|
Fusion gene ID: 17736 |
FusionGeneSummary for IRF7_CARS2 |
Fusion gene summary |
Fusion gene information | Fusion gene name: IRF7_CARS2 | Fusion gene ID: 17736 | Hgene | Tgene | Gene symbol | IRF7 | CARS2 | Gene ID | 3665 | 79587 |
Gene name | interferon regulatory factor 7 | cysteinyl-tRNA synthetase 2, mitochondrial | |
Synonyms | IMD39|IRF-7H|IRF7A|IRF7B|IRF7C|IRF7H | COXPD27|cysRS | |
Cytomap | 11p15.5 | 13q34 | |
Type of gene | protein-coding | protein-coding | |
Description | interferon regulatory factor 7IRF-7interferon regulatory factor 7G isoforminterferon regulatory factor-7H | probable cysteine--tRNA ligase, mitochondrialcysteine tRNA ligase 2, mitochondrial (putative)cysteinyl-tRNA synthetase 2, mitochondrial (putative) | |
Modification date | 20180519 | 20180523 | |
UniProtAcc | Q92985 | Q9HA77 | |
Ensembl transtripts involved in fusion gene | ENST00000525445, ENST00000348655, ENST00000397566, ENST00000397570, ENST00000397574, ENST00000397562, ENST00000330243, | ENST00000257347, ENST00000535398, | |
Fusion gene scores | * DoF score | 2 X 2 X 2=8 | 2 X 2 X 1=4 |
# samples | 2 | 2 | |
** MAII score | log2(2/8*10)=1.32192809488736 | log2(2/4*10)=2.32192809488736 | |
Context | PubMed: IRF7 [Title/Abstract] AND CARS2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Functional or gene categories assigned by FusionGDB annotation |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | IRF7 | GO:0002819 | regulation of adaptive immune response | 17404045 |
Hgene | IRF7 | GO:0032727 | positive regulation of interferon-alpha production | 16127453 |
Hgene | IRF7 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 16127453|17404045 |
Hgene | IRF7 | GO:0051607 | defense response to virus | 21478870 |
Fusion gene information from three resources (ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018)) * All genome coordinats were lifted-over on hg19. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
Data type | Source | Cancer type | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
ChiTaRS3.1 | BE843753 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
* LD: Li Ding group's fusion gene list RV: Roel Verhaak group's fusion gene list ChiTaRs fusion database |
Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
ORF | Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
Frame-shift | ENST00000525445 | ENST00000257347 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5CDS-intron | ENST00000525445 | ENST00000535398 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
Frame-shift | ENST00000348655 | ENST00000257347 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5CDS-intron | ENST00000348655 | ENST00000535398 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
Frame-shift | ENST00000397566 | ENST00000257347 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5CDS-intron | ENST00000397566 | ENST00000535398 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
In-frame | ENST00000397570 | ENST00000257347 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5CDS-intron | ENST00000397570 | ENST00000535398 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
In-frame | ENST00000397574 | ENST00000257347 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5CDS-intron | ENST00000397574 | ENST00000535398 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5UTR-3CDS | ENST00000397562 | ENST00000257347 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5UTR-intron | ENST00000397562 | ENST00000535398 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
In-frame | ENST00000330243 | ENST00000257347 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
5CDS-intron | ENST00000330243 | ENST00000535398 | IRF7 | chr11 | 614478 | - | CARS2 | chr13 | 111293936 | - |
Top |
FusionProtFeatures for IRF7_CARS2 |
Main function of each fusion partner protein. (from UniProt) |
Hgene | Tgene |
IRF7 | CARS2 |
Key transcriptional regulator of type I interferon(IFN)-dependent immune responses and plays a critical role in theinnate immune response against DNA and RNA viruses. Regulates thetranscription of type I IFN genes (IFN-alpha and IFN-beta) andIFN-stimulated genes (ISG) by binding to an interferon-stimulatedresponse element (ISRE) in their promoters. Can efficientlyactivate both the IFN-beta (IFNB) and the IFN-alpha (IFNA) genesand mediate their induction via both the virus-activated, MyD88-independent pathway and the TLR-activated, MyD88-dependentpathway. Required during both the early and late phases of the IFNgene induction but is more critical for the late than for theearly phase. Exists in an inactive form in the cytoplasm ofuninfected cells and following viral infection, double-strandedRNA (dsRNA), or toll-like receptor (TLR) signaling, becomesphosphorylated by IKBKE and TBK1 kinases. This induces aconformational change, leading to its dimerization and nuclearlocalization where along with other coactivators it can activatetranscription of the type I IFN and ISG genes. Can also play arole in regulating adaptive immune responses by inducingPSMB9/LMP2 expression, either directly or through induction ofIRF1. Binds to the Q promoter (Qp) of EBV nuclear antigen 1 a(EBNA1) and may play a role in the regulation of EBV latency. Canactivate distinct gene expression programs in macrophages andregulate the anti-tumor properties of primary macrophages.{ECO:0000269|PubMed:11073981, ECO:0000269|PubMed:12374802,ECO:0000269|PubMed:15361868, ECO:0000269|PubMed:17404045}. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at . * Minus value of BPloci means that the break pointn is located before the CDS. |
- In-frame and retained protein feature among the 13 regional features. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
- In-frame and not-retained protein feature among the 13 regional features. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Top |
FusionGeneSequence for IRF7_CARS2 |
For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences. (nt: nucleotides, aa: amino acids) |
* Fusion amino acid sequences. |
>In-frame_IRF7_ENST00000397570_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_0aa >In-frame_IRF7_ENST00000397574_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_0aa >In-frame_IRF7_ENST00000330243_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_0aa |
* Fusion transcript sequences (only coding sequence (CDS) region). |
>In-frame_IRF7_ENST00000397570_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_0nt >In-frame_IRF7_ENST00000397574_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_0nt >In-frame_IRF7_ENST00000330243_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_0nt |
* Fusion transcript sequences (Full-length transcript). |
>In-frame_IRF7_ENST00000397570_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_823nt GAAACTCCCGCCTGGCCACCATAAAAGCGCCGGCCCTCCGCTTCCCCGCGAGACGAAACTTCCCGTCCCGGCGGCTCTGGCACCCAGGGT CCGGCCTGCGCCTTCCCGCCAGGCCTGGACACTGGTTCAACACCTGTGACTTCATGTGTGCGCGCCGGCCACACCTGCAGTCACACCTGT AGCCCCCTCTGCCAAGAGATCCATACCGAGGCAGCGTCGGTGGCTACAAGCCCTCAGTCCACACCTGTGGACACCTGTGACACCTGGCCA CACGACCTGTGGCCGCGGCCTGGCGTCTGCTGCGACAGGAGCCCTTACCTCCCCTGTTATAACACCTGACCGCCACCTAACTGCCCCTGC AGAAGGAGCAATGGCCTTGGCTCCTGAGAGGGCAGCCCCACGCGTGCTGTTCGGAGAGTGGCTCCTTGGAGAGATCAGCAGCGGCTGCTA TGAGGGGCTGCAGTGGCTGGACGAGGCCCGCACCTGTTTCCGCGTGCCCTGGAAGCACTTCGCGCGCAAGGACCTGAGCGAGGCCGACGC GCGCATCTTCAAGGCCTGGGCTGTGGCCCGCGGCAGGTGGCCGCCTAGCAGCAGGGGAGGTGGCCCGCCCCCCGAGGCTGAGACTGCGGA GCGCGCCGGCTGGAAAACCAACTTCCGCTGCGCACTGCGCAGCACGCGTCGCTTCGTGATGCTGCGGGATAACTCGGGGGACCCGGCCGA CCCGCACAAGGTGTACGCGCTCAGCCGGGAGCTGTGCTGGCGAGAAGGCCCAGGCACGGACCAGACTGAGGCAGAGGCCCCCGCAGCTGT >In-frame_IRF7_ENST00000397574_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_823nt GAAACTCCCGCCTGGCCACCATAAAAGCGCCGGCCCTCCGCTTCCCCGCGAGACGAAACTTCCCGTCCCGGCGGCTCTGGCACCCAGGGT CCGGCCTGCGCCTTCCCGCCAGGCCTGGACACTGGTTCAACACCTGTGACTTCATGTGTGCGCGCCGGCCACACCTGCAGTCACACCTGT AGCCCCCTCTGCCAAGAGATCCATACCGAGGCAGCGTCGGTGGCTACAAGCCCTCAGTCCACACCTGTGGACACCTGTGACACCTGGCCA CACGACCTGTGGCCGCGGCCTGGCGTCTGCTGCGACAGGAGCCCTTACCTCCCCTGTTATAACACCTGACCGCCACCTAACTGCCCCTGC AGAAGGAGCAATGGCCTTGGCTCCTGAGAGGGCAGCCCCACGCGTGCTGTTCGGAGAGTGGCTCCTTGGAGAGATCAGCAGCGGCTGCTA TGAGGGGCTGCAGTGGCTGGACGAGGCCCGCACCTGTTTCCGCGTGCCCTGGAAGCACTTCGCGCGCAAGGACCTGAGCGAGGCCGACGC GCGCATCTTCAAGGCCTGGGCTGTGGCCCGCGGCAGGTGGCCGCCTAGCAGCAGGGGAGGTGGCCCGCCCCCCGAGGCTGAGACTGCGGA GCGCGCCGGCTGGAAAACCAACTTCCGCTGCGCACTGCGCAGCACGCGTCGCTTCGTGATGCTGCGGGATAACTCGGGGGACCCGGCCGA CCCGCACAAGGTGTACGCGCTCAGCCGGGAGCTGTGCTGGCGAGAAGGCCCAGGCACGGACCAGACTGAGGCAGAGGCCCCCGCAGCTGT >In-frame_IRF7_ENST00000330243_chr11_614478_-_CARS2_ENST00000257347_chr13_111293936_-_879nt CCGGCCCTCCGCTTCCCCGCGAGACGAAACTTCCCGTCCCGGCGGCTCTGGCACCCAGGGTCCGGCCTGCGCCTTCCCGCCAGGCCTGGA CACTGGTTCAACACCTGTGACTTCATGTGTGCGCGCCGGCCACACCTGCAGTCACACCTGTAGCCCCCTCTGCCAAGAGATCCATACCGA GGCAGCGTCGGTGGCTACAAGCCCTCAGTCCACACCTGTGGACACCTGTGACACCTGGCCACACGACCTGTGGCCGCGGCCTGGCGTCTG CTGCGACAGGAGCCCTTACCTCCCCTGTTATAACACCTGACCGCCACCTAACTGCCCCTGCAGAAGGAGCAATGGCCTTGGCTCCTGAGA GGTAAGAGCCCGGCCCACCCTCTCCAGATGCCAGTCCCCGAGCGCCCTGCAGCCGGCCCTGACTCTCCGCGGCCGGGCACCCGCAGGGCA GCCCCACGCGTGCTGTTCGGAGAGTGGCTCCTTGGAGAGATCAGCAGCGGCTGCTATGAGGGGCTGCAGTGGCTGGACGAGGCCCGCACC TGTTTCCGCGTGCCCTGGAAGCACTTCGCGCGCAAGGACCTGAGCGAGGCCGACGCGCGCATCTTCAAGGCCTGGGCTGTGGCCCGCGGC AGGTGGCCGCCTAGCAGCAGGGGAGGTGGCCCGCCCCCCGAGGCTGAGACTGCGGAGCGCGCCGGCTGGAAAACCAACTTCCGCTGCGCA CTGCGCAGCACGCGTCGCTTCGTGATGCTGCGGGATAACTCGGGGGACCCGGCCGACCCGCACAAGGTGTACGCGCTCAGCCGGGAGCTG |
Top |
FusionGenePPI for IRF7_CARS2 |
Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in . |
Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160) |
Hgene | Hgene's interactors | Tgene | Tgene's interactors |
- Retained PPIs in in-frame fusion. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Still interaction with |
- Lost PPIs in in-frame fusion. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Interaction lost with |
- Retained PPIs, but lost function due to frame-shift fusion. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Interaction lost with |
Top |
RelatedDrugs for IRF7_CARS2 |
Drugs targeting genes involved in this fusion gene. (DrugBank Version 5.1.0 2018-04-02) |
Partner | Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for IRF7_CARS2 |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | IRF7 | C0021368 | Inflammation | 1 | CTD_human |
Hgene | IRF7 | C0021400 | Influenza | 1 | CTD_human |
Hgene | IRF7 | C0041696 | Unipolar Depression | 1 | PSYGENET |
Hgene | IRF7 | C1269683 | Major Depressive Disorder | 1 | PSYGENET |
Hgene | IRF7 | C4225358 | IMMUNODEFICIENCY 39 | 1 | UNIPROT |
Tgene | CARS2 | C4225251 | COMBINED OXIDATIVE PHOSPHORYLATION DEFICIENCY 27 | 1 | UNIPROT |