FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 14752

FusionGeneSummary for GLT8D1_PLXNB1

check button Fusion gene summary
Fusion gene informationFusion gene name: GLT8D1_PLXNB1
Fusion gene ID: 14752
HgeneTgene
Gene symbol

GLT8D1

PLXNB1

Gene ID

55830

5364

Gene nameglycosyltransferase 8 domain containing 1plexin B1
SynonymsAD-017|MSTP139PLEXIN-B1|PLXN5|SEP
Cytomap

3p21.1

3p21.31

Type of geneprotein-codingprotein-coding
Descriptionglycosyltransferase 8 domain-containing protein 1glycosyltransferase AD-017plexin-B1plexin 5semaphorin receptor SEP
Modification date2018052620180523
UniProtAcc

Q68CQ7

O43157

Ensembl transtripts involved in fusion geneENST00000478968, ENST00000394783, 
ENST00000407584, ENST00000266014, 
ENST00000491606, ENST00000463827, 
ENST00000296440, ENST00000358459, 
ENST00000358536, ENST00000448774, 
ENST00000456774, ENST00000465117, 
Fusion gene scores* DoF score1 X 1 X 1=16 X 6 X 3=108
# samples 15
** MAII scorelog2(1/1*10)=3.32192809488736log2(5/108*10)=-1.11103131238874
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Context

PubMed: GLT8D1 [Title/Abstract] AND PLXNB1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgenePLXNB1

GO:0007162

negative regulation of cell adhesion

15218527

TgenePLXNB1

GO:0008360

regulation of cell shape

19843518

TgenePLXNB1

GO:0051493

regulation of cytoskeleton organization

19843518

TgenePLXNB1

GO:0071526

semaphorin-plexin signaling pathway

15218527|19843518


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
TCGARVMESOTCGA-UD-AABY-01AGLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
In-frameENST00000478968ENST00000296440GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000478968ENST00000358459GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000478968ENST00000358536GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000478968ENST00000448774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000478968ENST00000456774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5CDS-intronENST00000478968ENST00000465117GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000394783ENST00000296440GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000394783ENST00000358459GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000394783ENST00000358536GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000394783ENST00000448774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000394783ENST00000456774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5CDS-intronENST00000394783ENST00000465117GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000407584ENST00000296440GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000407584ENST00000358459GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000407584ENST00000358536GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000407584ENST00000448774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000407584ENST00000456774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5CDS-intronENST00000407584ENST00000465117GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000266014ENST00000296440GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000266014ENST00000358459GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000266014ENST00000358536GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000266014ENST00000448774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000266014ENST00000456774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5CDS-intronENST00000266014ENST00000465117GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000491606ENST00000296440GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000491606ENST00000358459GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
In-frameENST00000491606ENST00000358536GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000491606ENST00000448774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
Frame-shitENST00000491606ENST00000456774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5CDS-intronENST00000491606ENST00000465117GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5UTR-3CDSENST00000463827ENST00000296440GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5UTR-3CDSENST00000463827ENST00000358459GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5UTR-3CDSENST00000463827ENST00000358536GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5UTR-3CDSENST00000463827ENST00000448774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5UTR-3CDSENST00000463827ENST00000456774GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-
5UTR-intronENST00000463827ENST00000465117GLT8D1chr3

52729206

-PLXNB1chr3

48445997

-

Top

FusionProtFeatures for GLT8D1_PLXNB1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
GLT8D1

Q68CQ7

PLXNB1

O43157

Receptor for SEMA4D. Plays a role in RHOA activation andsubsequent changes of the actin cytoskeleton. Plays a role in axonguidance, invasive growth and cell migration.{ECO:0000269|PubMed:12196628, ECO:0000269|PubMed:12198496,ECO:0000269|PubMed:15210733, ECO:0000269|PubMed:19843518,ECO:0000269|PubMed:20877282, ECO:0000269|PubMed:21912513}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000266014-9101_7308372Topological domainCytoplasmic
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000394783-9101_7308372Topological domainCytoplasmic
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000407584-10111_7308372Topological domainCytoplasmic
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000478968-10111_7308372Topological domainCytoplasmic
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000491606-9101_7308372Topological domainCytoplasmic
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000266014-9108_28308372TransmembraneHelical%3B Signal-anchor for type II membrane protein
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000394783-9108_28308372TransmembraneHelical%3B Signal-anchor for type II membrane protein
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000407584-10118_28308372TransmembraneHelical%3B Signal-anchor for type II membrane protein
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000478968-10118_28308372TransmembraneHelical%3B Signal-anchor for type II membrane protein
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000491606-9108_28308372TransmembraneHelical%3B Signal-anchor for type II membrane protein

- In-frame and not-retained protein feature among the 13 regional features.
>>>>>
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000266014-91029_371308372Topological domainLumenal
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000394783-91029_371308372Topological domainLumenal
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000407584-101129_371308372Topological domainLumenal
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000478968-101129_371308372Topological domainLumenal
HgeneGLT8D1chr3:52729206chr3:48445997ENST00000491606-91029_371308372Topological domainLumenal
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-36381507_153921012136Coiled coilOntology_term=ECO:0000255
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-37391507_153919181953Coiled coilOntology_term=ECO:0000255
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-36381507_153921012136Coiled coilOntology_term=ECO:0000255
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-35371507_153919181953Coiled coilOntology_term=ECO:0000255
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-3638678_82921012136Compositional biasNote=Pro-rich
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-3739678_82919181953Compositional biasNote=Pro-rich
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-3638678_82921012136Compositional biasNote=Pro-rich
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-3537678_82919181953Compositional biasNote=Pro-rich
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-36381070_116021012136DomainNote=IPT/TIG 1
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-36381162_124921012136DomainNote=IPT/TIG 2
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-36381252_137521012136DomainNote=IPT/TIG 3
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-363820_47921012136DomainSema
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-37391070_116019181953DomainNote=IPT/TIG 1
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-37391162_124919181953DomainNote=IPT/TIG 2
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-37391252_137519181953DomainNote=IPT/TIG 3
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-373920_47919181953DomainSema
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-36381070_116021012136DomainNote=IPT/TIG 1
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-36381162_124921012136DomainNote=IPT/TIG 2
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-36381252_137521012136DomainNote=IPT/TIG 3
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-363820_47921012136DomainSema
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-35371070_116019181953DomainNote=IPT/TIG 1
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-35371162_124919181953DomainNote=IPT/TIG 2
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-35371252_137519181953DomainNote=IPT/TIG 3
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-353720_47919181953DomainSema
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-36381512_213521012136Topological domainCytoplasmic
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-363820_149021012136Topological domainExtracellular
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-37391512_213519181953Topological domainCytoplasmic
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-373920_149019181953Topological domainExtracellular
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-36381512_213521012136Topological domainCytoplasmic
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-363820_149021012136Topological domainExtracellular
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-35371512_213519181953Topological domainCytoplasmic
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-353720_149019181953Topological domainExtracellular
TgenePLXNB1chr3:52729206chr3:48445997ENST00000296440-36381491_151121012136TransmembraneHelical
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358459-37391491_151119181953TransmembraneHelical
TgenePLXNB1chr3:52729206chr3:48445997ENST00000358536-36381491_151121012136TransmembraneHelical
TgenePLXNB1chr3:52729206chr3:48445997ENST00000456774-35371491_151119181953TransmembraneHelical


Top

FusionGeneSequence for GLT8D1_PLXNB1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000407584_chr3_52729206_-_PLXNB1_ENST00000448774_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000407584_chr3_52729206_-_PLXNB1_ENST00000456774_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_35aa

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_35aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000407584_chr3_52729206_-_PLXNB1_ENST00000448774_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000407584_chr3_52729206_-_PLXNB1_ENST00000456774_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_105nt
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAG


* Fusion transcript sequences (Full-length transcript).
>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_2016nt
GCGGCGCCTGCTTGGCGCGACGCTCTAGCGGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGA
CAGCAGACCGAGGACACGGTTGTTACCAAGACCAGGCTGTTGCCTTGGAAGAGCCCAGAGCGTGTCAAGGGAGACAGCCACATCACGCCA
GAAATACATGACAGCTGGATTAGCCCTGGGAGAGGGAGGCCCAGATGTGGGAGCTCAGGGGAGGTGCAGCTCAACGTGGAGTTTGGAGGA
GGCTACCTTGACCTTTGAATGCCAAGTGGGAGCCAGCCAGATGAAAGGGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCA
TTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTG
TTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGA
CAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGC
TCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGA
TACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTT
GCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCC
CTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCA
GGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAAT
CCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAG
GGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATG
TGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGC
AGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTGCTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAG
CTCGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAGTGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGC
CTCGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAGTACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTG
ACACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAGACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGA
ACACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTTCCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTT
GAGCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGCCTCTCCTAGGCCACTACAAACTGACCCCTCAGCAG
GGCTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCTGCTGCAGGGGGGTCTTGGGGAGAGTGGTGACTCCA

>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_2015nt
GCGGCGCCTGCTTGGCGCGACGCTCTAGCGGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGA
CAGCAGACCGAGGACACGGTTGTTACCAAGACCAGGCTGTTGCCTTGGAAGAGCCCAGAGCGTGTCAAGGGAGACAGCCACATCACGCCA
GAAATACATGACAGCTGGATTAGCCCTGGGAGAGGGAGGCCCAGATGTGGGAGCTCAGGGGAGGTGCAGCTCAACGTGGAGTTTGGAGGA
GGCTACCTTGACCTTTGAATGCCAAGTGGGAGCCAGCCAGATGAAAGGGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCA
TTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTG
TTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGA
CAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGC
TCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGA
TACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTT
GCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCC
CTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCA
GGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAAT
CCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAG
GGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATG
TGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGC
AGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTGCTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAG
CTCGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAGTGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGC
CTCGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAGTACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTG
ACACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAGACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGA
ACACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTTCCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTT
GAGCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGCCTCTCCTAGGCCACTACAAACTGACCCCTCAGCAG
GGCTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCTGCTGCAGGGGGGTCTTGGGGAGAGTGGTGACTCCA

>In-frame_GLT8D1_ENST00000478968_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_2014nt
GCGGCGCCTGCTTGGCGCGACGCTCTAGCGGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGA
CAGCAGACCGAGGACACGGTTGTTACCAAGACCAGGCTGTTGCCTTGGAAGAGCCCAGAGCGTGTCAAGGGAGACAGCCACATCACGCCA
GAAATACATGACAGCTGGATTAGCCCTGGGAGAGGGAGGCCCAGATGTGGGAGCTCAGGGGAGGTGCAGCTCAACGTGGAGTTTGGAGGA
GGCTACCTTGACCTTTGAATGCCAAGTGGGAGCCAGCCAGATGAAAGGGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCA
TTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTG
TTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGA
CAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGC
TCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGA
TACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTT
GCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCC
CTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCA
GGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAAT
CCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAG
GGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATG
TGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGC
AGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTGCTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAG
CTCGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAGTGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGC
CTCGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAGTACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTG
ACACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAGACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGA
ACACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTTCCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTT
GAGCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGCCTCTCCTAGGCCACTACAAACTGACCCCTCAGCAG
GGCTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCTGCTGCAGGGGGGTCTTGGGGAGAGTGGTGACTCCA

>In-frame_GLT8D1_ENST00000407584_chr3_52729206_-_PLXNB1_ENST00000448774_chr3_48445997_-_1922nt
GCGCTTTTGCCGCGCCGTGCTGCCCGCGAGGGCAGCTGAGGTGGTGGTGGCGGCCGCCTTGTCGAGGCATCGCGCGCCCGTGAAGTGTTC
GCCGTCAGTGCTGTTGGGTGCCTGGAGCCGCGTCCCCCGTCCCGAAAACTGTCCTTGACAGTACTTGCGCGGCCCAACGGCCGCCGGCGC
CCCCGCGTCTCCATGGCGACGGCCTTTTTCCCTGCGAGGACCCCGGCGGCAGGGCTGCCCCGCGGCGCCTGCTTGGCGCGACGCTCTAGC
GGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGTGTGCTCGGCCCAGCGTGCAGGGAA
CGCGGGCGGCCAGACAACGGGCTGGGCTCCGGGGCCTGCGGCGCGGGCGCTGAGCTGGCAGGGCGGGTCGGGGCGCGGGCTGCATCCGCA
TCTCCTCCATCGCCTGCAGTAAGGGCGGCCGCGGCGAGCCTTTGAGGGGAACGACTTGTCGGAGCCCTAACCAGGGGTATCTCTGAGCCT
GGTGGGATCCCCGGAGCGTCACATCACTTTCCGATCACTTCAAAGTACAGCAGACCGAGGACACGGTTGTTACCAAGACCAGGCTGTTGC
CTTGGAAGAGCCCAGAGCGTGTCAAGGGAGACAGCCACATCACGCCAGAAATACATGACAGCTGGATTAGCCCTGGGAGAGGGAGGCCCA
GATGTGGGAGCTCAGGGGAGGTGCAGCTCAACGTGGAGTTTGGAGGAGGCTACCTTGACCTTTGAATGCCAAGTGGGAGCCAGCCAGATG
AAAGGGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCATTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTC
TCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAAC
CTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGC
TTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGCTCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAG
ACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAG
TAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGG
CCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTT
CAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGG
AAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGA
ATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTC
CTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATGTGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGAT
GGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGG

>In-frame_GLT8D1_ENST00000407584_chr3_52729206_-_PLXNB1_ENST00000456774_chr3_48445997_-_1881nt
GCGCTTTTGCCGCGCCGTGCTGCCCGCGAGGGCAGCTGAGGTGGTGGTGGCGGCCGCCTTGTCGAGGCATCGCGCGCCCGTGAAGTGTTC
GCCGTCAGTGCTGTTGGGTGCCTGGAGCCGCGTCCCCCGTCCCGAAAACTGTCCTTGACAGTACTTGCGCGGCCCAACGGCCGCCGGCGC
CCCCGCGTCTCCATGGCGACGGCCTTTTTCCCTGCGAGGACCCCGGCGGCAGGGCTGCCCCGCGGCGCCTGCTTGGCGCGACGCTCTAGC
GGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGTGTGCTCGGCCCAGCGTGCAGGGAA
CGCGGGCGGCCAGACAACGGGCTGGGCTCCGGGGCCTGCGGCGCGGGCGCTGAGCTGGCAGGGCGGGTCGGGGCGCGGGCTGCATCCGCA
TCTCCTCCATCGCCTGCAGTAAGGGCGGCCGCGGCGAGCCTTTGAGGGGAACGACTTGTCGGAGCCCTAACCAGGGGTATCTCTGAGCCT
GGTGGGATCCCCGGAGCGTCACATCACTTTCCGATCACTTCAAAGTACAGCAGACCGAGGACACGGTTGTTACCAAGACCAGGCTGTTGC
CTTGGAAGAGCCCAGAGCGTGTCAAGGGAGACAGCCACATCACGCCAGAAATACATGACAGCTGGATTAGCCCTGGGAGAGGGAGGCCCA
GATGTGGGAGCTCAGGGGAGGTGCAGCTCAACGTGGAGTTTGGAGGAGGCTACCTTGACCTTTGAATGCCAAGTGGGAGCCAGCCAGATG
AAAGGGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCATTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTC
TCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAAC
CTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGC
TTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGCTCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAG
ACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAG
TAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGG
CCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTT
CAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGG
AAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGA
ATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTC
CTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATGTGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGAT

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_2284nt
GCGCTTTTGCCGCGCCGTGCTGCCCGCGAGGGCAGCTGAGGTGGTGGTGGCGGCCGCCTTGTCGAGGCATCGCGCGCCCGTGAAGTGTTC
GCCGTCAGTGCTGTTGGGTGCCTGGAGCCGCGTCCCCCGTCCCGAAAACTGTCCTTGACAGTACTTGCGCGGCCCAACGGCCGCCGGCGC
CCCCGCGTCTCCATGGCGACGGCCTTTTTCCCTGCGAGGACCCCGGCGGCAGGGCTGCCCCGCGGCGCCTGCTTGGCGCGACGCTCTAGC
GGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGTGTGCTCGGCCCAGCGTGCAGGGAA
CGCGGGCGGCCAGACAACGGGCTGGGCTCCGGGGCCTGCGGCGCGGGCGCTGAGCTGGCAGGGCGGGTCGGGGCGCGGGCTGCATCCGCA
TCTCCTCCATCGCCTGCAGTAAGGGCGGCCGCGGCGAGCCTTTGAGGGGAACGACTTGTCGGAGCCCTAACCAGGGGTATCTCTGAGCCT
GGTGGGATCCCCGGAGCGTCACATCACTTTCCGATCACTTCAAAGTGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCATT
CCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTT
AAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACA
AGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGCTC
CAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATA
CAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGC
AAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCT
TTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGG
AAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCC
TGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGG
ACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATGTG
GAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAG
CTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTGCTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAGCT
CGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAGTGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGCCT
CGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAGTACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTGAC
ACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAGACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGAAC
ACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTTCCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTTGA
GCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGCCTCTCCTAGGCCACTACAAACTGACCCCTCAGCAGGG
CTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCTGCTGCAGGGGGGTCTTGGGGAGAGTGGTGACTCCATT

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_2283nt
GCGCTTTTGCCGCGCCGTGCTGCCCGCGAGGGCAGCTGAGGTGGTGGTGGCGGCCGCCTTGTCGAGGCATCGCGCGCCCGTGAAGTGTTC
GCCGTCAGTGCTGTTGGGTGCCTGGAGCCGCGTCCCCCGTCCCGAAAACTGTCCTTGACAGTACTTGCGCGGCCCAACGGCCGCCGGCGC
CCCCGCGTCTCCATGGCGACGGCCTTTTTCCCTGCGAGGACCCCGGCGGCAGGGCTGCCCCGCGGCGCCTGCTTGGCGCGACGCTCTAGC
GGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGTGTGCTCGGCCCAGCGTGCAGGGAA
CGCGGGCGGCCAGACAACGGGCTGGGCTCCGGGGCCTGCGGCGCGGGCGCTGAGCTGGCAGGGCGGGTCGGGGCGCGGGCTGCATCCGCA
TCTCCTCCATCGCCTGCAGTAAGGGCGGCCGCGGCGAGCCTTTGAGGGGAACGACTTGTCGGAGCCCTAACCAGGGGTATCTCTGAGCCT
GGTGGGATCCCCGGAGCGTCACATCACTTTCCGATCACTTCAAAGTGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCATT
CCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTT
AAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACA
AGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGCTC
CAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATA
CAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGC
AAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCT
TTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGG
AAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCC
TGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGG
ACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATGTG
GAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAG
CTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTGCTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAGCT
CGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAGTGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGCCT
CGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAGTACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTGAC
ACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAGACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGAAC
ACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTTCCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTTGA
GCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGCCTCTCCTAGGCCACTACAAACTGACCCCTCAGCAGGG
CTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCTGCTGCAGGGGGGTCTTGGGGAGAGTGGTGACTCCATT

>In-frame_GLT8D1_ENST00000266014_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_2282nt
GCGCTTTTGCCGCGCCGTGCTGCCCGCGAGGGCAGCTGAGGTGGTGGTGGCGGCCGCCTTGTCGAGGCATCGCGCGCCCGTGAAGTGTTC
GCCGTCAGTGCTGTTGGGTGCCTGGAGCCGCGTCCCCCGTCCCGAAAACTGTCCTTGACAGTACTTGCGCGGCCCAACGGCCGCCGGCGC
CCCCGCGTCTCCATGGCGACGGCCTTTTTCCCTGCGAGGACCCCGGCGGCAGGGCTGCCCCGCGGCGCCTGCTTGGCGCGACGCTCTAGC
GGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGTGTGCTCGGCCCAGCGTGCAGGGAA
CGCGGGCGGCCAGACAACGGGCTGGGCTCCGGGGCCTGCGGCGCGGGCGCTGAGCTGGCAGGGCGGGTCGGGGCGCGGGCTGCATCCGCA
TCTCCTCCATCGCCTGCAGTAAGGGCGGCCGCGGCGAGCCTTTGAGGGGAACGACTTGTCGGAGCCCTAACCAGGGGTATCTCTGAGCCT
GGTGGGATCCCCGGAGCGTCACATCACTTTCCGATCACTTCAAAGTGGTTAAAAACTAATATTTATATGACAGAAGAAAAAGATGTCATT
CCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGGTTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTT
AAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTGTCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACA
AGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCATTGCAGCTATAAACAGCATTCAGCACAACACTCGCTC
CAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGTCCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATA
CAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATCCTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGC
AAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGGATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCT
TTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTGATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGG
AAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTAAGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCC
TGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACCAACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGG
ACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCGTATTTTATCAACAGCACTCTACCATCGATCCTATGTG
GAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAG
CTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTGCTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAGCT
CGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAGTGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGCCT
CGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAGTACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTGAC
ACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAGACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGAAC
ACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTTCCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTTGA
GCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGCCTCTCCTAGGCCACTACAAACTGACCCCTCAGCAGGG
CTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCTGCTGCAGGGGGGTCTTGGGGAGAGTGGTGACTCCATT

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000296440_chr3_48445997_-_1781nt
CTTGGCGCGACGCTCTAGCGGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGGTTAAA
AACTAATATTTATATGACAGAAGAAAAAGATGTCATTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGG
TTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTG
TCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCA
TTGCAGCTATAAACAGCATTCAGCACAACACTCGCTCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGT
CCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATC
CTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGG
ATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTG
ATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTA
AGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACC
AACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCG
TATTTTATCAACAGCACTCTACCATCGATCCTATGTGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAG
AAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTG
CTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAGCTCGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAG
TGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGCCTCGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAG
TACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTGACACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAG
ACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGAACACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTT
CCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTTGAGCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGC
CTCTCCTAGGCCACTACAAACTGACCCCTCAGCAGGGCTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCT

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000358459_chr3_48445997_-_1780nt
CTTGGCGCGACGCTCTAGCGGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGGTTAAA
AACTAATATTTATATGACAGAAGAAAAAGATGTCATTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGG
TTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTG
TCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCA
TTGCAGCTATAAACAGCATTCAGCACAACACTCGCTCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGT
CCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATC
CTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGG
ATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTG
ATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTA
AGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACC
AACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCG
TATTTTATCAACAGCACTCTACCATCGATCCTATGTGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAG
AAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTG
CTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAGCTCGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAG
TGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGCCTCGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAG
TACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTGACACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAG
ACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGAACACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTT
CCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTTGAGCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGC
CTCTCCTAGGCCACTACAAACTGACCCCTCAGCAGGGCTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCT

>In-frame_GLT8D1_ENST00000491606_chr3_52729206_-_PLXNB1_ENST00000358536_chr3_48445997_-_1779nt
CTTGGCGCGACGCTCTAGCGGTTACCGCTGCGGGCTGGCTGGGCGTAGTGGGGCTGCGCGGCTGCCACGGAGCTAGAGGGCAAGGTTAAA
AACTAATATTTATATGACAGAAGAAAAAGATGTCATTCCGTAAAGTAAACATCATCATCTTGGTCCTGGCTGTTGCTCTCTTCTTACTGG
TTTTGCACCATAACTTCCTCAGCTTGAGCAGTTTGTTAAGGAATGAGGTTACAGATTCAGGAATTGTAGGGCCTCAACCTATAGACTTTG
TCCCAAATGCTCTCCGACATGCAGTAGATGGGAGACAAGAGGAGATTCCTGTGGTCATCGCTGCATCTGAAGACAGGCTTGGGGGGGCCA
TTGCAGCTATAAACAGCATTCAGCACAACACTCGCTCCAATGTGATTTTCTACATTGTTACTCTCAACAATACAGCAGACCATCTCCGGT
CCTGGCTCAACAGTGATTCCCTGAAAAGCATCAGATACAAAATTGTCAATTTTGACCCTAAACTTTTGGAAGGAAAAGTAAAGGAGGATC
CTGACCAGGGGGAATCCATGAAACCTTTAACCTTTGCAAGGTTCTACTTGCCAATTCTGGTTCCCAGCGCAAAGAAGGCCATATACATGG
ATGATGATGTAATTGTGCAAGGTGATATTCTTGCCCTTTACAATACAGCACTGAAGCCAGGACATGCAGCTGCATTTTCAGAAGATTGTG
ATTCAGCCTCTACTAAAGTTGTCATCCGTGGAGCAGGAAACCAGTACAATTACATTGGCTATCTTGACTATAAAAAGGAAAGAATTCGTA
AGCTTTCCATGAAAGCCAGCACTTGCTCATTTAATCCTGGAGTTTTTGTTGCAAACCTGACGGAATGGAAACGACAGAATATAACTAACC
AACTGGAAAAATGGATGAAACTCAATGTAGAAGAGGGACTGTATAGCAGAACCCTGGCTGGTAGCATCACAACACCTCCTCTGCTTATCG
TATTTTATCAACAGCACTCTACCATCGATCCTATGTGGAATGTCCGCCACCTTGATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAG
AAGATGCAGCTGGGCTATCGGCTCCAGCAGATTGCAGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCACGGCCTG
CTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAGCTCGGAGGAGAGGCCACCTTCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAG
TGGAAGGTGACTCCCAGTCTCCTGGTGGCTCTGGCCTCGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATGGGGTAG
TACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGTGACACCGGTCTGCAGGGAGTTGGGGACTAAGGGCTTCCAGAGAGTGGCTGGAAGAG
ACTCCAGGCCCCTGGGGAGACTGTACTGTTCCTGAACACTGGCCTTGGCCACACTGGGATTCGGAGAGGAAGGAGGAGAGCCCCATGCTT
CCTGTCTGCCTCCTCCACCATCCCTGACCTCAGTTGAGCTGCCTCTGGCCTTGTTGCTGCTGCCACATCCTAGGTCTAAGAGTTGAACGC
CTCTCCTAGGCCACTACAAACTGACCCCTCAGCAGGGCTGGCTGCCACAGGGCTGCCCTGCCTCATAGGTAGCCATGGTGAGGGCTATCT


Top

FusionGenePPI for GLT8D1_PLXNB1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
GLT8D1UGGT1, DUSP6, CD97, HTR3A, P2RX4, HLA-DPA1, HTR3CPLXNB1ARHGEF11, RND1, RND2, RND3, ARHGEF12, SEMA4D, RHOA, AKT1, GRB2, PLCG1, PLCG2, SOX4, DIAPH1, HNRNPD, SGTB, C21orf59, CENPO, CENPU, SMPX, HBB, HBA2


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for GLT8D1_PLXNB1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for GLT8D1_PLXNB1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneGLT8D1C0023893Liver Cirrhosis, Experimental1CTD_human
HgeneGLT8D1C0041696Unipolar Depression1PSYGENET
HgeneGLT8D1C1269683Major Depressive Disorder1PSYGENET