FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 13367

FusionGeneSummary for FGF12_OPA1

check button Fusion gene summary
Fusion gene informationFusion gene name: FGF12_OPA1
Fusion gene ID: 13367
HgeneTgene
Gene symbol

FGF12

OPA1

Gene ID

2257

9968

Gene namefibroblast growth factor 12mediator complex subunit 12
SynonymsEIEE47|FGF12B|FHF1ARC240|CAGH45|FGS1|HOPA|MED12S|OHDOX|OKS|OPA1|TNRC11|TRAP230
Cytomap

3q28-q29

Xq13.1

Type of geneprotein-codingprotein-coding
Descriptionfibroblast growth factor 12fibroblast growth factor 12Bfibroblast growth factor FGF-12bfibroblast growth factor homologous factor 1myocyte-activating factormediator of RNA polymerase II transcription subunit 12CAG repeat protein 45OPA-containing proteinactivator-recruited cofactor 240 kDa componenthuman opposite pairedmediator of RNA polymerase II transcription, subunit 12 homologputative mediator subu
Modification date2018051920180527
UniProtAcc

P61328

O60313

Ensembl transtripts involved in fusion geneENST00000445105, ENST00000264730, 
ENST00000454309, ENST00000450716, 
ENST00000430714, ENST00000466144, 
ENST00000361828, ENST00000361510, 
ENST00000361150, ENST00000361715, 
ENST00000361908, ENST00000392438, 
ENST00000487986, 
Fusion gene scores* DoF score6 X 3 X 4=723 X 3 X 3=27
# samples 73
** MAII scorelog2(7/72*10)=-0.0406419844973459
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(3/27*10)=0.15200309344505
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: FGF12 [Title/Abstract] AND OPA1 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
TgeneOPA1

GO:0006367

transcription initiation from RNA polymerase II promoter

12218053

TgeneOPA1

GO:0030518

intracellular steroid hormone receptor signaling pathway

11867769

TgeneOPA1

GO:0030521

androgen receptor signaling pathway

12218053

TgeneOPA1

GO:0045893

positive regulation of transcription, DNA-templated

10198638

TgeneOPA1

GO:0045944

positive regulation of transcription by RNA polymerase II

12037571


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1DA123600FGF12chr3

192444970

-OPA1chr3

193409850

+
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000445105ENST00000361828FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000445105ENST00000361510FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000445105ENST00000361150FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000445105ENST00000361715FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000445105ENST00000361908FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000445105ENST00000392438FGF12chr3

192444970

-OPA1chr3

193409850

+
5CDS-intronENST00000445105ENST00000487986FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000264730ENST00000361828FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000264730ENST00000361510FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000264730ENST00000361150FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000264730ENST00000361715FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000264730ENST00000361908FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000264730ENST00000392438FGF12chr3

192444970

-OPA1chr3

193409850

+
5CDS-intronENST00000264730ENST00000487986FGF12chr3

192444970

-OPA1chr3

193409850

+
intron-3CDSENST00000454309ENST00000361828FGF12chr3

192444970

-OPA1chr3

193409850

+
intron-3CDSENST00000454309ENST00000361510FGF12chr3

192444970

-OPA1chr3

193409850

+
intron-3CDSENST00000454309ENST00000361150FGF12chr3

192444970

-OPA1chr3

193409850

+
intron-3CDSENST00000454309ENST00000361715FGF12chr3

192444970

-OPA1chr3

193409850

+
intron-3CDSENST00000454309ENST00000361908FGF12chr3

192444970

-OPA1chr3

193409850

+
intron-3CDSENST00000454309ENST00000392438FGF12chr3

192444970

-OPA1chr3

193409850

+
intron-intronENST00000454309ENST00000487986FGF12chr3

192444970

-OPA1chr3

193409850

+
In-frameENST00000450716ENST00000361828FGF12chr3

192444970

-OPA1chr3

193409850

+
In-frameENST00000450716ENST00000361510FGF12chr3

192444970

-OPA1chr3

193409850

+
In-frameENST00000450716ENST00000361150FGF12chr3

192444970

-OPA1chr3

193409850

+
In-frameENST00000450716ENST00000361715FGF12chr3

192444970

-OPA1chr3

193409850

+
In-frameENST00000450716ENST00000361908FGF12chr3

192444970

-OPA1chr3

193409850

+
In-frameENST00000450716ENST00000392438FGF12chr3

192444970

-OPA1chr3

193409850

+
5CDS-intronENST00000450716ENST00000487986FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000430714ENST00000361828FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000430714ENST00000361510FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000430714ENST00000361150FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000430714ENST00000361715FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000430714ENST00000361908FGF12chr3

192444970

-OPA1chr3

193409850

+
Frame-shitENST00000430714ENST00000392438FGF12chr3

192444970

-OPA1chr3

193409850

+
5CDS-intronENST00000430714ENST00000487986FGF12chr3

192444970

-OPA1chr3

193409850

+
5UTR-3CDSENST00000466144ENST00000361828FGF12chr3

192444970

-OPA1chr3

193409850

+
5UTR-3CDSENST00000466144ENST00000361510FGF12chr3

192444970

-OPA1chr3

193409850

+
5UTR-3CDSENST00000466144ENST00000361150FGF12chr3

192444970

-OPA1chr3

193409850

+
5UTR-3CDSENST00000466144ENST00000361715FGF12chr3

192444970

-OPA1chr3

193409850

+
5UTR-3CDSENST00000466144ENST00000361908FGF12chr3

192444970

-OPA1chr3

193409850

+
5UTR-3CDSENST00000466144ENST00000392438FGF12chr3

192444970

-OPA1chr3

193409850

+
5UTR-intronENST00000466144ENST00000487986FGF12chr3

192444970

-OPA1chr3

193409850

+

Top

FusionProtFeatures for FGF12_OPA1


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
FGF12

P61328

OPA1

O60313

Involved in nervous system development and function.Involved in the positive regulation of voltage-gated sodiumchannel activity. Promotes neuronal excitability by elevating thevoltage dependence of neuronal sodium channel SCN8A fastinactivation. {ECO:0000269|PubMed:27164707}. Dynamin-related GTPase that is essential for normalmitochondrial morphology by regulating the equilibrium betweenmitochondrial fusion and mitochondrial fission (PubMed:16778770,PubMed:17709429, PubMed:20185555, PubMed:24616225,PubMed:28746876). Coexpression of isoform 1 with shorteralternative products is required for optimal activity in promotingmitochondrial fusion (PubMed:17709429). Binds lipid membranesenriched in negatively charged phospholipids, such as cardiolipin,and promotes membrane tubulation (PubMed:20185555). The intrinsicGTPase activity is low, and is strongly increased by interactionwith lipid membranes (PubMed:20185555). Plays a role in remodelingcristae and the release of cytochrome c during apoptosis (Bysimilarity). Proteolytic processing in response to intrinsicapoptotic signals may lead to disassembly of OPA1 oligomers andrelease of the caspase activator cytochrome C (CYCS) into themitochondrial intermembrane space (By similarity). Plays a role inmitochondrial genome maintenance (PubMed:20974897,PubMed:18158317). {ECO:0000250|UniProtKB:P58281,ECO:0000269|PubMed:16778770, ECO:0000269|PubMed:17709429,ECO:0000269|PubMed:18158317, ECO:0000269|PubMed:20185555,ECO:0000269|PubMed:20974897, ECO:0000269|PubMed:24616225,ECO:0000269|PubMed:28746876}. Dynamin-like 120 kDa protein, form S1: Inactive formproduced by cleavage at S1 position by OMA1 following stressconditions that induce loss of mitochondrial membrane potential,leading to negative regulation of mitochondrial fusion.{ECO:0000269|PubMed:20038677}. Isoforms that contain the alternative exon 4b (presentin isoform 4 and isoform 5) are required for mitochondrial genomemaintenance, possibly by anchoring the mitochondrial nucleoids tothe inner mitochondrial membrane. {ECO:0000269|PubMed:20974897}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for FGF12_OPA1


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.
>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361828_chr3_193409850_+_85aa

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361510_chr3_193409850_+_85aa

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361150_chr3_193409850_+_85aa

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361715_chr3_193409850_+_85aa

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361908_chr3_193409850_+_85aa

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000392438_chr3_193409850_+_85aa


* Fusion transcript sequences (only coding sequence (CDS) region).
>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361828_chr3_193409850_+_255nt
ATGGAGAGCAAAGTAAGCAATGGCATCAACCATTCTCCTCCTACCCTGAATGGTGCCCCATCACCGCCACAGAGATTCAGCAATGGTCCT
GCCTCCTCCACATCATCTGCACTCACAAATCAGCAATTGCCAGCCACTTGTGGTGCTCGACAACTCAGCAAGTTGAAACGCTTTCTTACC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361510_chr3_193409850_+_255nt
ATGGAGAGCAAAGTAAGCAATGGCATCAACCATTCTCCTCCTACCCTGAATGGTGCCCCATCACCGCCACAGAGATTCAGCAATGGTCCT
GCCTCCTCCACATCATCTGCACTCACAAATCAGCAATTGCCAGCCACTTGTGGTGCTCGACAACTCAGCAAGTTGAAACGCTTTCTTACC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361150_chr3_193409850_+_255nt
ATGGAGAGCAAAGTAAGCAATGGCATCAACCATTCTCCTCCTACCCTGAATGGTGCCCCATCACCGCCACAGAGATTCAGCAATGGTCCT
GCCTCCTCCACATCATCTGCACTCACAAATCAGCAATTGCCAGCCACTTGTGGTGCTCGACAACTCAGCAAGTTGAAACGCTTTCTTACC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361715_chr3_193409850_+_255nt
ATGGAGAGCAAAGTAAGCAATGGCATCAACCATTCTCCTCCTACCCTGAATGGTGCCCCATCACCGCCACAGAGATTCAGCAATGGTCCT
GCCTCCTCCACATCATCTGCACTCACAAATCAGCAATTGCCAGCCACTTGTGGTGCTCGACAACTCAGCAAGTTGAAACGCTTTCTTACC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361908_chr3_193409850_+_255nt
ATGGAGAGCAAAGTAAGCAATGGCATCAACCATTCTCCTCCTACCCTGAATGGTGCCCCATCACCGCCACAGAGATTCAGCAATGGTCCT
GCCTCCTCCACATCATCTGCACTCACAAATCAGCAATTGCCAGCCACTTGTGGTGCTCGACAACTCAGCAAGTTGAAACGCTTTCTTACC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000392438_chr3_193409850_+_255nt
ATGGAGAGCAAAGTAAGCAATGGCATCAACCATTCTCCTCCTACCCTGAATGGTGCCCCATCACCGCCACAGAGATTCAGCAATGGTCCT
GCCTCCTCCACATCATCTGCACTCACAAATCAGCAATTGCCAGCCACTTGTGGTGCTCGACAACTCAGCAAGTTGAAACGCTTTCTTACC


* Fusion transcript sequences (Full-length transcript).
>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361828_chr3_193409850_+_3479nt
TTAAAGCAGGAGCCTTGAGAGCCTGATAAGCTGTTGACACAAGTGCTTTTGAGAATAGCAGGAAGCCTGAGGGGAAGGAAGGAAGTACGG
GCGAAATCATCAGATTGGCTTCCCAGATTTGGGAATCTGAAGCGGGCCCACATCTTCCGGCCAACTTCCATTGAACTTCCCAGCACTCGA
AAGGGACCGAAATGGAGAGCAAAGAGAAAGTTAGAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAAA
TTAAAATCGTACTCATAATCAGCTCTGCATACATCTGAAGAACAAAAACATCAACGTCTTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCC
ACCTTTCTAAACATACAATAAAGTCATGGGATAAAAATAATCGATGTATGTTACGGGCGCTTTAACCATCAGCTGCCTCTCGAATGGAAG
AACAGTGGTAATGGATTAACATCCTATTTTGTTGTACTAAAGTGACAAATCGGAATAATATAATTGGTATGGCCATTAGGTTCAGTCCTT
GAAGATAAGAAACTTGTTCTCTGTTTGTTGTCTTATTTGTGGTGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAATGTTCAGTTTCT
TTTCCAGAAATACAATGCTAGGTGTTTTGAAATAAAACTTATATAGCAATTGTTTAAAGTTATCAATTGTATATAAAATCACAGTAGCCT
GCTAAATCATTGTATGTGTCTGTAGTATTCTATTCCCAGAAACTATTTGACCATGATAATTCAGTTTATATTCACCACATGAAAGAAAAA
TGGGTAACAGAAGAACCCTTAAAACAGGTTAATTTGGATTGTAACGTTCAGTGAAAGAAATTTCAACCCTTCATAGCCAGCGAAGAAATT
TGCCTTGGAAGCCAAGTCAGTACCAGCTTACCTATTTGATTCAGTTGCTGTTTTCTCACTCTCTATATCCATTTGAAATTGATTTATTTT
AGATGTTGTATACTTACGTTAGGCTTTCTGTTAATAGTGGTTTTTCTCCTGTTGACAGAGCCACCGGATTATGACACAGGATGAGGAAGA
TTAAGGATAATCAATTGACTAATTTCATTTAGAATATTATCAAACATTTCAACTAGGTATCAGAAAAAGGCTTTCTTTCATAAGACTATT
TTAAATAGAAATTATTTCAACAATTAAAGTAATGTTGACCATCCCCCTCTCAGCTGAATAAAGAAAAATTTAGTTCAATTTATTGCAATT
TAATTACAATACTACCTTCACAACATTTTCATGTGTTTTAAATAAATATTTTTTAATTGGCTAAAGGACATTCAAGCAAAGAAATGCTTT
CTTTACTTAAAATGTCTATCTCATTTGCTGCCTTTTCACTAAGCCTTTACTTTGTTAATAAAAGTGTCCATTGTGTGATGTTTTTGATTT
TACAGTTTGCTAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAACAGCCCCATTGCTACTCCCCATTTTATTGTTTTACATCAATGCATG
CTTCGTTGTGATCCCTCAAGATGTAACACTTGGTATGCTCGGTTGAGGATATGAAAAAATACTTCCGAAACCAGGAATTCAATGTATGTT
TGTTTTATACTGTTTGATAAGAAAAGTAGGTCCAGCCTTAAGCAGCACAGATGCGCTGGTAGATGCATAGTCAGGAACTTTTTTTATTTC
TTTTAGGTCTAGGGACAGGAGTGAATAGAAAGGGAGGAGAGCTCTATTATGTTCTATACACAGATTAGGAGATGACCTTACTGGGTACAC
CCCTCTAACCAGTGCTTACAGGTTAATGCATGTTAATGAATATTTTTGCAGTTGTAAAGCATAACAATTACAACTACACATCTATTTCTA
AAGAATAAAACAGGACCATATTTATTTACTTCTGTCAACTATAGAAAGAAAGACCTTCAGCTGTATTTCCACAGATTTCTCCCAAGGAAA
AGGCTAATATTAGTCACTACTGTTATCACATCCCTTTGTATAAGTTTTAAAAAGAGATGGAGGGAGATCTTCATTTCTTTGAGGAGATCA
GTATTGTAACGTATGTGAATAGATGATAACAATTAATATTACTAAAAGTCCCACATGAGAGTCCTGACGCCCTCTCCATGCCCCACAGTA
ATGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTTTTAGCTGATCTCATCCTAAGCATGCTTTATTTTTCCTTGAAAGCTAGGTATTTAT
CAACTGCAGATGTTATTGAAAGAAAATAAAATTCAGTCTCAAGAGTAAACCCTGTGTCTTGTGTCTGTAGTTCAAAAGTCAGAAATGATT
CTAATTTAAACAAAAAGATACTAAATATACAGAAGTTAAATTCGAACTAGCCACAGAATCATTTGTTTTTATGTCAGAATTTGCAAAGAG
TGGAGTGGACAAAGCTCTGTATGGAAGACTGAACAACTGTAAATAGATGATATCCAAACTTAATTTGGCTAGGACTTCAATTTTAAAAAT
CAGTGTACCTAGGCAGTGCACAGCACGAAATAAGTGGCCCTTGCAGCTTCCCCGTTTAACCCACTGTGCTATAGTTGCGGGTGGAACAGT
CAACCTTTCTAGTAGTTTATGATATTGCCCTCTTTGTATTCCCATTTTCTACAGTTTTTTCCGCAGACTTCTTTCTGCAAATTATTCAGC
CTCCAAATGCAAATGAATGATATAAAAATAAGTAGGGAACATGGCAGAGAGTGGTGCTTCCCAGCCTCACAATGTGGGAATTTGACATAG
GATGAGAGTCAGAGTATAGGTTTAAAAGATAAAATCTTTAGTTAATAATTTTGTATTTATTTATTCTAGATGTATGTATCTGAGGAAAGA
AATCTGGTATTTTTGCTTTCCAATAAAGGGGATCAAAGTAATGGTTTTTCTCTCAGTTCTCTAAGCTGGTCTATGTTATAGCTCTAGCAG
TATGGAAATGTGCTTTAAAATATGCTTACCTTTTGAATGATCATGGCTATATGTTGTTGAGATATTTGAAACTTACCTTGTTTTCACTTG
TGCACTGTGAATGAACTTTGTATTATTTTTTTAAAACCTTCACATTACGTGTAGATATTATTGCAACTTATATTTTGCCTGAGCTTGATC
AAAGGTCATTTGTGTAGATGAGTAATTAAAAAATATTTAAATCACATTATAATTCTATTATTGGAGAGCATCTTTTAAATTTTTTTCTGT
TTTAACGAGGGAAAGAGAAACCTGTATACCTAGGGTCATTATTTGACCCCATAGTATAACCAGATTCATGGTCTAACAAGCTCTCAGTGT
GGCTTTTCTCTGAATGCTTGAATTTCACATGCCTTGCATTTCACAGTTGTACTCCATGGTCAACCGGTGCTTTTTTTCACATCGTGGTAC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361510_chr3_193409850_+_3479nt
TTAAAGCAGGAGCCTTGAGAGCCTGATAAGCTGTTGACACAAGTGCTTTTGAGAATAGCAGGAAGCCTGAGGGGAAGGAAGGAAGTACGG
GCGAAATCATCAGATTGGCTTCCCAGATTTGGGAATCTGAAGCGGGCCCACATCTTCCGGCCAACTTCCATTGAACTTCCCAGCACTCGA
AAGGGACCGAAATGGAGAGCAAAGAGAAAGTTAGAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAAA
TTAAAATCGTACTCATAATCAGCTCTGCATACATCTGAAGAACAAAAACATCAACGTCTTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCC
ACCTTTCTAAACATACAATAAAGTCATGGGATAAAAATAATCGATGTATGTTACGGGCGCTTTAACCATCAGCTGCCTCTCGAATGGAAG
AACAGTGGTAATGGATTAACATCCTATTTTGTTGTACTAAAGTGACAAATCGGAATAATATAATTGGTATGGCCATTAGGTTCAGTCCTT
GAAGATAAGAAACTTGTTCTCTGTTTGTTGTCTTATTTGTGGTGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAATGTTCAGTTTCT
TTTCCAGAAATACAATGCTAGGTGTTTTGAAATAAAACTTATATAGCAATTGTTTAAAGTTATCAATTGTATATAAAATCACAGTAGCCT
GCTAAATCATTGTATGTGTCTGTAGTATTCTATTCCCAGAAACTATTTGACCATGATAATTCAGTTTATATTCACCACATGAAAGAAAAA
TGGGTAACAGAAGAACCCTTAAAACAGGTTAATTTGGATTGTAACGTTCAGTGAAAGAAATTTCAACCCTTCATAGCCAGCGAAGAAATT
TGCCTTGGAAGCCAAGTCAGTACCAGCTTACCTATTTGATTCAGTTGCTGTTTTCTCACTCTCTATATCCATTTGAAATTGATTTATTTT
AGATGTTGTATACTTACGTTAGGCTTTCTGTTAATAGTGGTTTTTCTCCTGTTGACAGAGCCACCGGATTATGACACAGGATGAGGAAGA
TTAAGGATAATCAATTGACTAATTTCATTTAGAATATTATCAAACATTTCAACTAGGTATCAGAAAAAGGCTTTCTTTCATAAGACTATT
TTAAATAGAAATTATTTCAACAATTAAAGTAATGTTGACCATCCCCCTCTCAGCTGAATAAAGAAAAATTTAGTTCAATTTATTGCAATT
TAATTACAATACTACCTTCACAACATTTTCATGTGTTTTAAATAAATATTTTTTAATTGGCTAAAGGACATTCAAGCAAAGAAATGCTTT
CTTTACTTAAAATGTCTATCTCATTTGCTGCCTTTTCACTAAGCCTTTACTTTGTTAATAAAAGTGTCCATTGTGTGATGTTTTTGATTT
TACAGTTTGCTAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAACAGCCCCATTGCTACTCCCCATTTTATTGTTTTACATCAATGCATG
CTTCGTTGTGATCCCTCAAGATGTAACACTTGGTATGCTCGGTTGAGGATATGAAAAAATACTTCCGAAACCAGGAATTCAATGTATGTT
TGTTTTATACTGTTTGATAAGAAAAGTAGGTCCAGCCTTAAGCAGCACAGATGCGCTGGTAGATGCATAGTCAGGAACTTTTTTTATTTC
TTTTAGGTCTAGGGACAGGAGTGAATAGAAAGGGAGGAGAGCTCTATTATGTTCTATACACAGATTAGGAGATGACCTTACTGGGTACAC
CCCTCTAACCAGTGCTTACAGGTTAATGCATGTTAATGAATATTTTTGCAGTTGTAAAGCATAACAATTACAACTACACATCTATTTCTA
AAGAATAAAACAGGACCATATTTATTTACTTCTGTCAACTATAGAAAGAAAGACCTTCAGCTGTATTTCCACAGATTTCTCCCAAGGAAA
AGGCTAATATTAGTCACTACTGTTATCACATCCCTTTGTATAAGTTTTAAAAAGAGATGGAGGGAGATCTTCATTTCTTTGAGGAGATCA
GTATTGTAACGTATGTGAATAGATGATAACAATTAATATTACTAAAAGTCCCACATGAGAGTCCTGACGCCCTCTCCATGCCCCACAGTA
ATGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTTTTAGCTGATCTCATCCTAAGCATGCTTTATTTTTCCTTGAAAGCTAGGTATTTAT
CAACTGCAGATGTTATTGAAAGAAAATAAAATTCAGTCTCAAGAGTAAACCCTGTGTCTTGTGTCTGTAGTTCAAAAGTCAGAAATGATT
CTAATTTAAACAAAAAGATACTAAATATACAGAAGTTAAATTCGAACTAGCCACAGAATCATTTGTTTTTATGTCAGAATTTGCAAAGAG
TGGAGTGGACAAAGCTCTGTATGGAAGACTGAACAACTGTAAATAGATGATATCCAAACTTAATTTGGCTAGGACTTCAATTTTAAAAAT
CAGTGTACCTAGGCAGTGCACAGCACGAAATAAGTGGCCCTTGCAGCTTCCCCGTTTAACCCACTGTGCTATAGTTGCGGGTGGAACAGT
CAACCTTTCTAGTAGTTTATGATATTGCCCTCTTTGTATTCCCATTTTCTACAGTTTTTTCCGCAGACTTCTTTCTGCAAATTATTCAGC
CTCCAAATGCAAATGAATGATATAAAAATAAGTAGGGAACATGGCAGAGAGTGGTGCTTCCCAGCCTCACAATGTGGGAATTTGACATAG
GATGAGAGTCAGAGTATAGGTTTAAAAGATAAAATCTTTAGTTAATAATTTTGTATTTATTTATTCTAGATGTATGTATCTGAGGAAAGA
AATCTGGTATTTTTGCTTTCCAATAAAGGGGATCAAAGTAATGGTTTTTCTCTCAGTTCTCTAAGCTGGTCTATGTTATAGCTCTAGCAG
TATGGAAATGTGCTTTAAAATATGCTTACCTTTTGAATGATCATGGCTATATGTTGTTGAGATATTTGAAACTTACCTTGTTTTCACTTG
TGCACTGTGAATGAACTTTGTATTATTTTTTTAAAACCTTCACATTACGTGTAGATATTATTGCAACTTATATTTTGCCTGAGCTTGATC
AAAGGTCATTTGTGTAGATGAGTAATTAAAAAATATTTAAATCACATTATAATTCTATTATTGGAGAGCATCTTTTAAATTTTTTTCTGT
TTTAACGAGGGAAAGAGAAACCTGTATACCTAGGGTCATTATTTGACCCCATAGTATAACCAGATTCATGGTCTAACAAGCTCTCAGTGT
GGCTTTTCTCTGAATGCTTGAATTTCACATGCCTTGCATTTCACAGTTGTACTCCATGGTCAACCGGTGCTTTTTTTCACATCGTGGTAC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361150_chr3_193409850_+_3479nt
TTAAAGCAGGAGCCTTGAGAGCCTGATAAGCTGTTGACACAAGTGCTTTTGAGAATAGCAGGAAGCCTGAGGGGAAGGAAGGAAGTACGG
GCGAAATCATCAGATTGGCTTCCCAGATTTGGGAATCTGAAGCGGGCCCACATCTTCCGGCCAACTTCCATTGAACTTCCCAGCACTCGA
AAGGGACCGAAATGGAGAGCAAAGAGAAAGTTAGAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAAA
TTAAAATCGTACTCATAATCAGCTCTGCATACATCTGAAGAACAAAAACATCAACGTCTTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCC
ACCTTTCTAAACATACAATAAAGTCATGGGATAAAAATAATCGATGTATGTTACGGGCGCTTTAACCATCAGCTGCCTCTCGAATGGAAG
AACAGTGGTAATGGATTAACATCCTATTTTGTTGTACTAAAGTGACAAATCGGAATAATATAATTGGTATGGCCATTAGGTTCAGTCCTT
GAAGATAAGAAACTTGTTCTCTGTTTGTTGTCTTATTTGTGGTGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAATGTTCAGTTTCT
TTTCCAGAAATACAATGCTAGGTGTTTTGAAATAAAACTTATATAGCAATTGTTTAAAGTTATCAATTGTATATAAAATCACAGTAGCCT
GCTAAATCATTGTATGTGTCTGTAGTATTCTATTCCCAGAAACTATTTGACCATGATAATTCAGTTTATATTCACCACATGAAAGAAAAA
TGGGTAACAGAAGAACCCTTAAAACAGGTTAATTTGGATTGTAACGTTCAGTGAAAGAAATTTCAACCCTTCATAGCCAGCGAAGAAATT
TGCCTTGGAAGCCAAGTCAGTACCAGCTTACCTATTTGATTCAGTTGCTGTTTTCTCACTCTCTATATCCATTTGAAATTGATTTATTTT
AGATGTTGTATACTTACGTTAGGCTTTCTGTTAATAGTGGTTTTTCTCCTGTTGACAGAGCCACCGGATTATGACACAGGATGAGGAAGA
TTAAGGATAATCAATTGACTAATTTCATTTAGAATATTATCAAACATTTCAACTAGGTATCAGAAAAAGGCTTTCTTTCATAAGACTATT
TTAAATAGAAATTATTTCAACAATTAAAGTAATGTTGACCATCCCCCTCTCAGCTGAATAAAGAAAAATTTAGTTCAATTTATTGCAATT
TAATTACAATACTACCTTCACAACATTTTCATGTGTTTTAAATAAATATTTTTTAATTGGCTAAAGGACATTCAAGCAAAGAAATGCTTT
CTTTACTTAAAATGTCTATCTCATTTGCTGCCTTTTCACTAAGCCTTTACTTTGTTAATAAAAGTGTCCATTGTGTGATGTTTTTGATTT
TACAGTTTGCTAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAACAGCCCCATTGCTACTCCCCATTTTATTGTTTTACATCAATGCATG
CTTCGTTGTGATCCCTCAAGATGTAACACTTGGTATGCTCGGTTGAGGATATGAAAAAATACTTCCGAAACCAGGAATTCAATGTATGTT
TGTTTTATACTGTTTGATAAGAAAAGTAGGTCCAGCCTTAAGCAGCACAGATGCGCTGGTAGATGCATAGTCAGGAACTTTTTTTATTTC
TTTTAGGTCTAGGGACAGGAGTGAATAGAAAGGGAGGAGAGCTCTATTATGTTCTATACACAGATTAGGAGATGACCTTACTGGGTACAC
CCCTCTAACCAGTGCTTACAGGTTAATGCATGTTAATGAATATTTTTGCAGTTGTAAAGCATAACAATTACAACTACACATCTATTTCTA
AAGAATAAAACAGGACCATATTTATTTACTTCTGTCAACTATAGAAAGAAAGACCTTCAGCTGTATTTCCACAGATTTCTCCCAAGGAAA
AGGCTAATATTAGTCACTACTGTTATCACATCCCTTTGTATAAGTTTTAAAAAGAGATGGAGGGAGATCTTCATTTCTTTGAGGAGATCA
GTATTGTAACGTATGTGAATAGATGATAACAATTAATATTACTAAAAGTCCCACATGAGAGTCCTGACGCCCTCTCCATGCCCCACAGTA
ATGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTTTTAGCTGATCTCATCCTAAGCATGCTTTATTTTTCCTTGAAAGCTAGGTATTTAT
CAACTGCAGATGTTATTGAAAGAAAATAAAATTCAGTCTCAAGAGTAAACCCTGTGTCTTGTGTCTGTAGTTCAAAAGTCAGAAATGATT
CTAATTTAAACAAAAAGATACTAAATATACAGAAGTTAAATTCGAACTAGCCACAGAATCATTTGTTTTTATGTCAGAATTTGCAAAGAG
TGGAGTGGACAAAGCTCTGTATGGAAGACTGAACAACTGTAAATAGATGATATCCAAACTTAATTTGGCTAGGACTTCAATTTTAAAAAT
CAGTGTACCTAGGCAGTGCACAGCACGAAATAAGTGGCCCTTGCAGCTTCCCCGTTTAACCCACTGTGCTATAGTTGCGGGTGGAACAGT
CAACCTTTCTAGTAGTTTATGATATTGCCCTCTTTGTATTCCCATTTTCTACAGTTTTTTCCGCAGACTTCTTTCTGCAAATTATTCAGC
CTCCAAATGCAAATGAATGATATAAAAATAAGTAGGGAACATGGCAGAGAGTGGTGCTTCCCAGCCTCACAATGTGGGAATTTGACATAG
GATGAGAGTCAGAGTATAGGTTTAAAAGATAAAATCTTTAGTTAATAATTTTGTATTTATTTATTCTAGATGTATGTATCTGAGGAAAGA
AATCTGGTATTTTTGCTTTCCAATAAAGGGGATCAAAGTAATGGTTTTTCTCTCAGTTCTCTAAGCTGGTCTATGTTATAGCTCTAGCAG
TATGGAAATGTGCTTTAAAATATGCTTACCTTTTGAATGATCATGGCTATATGTTGTTGAGATATTTGAAACTTACCTTGTTTTCACTTG
TGCACTGTGAATGAACTTTGTATTATTTTTTTAAAACCTTCACATTACGTGTAGATATTATTGCAACTTATATTTTGCCTGAGCTTGATC
AAAGGTCATTTGTGTAGATGAGTAATTAAAAAATATTTAAATCACATTATAATTCTATTATTGGAGAGCATCTTTTAAATTTTTTTCTGT
TTTAACGAGGGAAAGAGAAACCTGTATACCTAGGGTCATTATTTGACCCCATAGTATAACCAGATTCATGGTCTAACAAGCTCTCAGTGT
GGCTTTTCTCTGAATGCTTGAATTTCACATGCCTTGCATTTCACAGTTGTACTCCATGGTCAACCGGTGCTTTTTTTCACATCGTGGTAC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361715_chr3_193409850_+_3479nt
TTAAAGCAGGAGCCTTGAGAGCCTGATAAGCTGTTGACACAAGTGCTTTTGAGAATAGCAGGAAGCCTGAGGGGAAGGAAGGAAGTACGG
GCGAAATCATCAGATTGGCTTCCCAGATTTGGGAATCTGAAGCGGGCCCACATCTTCCGGCCAACTTCCATTGAACTTCCCAGCACTCGA
AAGGGACCGAAATGGAGAGCAAAGAGAAAGTTAGAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAAA
TTAAAATCGTACTCATAATCAGCTCTGCATACATCTGAAGAACAAAAACATCAACGTCTTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCC
ACCTTTCTAAACATACAATAAAGTCATGGGATAAAAATAATCGATGTATGTTACGGGCGCTTTAACCATCAGCTGCCTCTCGAATGGAAG
AACAGTGGTAATGGATTAACATCCTATTTTGTTGTACTAAAGTGACAAATCGGAATAATATAATTGGTATGGCCATTAGGTTCAGTCCTT
GAAGATAAGAAACTTGTTCTCTGTTTGTTGTCTTATTTGTGGTGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAATGTTCAGTTTCT
TTTCCAGAAATACAATGCTAGGTGTTTTGAAATAAAACTTATATAGCAATTGTTTAAAGTTATCAATTGTATATAAAATCACAGTAGCCT
GCTAAATCATTGTATGTGTCTGTAGTATTCTATTCCCAGAAACTATTTGACCATGATAATTCAGTTTATATTCACCACATGAAAGAAAAA
TGGGTAACAGAAGAACCCTTAAAACAGGTTAATTTGGATTGTAACGTTCAGTGAAAGAAATTTCAACCCTTCATAGCCAGCGAAGAAATT
TGCCTTGGAAGCCAAGTCAGTACCAGCTTACCTATTTGATTCAGTTGCTGTTTTCTCACTCTCTATATCCATTTGAAATTGATTTATTTT
AGATGTTGTATACTTACGTTAGGCTTTCTGTTAATAGTGGTTTTTCTCCTGTTGACAGAGCCACCGGATTATGACACAGGATGAGGAAGA
TTAAGGATAATCAATTGACTAATTTCATTTAGAATATTATCAAACATTTCAACTAGGTATCAGAAAAAGGCTTTCTTTCATAAGACTATT
TTAAATAGAAATTATTTCAACAATTAAAGTAATGTTGACCATCCCCCTCTCAGCTGAATAAAGAAAAATTTAGTTCAATTTATTGCAATT
TAATTACAATACTACCTTCACAACATTTTCATGTGTTTTAAATAAATATTTTTTAATTGGCTAAAGGACATTCAAGCAAAGAAATGCTTT
CTTTACTTAAAATGTCTATCTCATTTGCTGCCTTTTCACTAAGCCTTTACTTTGTTAATAAAAGTGTCCATTGTGTGATGTTTTTGATTT
TACAGTTTGCTAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAACAGCCCCATTGCTACTCCCCATTTTATTGTTTTACATCAATGCATG
CTTCGTTGTGATCCCTCAAGATGTAACACTTGGTATGCTCGGTTGAGGATATGAAAAAATACTTCCGAAACCAGGAATTCAATGTATGTT
TGTTTTATACTGTTTGATAAGAAAAGTAGGTCCAGCCTTAAGCAGCACAGATGCGCTGGTAGATGCATAGTCAGGAACTTTTTTTATTTC
TTTTAGGTCTAGGGACAGGAGTGAATAGAAAGGGAGGAGAGCTCTATTATGTTCTATACACAGATTAGGAGATGACCTTACTGGGTACAC
CCCTCTAACCAGTGCTTACAGGTTAATGCATGTTAATGAATATTTTTGCAGTTGTAAAGCATAACAATTACAACTACACATCTATTTCTA
AAGAATAAAACAGGACCATATTTATTTACTTCTGTCAACTATAGAAAGAAAGACCTTCAGCTGTATTTCCACAGATTTCTCCCAAGGAAA
AGGCTAATATTAGTCACTACTGTTATCACATCCCTTTGTATAAGTTTTAAAAAGAGATGGAGGGAGATCTTCATTTCTTTGAGGAGATCA
GTATTGTAACGTATGTGAATAGATGATAACAATTAATATTACTAAAAGTCCCACATGAGAGTCCTGACGCCCTCTCCATGCCCCACAGTA
ATGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTTTTAGCTGATCTCATCCTAAGCATGCTTTATTTTTCCTTGAAAGCTAGGTATTTAT
CAACTGCAGATGTTATTGAAAGAAAATAAAATTCAGTCTCAAGAGTAAACCCTGTGTCTTGTGTCTGTAGTTCAAAAGTCAGAAATGATT
CTAATTTAAACAAAAAGATACTAAATATACAGAAGTTAAATTCGAACTAGCCACAGAATCATTTGTTTTTATGTCAGAATTTGCAAAGAG
TGGAGTGGACAAAGCTCTGTATGGAAGACTGAACAACTGTAAATAGATGATATCCAAACTTAATTTGGCTAGGACTTCAATTTTAAAAAT
CAGTGTACCTAGGCAGTGCACAGCACGAAATAAGTGGCCCTTGCAGCTTCCCCGTTTAACCCACTGTGCTATAGTTGCGGGTGGAACAGT
CAACCTTTCTAGTAGTTTATGATATTGCCCTCTTTGTATTCCCATTTTCTACAGTTTTTTCCGCAGACTTCTTTCTGCAAATTATTCAGC
CTCCAAATGCAAATGAATGATATAAAAATAAGTAGGGAACATGGCAGAGAGTGGTGCTTCCCAGCCTCACAATGTGGGAATTTGACATAG
GATGAGAGTCAGAGTATAGGTTTAAAAGATAAAATCTTTAGTTAATAATTTTGTATTTATTTATTCTAGATGTATGTATCTGAGGAAAGA
AATCTGGTATTTTTGCTTTCCAATAAAGGGGATCAAAGTAATGGTTTTTCTCTCAGTTCTCTAAGCTGGTCTATGTTATAGCTCTAGCAG
TATGGAAATGTGCTTTAAAATATGCTTACCTTTTGAATGATCATGGCTATATGTTGTTGAGATATTTGAAACTTACCTTGTTTTCACTTG
TGCACTGTGAATGAACTTTGTATTATTTTTTTAAAACCTTCACATTACGTGTAGATATTATTGCAACTTATATTTTGCCTGAGCTTGATC
AAAGGTCATTTGTGTAGATGAGTAATTAAAAAATATTTAAATCACATTATAATTCTATTATTGGAGAGCATCTTTTAAATTTTTTTCTGT
TTTAACGAGGGAAAGAGAAACCTGTATACCTAGGGTCATTATTTGACCCCATAGTATAACCAGATTCATGGTCTAACAAGCTCTCAGTGT
GGCTTTTCTCTGAATGCTTGAATTTCACATGCCTTGCATTTCACAGTTGTACTCCATGGTCAACCGGTGCTTTTTTTCACATCGTGGTAC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000361908_chr3_193409850_+_3480nt
TTAAAGCAGGAGCCTTGAGAGCCTGATAAGCTGTTGACACAAGTGCTTTTGAGAATAGCAGGAAGCCTGAGGGGAAGGAAGGAAGTACGG
GCGAAATCATCAGATTGGCTTCCCAGATTTGGGAATCTGAAGCGGGCCCACATCTTCCGGCCAACTTCCATTGAACTTCCCAGCACTCGA
AAGGGACCGAAATGGAGAGCAAAGAGAAAGTTAGAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAAA
TTAAAATCGTACTCATAATCAGCTCTGCATACATCTGAAGAACAAAAACATCAACGTCTTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCC
ACCTTTCTAAACATACAATAAAGTCATGGGATAAAAATAATCGATGTATGTTACGGGCGCTTTAACCATCAGCTGCCTCTCGAATGGAAG
AACAGTGGTAATGGATTAACATCCTATTTTGTTGTACTAAAGTGACAAATCGGAATAATATAATTGGTATGGCCATTAGGTTCAGTCCTT
GAAGATAAGAAACTTGTTCTCTGTTTGTTGTCTTATTTGTGGTGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAATGTTCAGTTTCT
TTTCCAGAAATACAATGCTAGGTGTTTTGAAATAAAACTTATATAGCAATTGTTTAAAGTTATCAATTGTATATAAAATCACAGTAGCCT
GCTAAATCATTGTATGTGTCTGTAGTATTCTATTCCCAGAAACTATTTGACCATGATAATTCAGTTTATATTCACCACATGAAAGAAAAA
TGGGTAACAGAAGAACCCTTAAAACAGGTTAATTTGGATTGTAACGTTCAGTGAAAGAAATTTCAACCCTTCATAGCCAGCGAAGAAATT
TGCCTTGGAAGCCAAGTCAGTACCAGCTTACCTATTTGATTCAGTTGCTGTTTTCTCACTCTCTATATCCATTTGAAATTGATTTATTTT
AGATGTTGTATACTTACGTTAGGCTTTCTGTTAATAGTGGTTTTTCTCCTGTTGACAGAGCCACCGGATTATGACACAGGATGAGGAAGA
TTAAGGATAATCAATTGACTAATTTCATTTAGAATATTATCAAACATTTCAACTAGGTATCAGAAAAAGGCTTTCTTTCATAAGACTATT
TTAAATAGAAATTATTTCAACAATTAAAGTAATGTTGACCATCCCCCTCTCAGCTGAATAAAGAAAAATTTAGTTCAATTTATTGCAATT
TAATTACAATACTACCTTCACAACATTTTCATGTGTTTTAAATAAATATTTTTTAATTGGCTAAAGGACATTCAAGCAAAGAAATGCTTT
CTTTACTTAAAATGTCTATCTCATTTGCTGCCTTTTCACTAAGCCTTTACTTTGTTAATAAAAGTGTCCATTGTGTGATGTTTTTGATTT
TACAGTTTGCTAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAACAGCCCCATTGCTACTCCCCATTTTATTGTTTTACATCAATGCATG
CTTCGTTGTGATCCCTCAAGATGTAACACTTGGTATGCTCGGTTGAGGATATGAAAAAATACTTCCGAAACCAGGAATTCAATGTATGTT
TGTTTTATACTGTTTGATAAGAAAAGTAGGTCCAGCCTTAAGCAGCACAGATGCGCTGGTAGATGCATAGTCAGGAACTTTTTTTATTTC
TTTTAGGTCTAGGGACAGGAGTGAATAGAAAGGGAGGAGAGCTCTATTATGTTCTATACACAGATTAGGAGATGACCTTACTGGGTACAC
CCCTCTAACCAGTGCTTACAGGTTAATGCATGTTAATGAATATTTTTGCAGTTGTAAAGCATAACAATTACAACTACACATCTATTTCTA
AAGAATAAAACAGGACCATATTTATTTACTTCTGTCAACTATAGAAAGAAAGACCTTCAGCTGTATTTCCACAGATTTCTCCCAAGGAAA
AGGCTAATATTAGTCACTACTGTTATCACATCCCTTTGTATAAGTTTTAAAAAGAGATGGAGGGAGATCTTCATTTCTTTGAGGAGATCA
GTATTGTAACGTATGTGAATAGATGATAACAATTAATATTACTAAAAGTCCCACATGAGAGTCCTGACGCCCTCTCCATGCCCCACAGTA
ATGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTTTTAGCTGATCTCATCCTAAGCATGCTTTATTTTTCCTTGAAAGCTAGGTATTTAT
CAACTGCAGATGTTATTGAAAGAAAATAAAATTCAGTCTCAAGAGTAAACCCTGTGTCTTGTGTCTGTAGTTCAAAAGTCAGAAATGATT
CTAATTTAAACAAAAAGATACTAAATATACAGAAGTTAAATTCGAACTAGCCACAGAATCATTTGTTTTTATGTCAGAATTTGCAAAGAG
TGGAGTGGACAAAGCTCTGTATGGAAGACTGAACAACTGTAAATAGATGATATCCAAACTTAATTTGGCTAGGACTTCAATTTTAAAAAT
CAGTGTACCTAGGCAGTGCACAGCACGAAATAAGTGGCCCTTGCAGCTTCCCCGTTTAACCCACTGTGCTATAGTTGCGGGTGGAACAGT
CAACCTTTCTAGTAGTTTATGATATTGCCCTCTTTGTATTCCCATTTTCTACAGTTTTTTCCGCAGACTTCTTTCTGCAAATTATTCAGC
CTCCAAATGCAAATGAATGATATAAAAATAAGTAGGGAACATGGCAGAGAGTGGTGCTTCCCAGCCTCACAATGTGGGAATTTGACATAG
GATGAGAGTCAGAGTATAGGTTTAAAAGATAAAATCTTTAGTTAATAATTTTGTATTTATTTATTCTAGATGTATGTATCTGAGGAAAGA
AATCTGGTATTTTTGCTTTCCAATAAAGGGGATCAAAGTAATGGTTTTTCTCTCAGTTCTCTAAGCTGGTCTATGTTATAGCTCTAGCAG
TATGGAAATGTGCTTTAAAATATGCTTACCTTTTGAATGATCATGGCTATATGTTGTTGAGATATTTGAAACTTACCTTGTTTTCACTTG
TGCACTGTGAATGAACTTTGTATTATTTTTTTAAAACCTTCACATTACGTGTAGATATTATTGCAACTTATATTTTGCCTGAGCTTGATC
AAAGGTCATTTGTGTAGATGAGTAATTAAAAAATATTTAAATCACATTATAATTCTATTATTGGAGAGCATCTTTTAAATTTTTTTCTGT
TTTAACGAGGGAAAGAGAAACCTGTATACCTAGGGTCATTATTTGACCCCATAGTATAACCAGATTCATGGTCTAACAAGCTCTCAGTGT
GGCTTTTCTCTGAATGCTTGAATTTCACATGCCTTGCATTTCACAGTTGTACTCCATGGTCAACCGGTGCTTTTTTTCACATCGTGGTAC

>In-frame_FGF12_ENST00000450716_chr3_192444970_-_OPA1_ENST00000392438_chr3_193409850_+_3492nt
TTAAAGCAGGAGCCTTGAGAGCCTGATAAGCTGTTGACACAAGTGCTTTTGAGAATAGCAGGAAGCCTGAGGGGAAGGAAGGAAGTACGG
GCGAAATCATCAGATTGGCTTCCCAGATTTGGGAATCTGAAGCGGGCCCACATCTTCCGGCCAACTTCCATTGAACTTCCCAGCACTCGA
AAGGGACCGAAATGGAGAGCAAAGAGAAAGTTAGAGAAATTCAAGAAAAACTTGATGCTTTCATTGAAGCTCTTCATCAGGAGAAATAAA
TTAAAATCGTACTCATAATCAGCTCTGCATACATCTGAAGAACAAAAACATCAACGTCTTTTGTCCAGCCTCTTTTTCTTCTGCTGTTCC
ACCTTTCTAAACATACAATAAAGTCATGGGATAAAAATAATCGATGTATGTTACGGGCGCTTTAACCATCAGCTGCCTCTCGAATGGAAG
AACAGTGGTAATGGATTAACATCCTATTTTGTTGTACTAAAGTGACAAATCGGAATAATATAATTGGTATGGCCATTAGGTTCAGTCCTT
GAAGATAAGAAACTTGTTCTCTGTTTGTTGTCTTATTTGTGGTGGCACTCGTTTAATGGATTAACTGAGGTTGCTCAATGTTCAGTTTCT
TTTCCAGAAATACAATGCTAGGTGTTTTGAAATAAAACTTATATAGCAATTGTTTAAAGTTATCAATTGTATATAAAATCACAGTAGCCT
GCTAAATCATTGTATGTGTCTGTAGTATTCTATTCCCAGAAACTATTTGACCATGATAATTCAGTTTATATTCACCACATGAAAGAAAAA
TGGGTAACAGAAGAACCCTTAAAACAGGTTAATTTGGATTGTAACGTTCAGTGAAAGAAATTTCAACCCTTCATAGCCAGCGAAGAAATT
TGCCTTGGAAGCCAAGTCAGTACCAGCTTACCTATTTGATTCAGTTGCTGTTTTCTCACTCTCTATATCCATTTGAAATTGATTTATTTT
AGATGTTGTATACTTACGTTAGGCTTTCTGTTAATAGTGGTTTTTCTCCTGTTGACAGAGCCACCGGATTATGACACAGGATGAGGAAGA
TTAAGGATAATCAATTGACTAATTTCATTTAGAATATTATCAAACATTTCAACTAGGTATCAGAAAAAGGCTTTCTTTCATAAGACTATT
TTAAATAGAAATTATTTCAACAATTAAAGTAATGTTGACCATCCCCCTCTCAGCTGAATAAAGAAAAATTTAGTTCAATTTATTGCAATT
TAATTACAATACTACCTTCACAACATTTTCATGTGTTTTAAATAAATATTTTTTAATTGGCTAAAGGACATTCAAGCAAAGAAATGCTTT
CTTTACTTAAAATGTCTATCTCATTTGCTGCCTTTTCACTAAGCCTTTACTTTGTTAATAAAAGTGTCCATTGTGTGATGTTTTTGATTT
TACAGTTTGCTAAATCTTATTTTCTTGGAGTTGCTTTTTGGTAACAGCCCCATTGCTACTCCCCATTTTATTGTTTTACATCAATGCATG
CTTCGTTGTGATCCCTCAAGATGTAACACTTGGTATGCTCGGTTGAGGATATGAAAAAATACTTCCGAAACCAGGAATTCAATGTATGTT
TGTTTTATACTGTTTGATAAGAAAAGTAGGTCCAGCCTTAAGCAGCACAGATGCGCTGGTAGATGCATAGTCAGGAACTTTTTTTATTTC
TTTTAGGTCTAGGGACAGGAGTGAATAGAAAGGGAGGAGAGCTCTATTATGTTCTATACACAGATTAGGAGATGACCTTACTGGGTACAC
CCCTCTAACCAGTGCTTACAGGTTAATGCATGTTAATGAATATTTTTGCAGTTGTAAAGCATAACAATTACAACTACACATCTATTTCTA
AAGAATAAAACAGGACCATATTTATTTACTTCTGTCAACTATAGAAAGAAAGACCTTCAGCTGTATTTCCACAGATTTCTCCCAAGGAAA
AGGCTAATATTAGTCACTACTGTTATCACATCCCTTTGTATAAGTTTTAAAAAGAGATGGAGGGAGATCTTCATTTCTTTGAGGAGATCA
GTATTGTAACGTATGTGAATAGATGATAACAATTAATATTACTAAAAGTCCCACATGAGAGTCCTGACGCCCTCTCCATGCCCCACAGTA
ATGTGGCTTCTTTCATGGGTTTTTTTTTCTTCTTTTTAGCTGATCTCATCCTAAGCATGCTTTATTTTTCCTTGAAAGCTAGGTATTTAT
CAACTGCAGATGTTATTGAAAGAAAATAAAATTCAGTCTCAAGAGTAAACCCTGTGTCTTGTGTCTGTAGTTCAAAAGTCAGAAATGATT
CTAATTTAAACAAAAAGATACTAAATATACAGAAGTTAAATTCGAACTAGCCACAGAATCATTTGTTTTTATGTCAGAATTTGCAAAGAG
TGGAGTGGACAAAGCTCTGTATGGAAGACTGAACAACTGTAAATAGATGATATCCAAACTTAATTTGGCTAGGACTTCAATTTTAAAAAT
CAGTGTACCTAGGCAGTGCACAGCACGAAATAAGTGGCCCTTGCAGCTTCCCCGTTTAACCCACTGTGCTATAGTTGCGGGTGGAACAGT
CAACCTTTCTAGTAGTTTATGATATTGCCCTCTTTGTATTCCCATTTTCTACAGTTTTTTCCGCAGACTTCTTTCTGCAAATTATTCAGC
CTCCAAATGCAAATGAATGATATAAAAATAAGTAGGGAACATGGCAGAGAGTGGTGCTTCCCAGCCTCACAATGTGGGAATTTGACATAG
GATGAGAGTCAGAGTATAGGTTTAAAAGATAAAATCTTTAGTTAATAATTTTGTATTTATTTATTCTAGATGTATGTATCTGAGGAAAGA
AATCTGGTATTTTTGCTTTCCAATAAAGGGGATCAAAGTAATGGTTTTTCTCTCAGTTCTCTAAGCTGGTCTATGTTATAGCTCTAGCAG
TATGGAAATGTGCTTTAAAATATGCTTACCTTTTGAATGATCATGGCTATATGTTGTTGAGATATTTGAAACTTACCTTGTTTTCACTTG
TGCACTGTGAATGAACTTTGTATTATTTTTTTAAAACCTTCACATTACGTGTAGATATTATTGCAACTTATATTTTGCCTGAGCTTGATC
AAAGGTCATTTGTGTAGATGAGTAATTAAAAAATATTTAAATCACATTATAATTCTATTATTGGAGAGCATCTTTTAAATTTTTTTCTGT
TTTAACGAGGGAAAGAGAAACCTGTATACCTAGGGTCATTATTTGACCCCATAGTATAACCAGATTCATGGTCTAACAAGCTCTCAGTGT
GGCTTTTCTCTGAATGCTTGAATTTCACATGCCTTGCATTTCACAGTTGTACTCCATGGTCAACCGGTGCTTTTTTTCACATCGTGGTAC


Top

FusionGenePPI for FGF12_OPA1


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
FGF12MAPK13, MAPK8IP2, NEDD4, NEDD4L, APP, SRPK2, SRPK1, DACH1, DCTD, COIL, IKZF1, ZNF460, LZTS2, DPPA2, SMURF1, YWHAEOPA1MME, ELAVL1, CUL3, CAND1, SMAD2, SMAD3, APP, ILF3, NDUFS8, DNASE2, ECH1, NDUFS1, NIT2, HSP90AA5P, NDUFA9, HADHB, NPTX1, HTRA2, MYC, PARK2, EGFR, BNIP3, PRDX3, SCGN, SCN2B, UNK, ARHGAP17, EEF2, EHD1, NTRK1, XRCC3, MCM2, COQ9, PTPN7, VIPR2, FAM196A, NPY2R, PTH1R, FAM174A, EPHA1, GID8


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for FGF12_OPA1


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for FGF12_OPA1


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
TgeneOPA1C0338508Optic Atrophy, Autosomal Dominant21CTD_human;ORPHANET;UNIPROT
TgeneOPA1C3276549OPTIC ATROPHY WITH OR WITHOUT DEAFNESS, OPHTHALMOPLEGIA, MYOPATHY, ATAXIA, AND NEUROPATHY10UNIPROT
TgeneOPA1C0036341Schizophrenia2PSYGENET
TgeneOPA1C0029408Degenerative polyarthritis1CTD_human
TgeneOPA1C0221061Behr syndrome1ORPHANET;UNIPROT
TgeneOPA1C4225163MITOCHONDRIAL DNA DEPLETION SYNDROME 14 (CARDIOENCEPHALOMYOPATHIC TYPE)1UNIPROT