FusionGenePPI for KDM4C_MEIS1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
KDM4CKDM4A, KDM4C, HIST1H3A, H3F3A, PPARG, HDAC1, HDAC3, HIST2H3C, SHMT2, MOV10, NXF1, TRIM25MEIS1HOXA9, PBX1, HOXD9, EMX2, TLX2, HOXC11, CREB1, CRTC1, CREBBP, ETS1, TRMT10B, SHMT2, LMX1B, MAB21L1, MEIS2, MAB21L2, FOXC1, FAM222A, C16orf71, CCDC120, C5orf24, COL20A1


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with
TgeneMEIS1chr9:6793134chr2:66794583ENST00000272369+813299_3293211109DNA
TgeneMEIS1chr9:6793134chr2:66794583ENST00000398506+711299_329319464DNA


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for KDM4C_MEIS1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for KDM4C_MEIS1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneKDM4CC0025149Medulloblastoma1CTD_human
HgeneKDM4CC0236663Alcohol withdrawal syndrome1PSYGENET
TgeneMEIS1C0035258Restless Legs Syndrome1CTD_human
TgeneMEIS1C1458155Mammary Neoplasms1CTD_human