FusionGDB Logo

Home

Download

Statistics

Examples

Help

Contact

Center for Computational Systems Medicine
leaf

FusionGeneSummary

leaf

FusionProtFeature

leaf

FusionGeneSequence

leaf

FusionGenePPI

leaf

RelatedDrugs

leaf

RelatedDiseases

Fusion gene ID: 11323

FusionGeneSummary for EIF4E_UBXN7

check button Fusion gene summary
Fusion gene informationFusion gene name: EIF4E_UBXN7
Fusion gene ID: 11323
HgeneTgene
Gene symbol

EIF4E

UBXN7

Gene ID

1977

26043

Gene nameeukaryotic translation initiation factor 4EUBX domain protein 7
SynonymsAUTS19|CBP|EIF4E1|EIF4EL1|EIF4F|eIF-4EUBXD7
Cytomap

4q23

3q29

Type of geneprotein-codingprotein-coding
Descriptioneukaryotic translation initiation factor 4EeIF-4F 25 kDa subuniteukaryotic translation initiation factor 4E-like 1mRNA cap-binding proteinUBX domain-containing protein 7UBX domain containing 7
Modification date2018052220180519
UniProtAcc

P06730

O94888

Ensembl transtripts involved in fusion geneENST00000450253, ENST00000280892, 
ENST00000504432, ENST00000505992, 
ENST00000504472, 
ENST00000296328, 
ENST00000428095, ENST00000535858, 
Fusion gene scores* DoF score2 X 2 X 1=43 X 3 X 1=9
# samples 23
** MAII scorelog2(2/4*10)=2.32192809488736log2(3/9*10)=1.73696559416621
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Context

PubMed: EIF4E [Title/Abstract] AND UBXN7 [Title/Abstract] AND fusion [Title/Abstract]

Functional or gene categories assigned by FusionGDB annotation
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneEIF4E

GO:0006417

regulation of translation

22578813


check button Fusion gene information from three resources
(ChiTars (NAR, 2018), tumorfusions (NAR, 2018), Gao et al. (Cell, 2018))
* All genome coordinats were lifted-over on hg19.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
Data typeSourceCancer typeSampleHgeneHchrHbpHstrandTgeneTchrTbpTstrand
ChiTaRS3.1DA724990EIF4Echr4

99823025

-UBXN7chr3

196134267

-
* LD: Li Ding group's fusion gene list
  RV: Roel Verhaak group's fusion gene list
  ChiTaRs fusion database

check button Open reading frame (ORF) analsis of fusion genes based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.
ORFHenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrand
Frame-shitENST00000450253ENST00000296328EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000450253ENST00000428095EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000450253ENST00000535858EIF4Echr4

99823025

-UBXN7chr3

196134267

-
Frame-shitENST00000280892ENST00000296328EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000280892ENST00000428095EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000280892ENST00000535858EIF4Echr4

99823025

-UBXN7chr3

196134267

-
In-frameENST00000504432ENST00000296328EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000504432ENST00000428095EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000504432ENST00000535858EIF4Echr4

99823025

-UBXN7chr3

196134267

-
Frame-shitENST00000505992ENST00000296328EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000505992ENST00000428095EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5CDS-intronENST00000505992ENST00000535858EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5UTR-3CDSENST00000504472ENST00000296328EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5UTR-intronENST00000504472ENST00000428095EIF4Echr4

99823025

-UBXN7chr3

196134267

-
5UTR-intronENST00000504472ENST00000535858EIF4Echr4

99823025

-UBXN7chr3

196134267

-

Top

FusionProtFeatures for EIF4E_UBXN7


check buttonMain function of each fusion partner protein. (from UniProt)
HgeneTgene
EIF4E

P06730

UBXN7

O94888

Recognizes and binds the 7-methylguanosine-containingmRNA cap during an early step in the initiation of proteinsynthesis and facilitates ribosome binding by inducing theunwinding of the mRNAs secondary structures. Component of theCYFIP1-EIF4E-FMR1 complex which binds to the mRNA cap and mediatestranslational repression. In the CYFIP1-EIF4E-FMR1 complex thissubunit mediates the binding to the mRNA cap.{ECO:0000269|PubMed:16271312, ECO:0000269|PubMed:22578813}. Ubiquitin-binding adapter that links a subset of NEDD8-associated cullin ring ligases (CRLs) to the segregase VCP/p97, toregulate turnover of their ubiquitination substrates.{ECO:0000269|PubMed:22537386}.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, because of limited space for viewing, we only show the protein feature retention information belong to the 13 regional features. All retention annotation result can be downloaded at

download page

.

* Minus value of BPloci means that the break pointn is located before the CDS.
- In-frame and retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

- In-frame and not-retained protein feature among the 13 regional features.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note


Top

FusionGeneSequence for EIF4E_UBXN7


check button For in-frame fusion transcripts, we provide the fusion transcript sequences and fusion amino acid sequences.
(nt: nucleotides, aa: amino acids)

* Fusion amino acid sequences.

* Fusion transcript sequences (only coding sequence (CDS) region).

* Fusion transcript sequences (Full-length transcript).
>In-frame_EIF4E_ENST00000504432_chr4_99823025_-_UBXN7_ENST00000296328_chr3_196134267_-_10840nt
AGATCGATCTAAGATGGCGACTGTCGAACCGGGTGCTGTGAGGAAATGCATGGTTTGTTGAAAAGAACTGAGGACTGACAGCCGCCTCCT
CCATGATTACCCTGGCTCTCTGTCCCACCCTTCTCATGGCGCTTGGGGGACCATGGCTGATCCTGTCCTGAGACAAATTAAGACTCCTGT
GGTGAAGCAGTTGGTCGAGAAAAAGTGATGCATGAAAAAGAAGCAAAACAAGAAGGAAAGAAAAAAAATGAGAGCTGAAGATGGTGAAAA
TGATGCCATTAAAAAGCAGGCAGAAAGTCTGCGAGAATCCCAGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAGGAGAAAAC
GGAATCTAATCAGGAGGTTGCTAACCCAGAACACTATATTAAACATCCCCTACAGAACAGGTGCAAGTGAAAGTGTAGGAAAACATATGC
TTGAAGCGTGCAACAATAATCTGGAAATGGCAGTCACTATGTTTTTGGATGGTGGAGGAATCGCTGAAGAGCCCAGTACCAGTTCAGCAA
GTGTCTCTACTGTCAGACCACACACAGAAGAAGAAGTTCGTGCCCCAATTCCTCAAAAGCAGGAAATACTGGTGGAACCAGAACCATTAT
TTGGTGCTCCTAAAAGACGACGGCCTGCACGTTCAATTTTTGATGGTTTCCGGGATTTTCAGACTGAAACTATTCGGCAAGAACAAGAAT
TAAGAAATGGAGGAGCTATCGATAAGAAATTAACTACCCTTGCAGATCTATTCCGGCCACCCATTGATTTGATGCATAAAGGCAGCTTTG
AAACAGCCAAAGAGTGTGGCCAGATGCAAAATAAGTGGCTGATGATAAACATTCAAAATGTTCAAGACTTTGCATGTCAGTGCCTCAACC
GCGATGTGTGGAGCAACGAAGCTGTGAAGAATATTATCCGGGAACATTTCATTTTCTGGCAGGTTTATCATGACAGTGAGGAAGGTCAGA
GATACATACAGTTTTATAAGTTAGGGGATTTCCCCTATGTTTCCATATTGGACCCACGGACAGGTCAGAAGCTAGTAGAATGGCACCAGT
TAGATGTATCTTCTTTCTTGGACCAAGTGACGGGATTTCTGGGTGAACATGGACAACTGGATGGACTTTCTAGCAGTCCCCCCAAAAAAT
GTGCCCGTTCAGAGAGCCTTATAGATGCAAGTGAAGACAGCCAGCTAGAAGCTGCCATCAGAGCCTCCTTACAAGAAACACATTTTGATT
CAACACAGACAAAACAGGATAGCCGCTCAGATGAAGAATCTGAATCTGAACTTTTTTCTGGCAGTGAGGAGTTCATATCCGTTTGTGGCT
CTGATGAAGAAGAAGAGGTAGAGAATCTTGCCAAGTCCAGAAAGTCTCCCCACAAAGATTTGGGGCATAGAAAAGAGGAGAATAGAAGGC
CGCTGACTGAGCCACCAGTCAGAACTGATCCTGGAACAGCCACAAACCACCAAGGATTGCCAGCTGTGGATTCAGAGATACTGGAGATGC
CACCTGAAAAAGCAGATGGAGTAGTGGAGGGGATAGATGTAAATGGACCAAAAGCACAGCTGATGTTGCGGTATCCAGATGGAAAAAGGG
AACAGATCACTCTTCCAGAGCAAGCTAAACTGCTAGCTTTGGTGAAGCACGTGCAGTCTAAAGGATACCCAAATGAACGTTTTGAACTTC
TCACCAACTTTCCTCGAAGGAAATTATCTCATCTGGACTATGATATTACATTGCAAGAGGCAGGCCTTTGTCCTCAAGAGACTGTCTTTG
TACAGGAAAGAAATTAACACCATGGCTTGACCTCTCTCAGCTTACCCCTTTTTTCCCTTTTCCTGTGAGATACATGTCACTAAGTATGCA
TTTTGGCTCATAGGACCACAGAGCCAAAGTTGGGCAAGCAAGTCACCTTCCTTCTCTTATTTCTTGATCTCTCCTATAATCAGTCTCTTT
CTCCCCCTTTGTTTCTTTCTCCTCTTCTGTTTTCTCGCTCCCCACTCCGTACCCTTCTGCCTCCCCCTCCCCCCACACTTTTCTTTCTTA
CCTAATCTGGTGACCAAACTGAAGTGTAAGGATAAGACCTCTCCTAGTACTAGCAGCAGGAATTGTGTGTTCCAGTAAGTGGTCTCTTGC
ACGGCACTTTTTTGGGATCAAATGTTAACGTTACTCCCCAGACTCTTCGGGCAAAGGAATGGCTAGATTCAGAGTAAGAACAACCCTCCC
TTTTTTGTAAGTCCCCGTGTTTAGCAGGGAGAAGAAATTCTCTAACATGGGTTTGGTTTTGTTGTGTTCTTCATGTGGAAATGTCGCTTA
ACAAAATATCCAGGCTTTTGTTTACGTGGAAAAAGCATCCCTTGTAATGATTGCTCATCATACTTAAAAACCTTTTTCAAAGGATTTTCA
TGTTCCCAGCTATAAGGACTATTTCCATGACATGTGTTATTGGCAGAATGAGTGTTAAATATGGAGCATATAGCATGGGGTGACTTTCAT
TGTCCTAACCTGAGACAGTTTTCCTTATTACTCTGTATTGATCCTGCTAGTCCAAGAATGGACATGAAGTGAACCTATCGTGGTGACTGG
GATAGGAAGGTGCTTGCTATTTTTGCCAGCACAGCATATTAGTTCCTTTGGAGCCCTCCATTGTCTGAGTCTGCAGTGATCTGTAGGAAG
GCAGCTGGTCAATAATCATGTAGTACAATGGCTTGGAATTGTAACCACTATGGTTATTGATTGTCCTGTGTTGTTTCAGGCATACTTAGG
TATGTCCCTGGGGAAAAAGAAAACCATTCAGCTGAGAGTTGCTAACCATGTTCTTTTGGTTAGAAATAATGGTTCATTTTTTGCCCCTGG
TTGGAATAGTCTCTAAAAGGCTCTGGTGACTGAATTGAACATGAGTCCGCATGCTGTTTTCTTTCAAAAGGTATCAAAACGGAAAGCCTC
TCTAAGGGGAAGACCTTTCAACTCCATTCAGAAGACAACATTTAGTAAGGAGGATGGCGGAGGTTACTAGTAATTTTCAGATGTCTTGGG
CTTTTTCTGCCAACAAAACCCAAAATCAAATTAGAGTTGGTGAAAGCTTTCTTCAGTGTTTTTAGAAGAGGCCATCTTGAATCTGTAGAA
TACCATTTACACATCAACTTCACCCTATGCTCATTTCGTATTTTGAGCTTAAATGGAGTCCTCTGAAGGGGGGGTAGTCGTGATTCTGGT
GGCAAAACTAGAACTTTTAACTTGTAAAATGAAAAATATTAAATGGACCTTTTTGTCAGTTGAGGATTTAGATTGATTCTTTTATCTGAG
GAGCGTATGTTCCTCAGATGTTGCGTAGAGACCTTTAGGTTTTCATCTACTTTAAGATTGCTCTCTTGGCAATTAGGGGATTTGGGAAAA
GAAGAAAAAAAGATGCCATGTGTTGCTAGTACACAGTTATAGGATATGGTTTCTAATGGTTGAATTTTGAGGAACTCTCCCTAAAGAATG
AGTTTTATATCTCCTCAAGGAAATCATGGAAAAATCTGTTTATTCTTCAGTGAGTCCTTTTGAATTAATGTTCTTAAATTTTTTTCTAAG
TCTGTGTAAGTGCTTATGTATAAGTATATAATTGTATAAATATTTATAAATATATTTATATAATTACGGTTTCATTTCTACCTTGAGTCA
AAGTTCTGTCTTTAGATTGGTGACTGAGTAATACTTACACTTTGGTGTTTTTTCTTAGGTTCTTGAGGCTTACTTAACTAGCAGCTTCTG
ATTTATTGAGTGAAAGATGGTTTTCATGTTAATTCCTCAGTTGCATCTCTGAACTTGGATAACATACTTGCCGTTTGAAAAATAGAGCTG
TATACTGTCAAAGGTGCACTGGAGGGTAAAACATTTGTTGGTAGTAGACAAGCTCAGAAATCCAAAAATTCAGGGAGGGCACAGGGTAAG
AAGAGAGGTTTGCTCAGCTTTGTGCTCTGATGGCACCCATCTGTACTCCAGCAAAGTCATAGCTGAAGCCCAAATCGCTCAAACGTGTGA
AGTCAATCATTTTTCCTATAGGGCTCTGTTTCCTTTTCTTTACCTTCTAGCTTCTCTTGATAAAACAGTTGGGAGAACTGCCAACGTGTT
CATCAGTGAGAGGGTGTGGTTCTTTCCGATATGTTCAGCACGTGCATATTCATTTATGAGAAACCAAAGTAACTTCTTCAACTCGGGTTA
CTGTGGGATGATTAAGTAGATATAAAGTGATTTAAAAGACAGCATGGTACTTTCACTCAGCTTAACATGCAGCTGGGATGTCTACAATAC
AAGATGTGGTGGGTTTTATTTTATTTTATTTTGAGGCAGGAGTGTAATTATCTTAGGGTTGATATAAAGGCCCATGGGAAGAGTTACGGA
TTGTACATGGGAAGAATCCATAAGGAGTATTGCCTTGCTCAAGAATTTAATCCGCTGACAGTATGCTTCTTCCAGTTTGCCTTACTTCCT
CTGCAAGTTTCTTTGCTCCTTAGGGCAGAGGTTTTATTGAATAGATTAAATGAGGTCAGTAAGATTAGTTAAAAATAGTCATTCCTTGTG
GGTGTTGGACACAGCTTGAAAGGAGTGTTTAAAAAAAAAAAGCTAGGGAGGAAAAGAACAAGAAAGATAGACTTCGAGAGTGATAAGAGA
AAAATACAGGGAGATGGAATGGAAACTACCAGGAAGGCCGGGCGCGGTGGCTCATGCCTGTAATCCCAACACTTTGGGAGGCGGAGGTGG
GCAGATCACCTAAGGTCAGGAGATCGAGGCCAGCCTGAGCAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAATTACCTGGGTGT
GGTGGCGTGCACCTGTAATCCCAGCTACTCAGAGGCTGAGGCAGGGGAATGGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCAAGAT
CGCACCATTACACTCCAGCCTGGGCGACAAAGCGACACTCCATCTCAAATTTAAAAAAAAAAAAGAAGAAGAAGAAGAAAACTAGTGGGA
AAAAAGTGAGAGGAATACTTTTTTGAAATTGGTATCGGAAGGAACTGGAGAAGAGAAAACAACAGTGCCAAATGAGAAAAGAACAGGAAA
CTTAATACTAATTGGCATGCACCAGATACTTTTGTGTACATTTGCCTCTTCAATCTCCCGAAGAATCGTACAAAATGTATACTTTCTTCC
CATGTTAAGAAAACAGGTATAGAGAACTTATTCAGGACTCATAGCTAGTGAGTGGCAAATCAGAATTGGAATCCAGAGTCCATGCTGTGG
TCTCCTTCAGCAAGAGAATCAAGCTACCCAGATGATTCTCTTCTCATTGTTTGGCTTTGTAAAGTGTCACTTAGTTTTGTTCCCATAAAT
ATAGAGGAAGTAGTTGGGTTAAAGTTGTGGGATTTGCACTATGCCTATACATTTTTATTTATGCCATTATTTTGAGAGGCTGATTATTGC
TTTTTTAAAATGATGCACTGGTGAAGATGTGAAAGTAAAATTGCCACGTGGCATTATTTGCCAAGAATAAATGAAAAGGGTAAAAAAACA
ATTTTTTCTTTTTTTAAACATTTTTCAGAAAAGATACAATTACCTTTTTTAATAGGTGAGCGCCACCACGCCCGGCTAATTTTTGCATTT
TTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGATGGTCTCGATCTCTTGATCTCGTGTTCCGCCCACCTCGGCCTCCTAAAGTGCTGG
GATTACAGGCATGAGCCACTGCGCCCGATCTACAATTCTGTTTTCTGTGTCCCATCCATACCAGATTATTGAACCCTCTGTGTGTATGTT
TTTAAATCTTGTATATAATTCTACTTCCTTGACTTACAAGTCAACAATTAGCTATTGAGTTCTTTATAGAAGTTGGAAGTATTTTGAAAT
CTGAGATCTAATTCCTGGCCAGGTGTGGTGGCTCATGCCTGTAATCCCAATATTTTGGGAGGCCGAGGTGGGTGGATCACCTGAGGTTGG
GAGTTCGAGATCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTGAAAAATACAAAAATTAGCCAGGCATGGTGGCTGTCTGTAATCC
CAGCTAATGGGGAGGCTGAGGCACAAGAATCTCTTGAACCTGGGAGGCGGAGGTTGCAGTGAGCCGAGATCACACCACTGCACTCCATCC
TGGGCAATGGAGCGAGACTCTGTCTCAAAAAATAATAAATAAGATATGATTCCTGCCTGTTTTATCCAGTTAGAGAGACACACTACACAT
GAAATAATTGGAGAGCATGTAAATGTTTACCTATTAGTTCAAACTTAGAAAAAGGGAAGAATATGTTTTAGTTAGCAAAGTCTTAAACAA
GACTGAAGTGGCAAGCACTGTAGCTCACGTTTTCTTTTGACTCACCTTTTTCTTTAGCTCCACCTTTTGTAACTTCTAGATTTGGGGCAT
GAAGTTCTGCCACTAAGGCATAACCAGTACCCAAGTAGGAAAGGATTATTGATCCCTGGAGTAAAGATTCCTAGCTTGCGGGGATCTCAC
TATTGATCCCCCGGAGTAAAGATTCCTAGCTCGCAGGAATCTTACTTGCACACTTAGGGAAAATACCAGAGGGAGCCACTAGCAACCGAA
AAATGAAGGAAAGATTTAATTTCTCTACCCAGGTACAAATCCAATGCATAGTATAGTATATGTTATATGCAGAAAGGGCACTGGAGGTGT
GAGAGCCCTTTGGGTAACAGCTCTGCTAGTTGTTACCTTCACACTTCTCTTTCTTCTTAATCTCTGGTTTCTCGTCTGAAAAATGAGATA
ATTGGACTAGATTAATAGTTCTCAGCCTTTTCTAGAACAACAAATTAGATTATCTCTGAAGTCCTTTTCCAAAATTTCATGCTTCCAGTC
TCTCCCCGTGATTGCGTATTATCCCTAGGCTAATTAAAAGTGTGCTGGTTAATCAGTTTCTTTACTTTTTTTTTCTCTCTTTTTTTTATT
CTGTGTTCAGGTATCATTTGACCAACAACTTGCTCTTAATCTTACTGCGATGACTGAAATCTCCAAAGAGGAGAGTATAGTAGTTATAGG
TCTAGTAATAATAATCTTGTAAACAATTCATTATTTTTTAAAACTTAATGCTGTGTGCCTAATCAGTGTTGAGTATGACTAAAATGTAAA
TGAGAACCAAATATGACACTAACGCTGGCACTAAATTTTATTTTTACTTGTGTACTTAAAGTACTTTACTGGCCTGTTGGGAAATTGATT
TGTATAAGATTCACACCTGGTTTTGGCAGAAACAGCTTTTTAAAGATACAATTAGGCTGACTTAAAAATGTTTTTTATTCCACAGAATGT
ATCTTTATTATGTCATTCTTACCGTCTCTCTGCCTTTTTTGACCATCATGTAACTACGCAGTAGTAAATCATGGGGTGCAGGCTGATGAA
TTAGTAGTCTTTGTAAAACTAAAATGTAATGAGCATAGGAAGAGACAGCTCTTCTGGTGAACATGGCAGTTTTCCGGTAATACCAGCCTT
GATGAATAGGCTAAAGACAGCTGTGTACTATGGACATTCAACTTCACTGGATTGCCTGGCTTAGCTTTTCAGTTATTGTCTTGCCGTGAA
ACATGGTGTTGCACTGTACACATTTTAGAATAGTGGCAAGAATGTTCTTTAGAACTGCAGATAACCCAACAGAGAATACCATACCAATAT
ATCGGTTTCTCCTGTTACATAGAGATTTGGTATTTCAGTGATGGTTATGGTTTTTGACTCACCTGTGTGTCAGTCCTGCTAGAGAGACAG
TATAGAATCAAGAATTTCTTGATGTCTTTTTAAAAATAGAGATTATAATGGCCTTGCTAGTTGTCCTGTGAAGTGACAGACCCTTAATTA
GAAATCTTTTAATCCTGCTTTCCATTTTACTTCTCCACCATTTATTTTTAACATTCATTCTCTGAAAATAGTTATGATTTTTAGTGTAAT
TGGCTATGTTTAAGAAATTCCATTTCAAAGTCTTAATATGTAACAATCTTCATTTTTTATAAAATTGAAGGACATTTTTGAGGCAAACTT
ACTTTTATAGCTCATTTTCTCCCTAGTTAAGGAGAATTCTCTGGTTTCATATAGAGAATGGCTAGCTCTGTGATACCCCACCCTCTTTGT
GGCCTACCAGTTGCTGTTGTGTTGCTTAAAATTGCAGATATTCTCATAAACATGATGATTTTTGGCACAGGCCTTTCTTTGCTATTGATT
TCAAAATAAAGTTGGGCAATCCAATTTGAACTACTTTAATAAACATAATTTAGCATTCCTGTAATGAGAAAGTATTTTCAAAAGATAACC
AGATTTATTTCTAGGATTAGAGATGGCAAATACCAATGATAGTATTTTTCCCAAGAGCAATCACAGATTAATCTATAAATATGAGAAGTC
GCATTATTGTACTTAATTCTTTGGCAACAAACAGCAAGTTTTTATTGTTTAATTGTATTTCCTCTCTAGAGATCACAATACTCTGGGTAT
TTTATATCCCTTCTAAAGGTCATTTGGGTTTTCAAATGGGAAGAATAGTCAAGCTAAGCTGGACTAAACCTAAGTAATATTTTTTCTCAT
CAAAAGAAGTTATTAATCTAACTGGGTTAGCATGAGTCATTCATTTTTTAGACATGATAAATGGGAAACATATCAAATCATTAGATAAAT
TCTGACCTGGAATTGAATTCCCCCTTTCTTAAAATCTTTTTAATTTGCTTTTTTCATAGACTCAGTATGGAACTCTTAACTGATAAGGGA
GAGATTCTTGATCTGGAACCGTTCCCTGCCATTCTCCTTTTTTCTCTCTATCTAGGTAGCTGGTTCCATAGTGCCCGTCACGAGGGTCCA
TTTCAGTTTGATGACATTAGACTGCTTACACTCAGCTGGATGCCTTGCTGTTTGCAGCAACATGATTTTACAGTATGCTTTTCTCAAAGC
TTTGCATTCTTAATGGAGATATCAAATGGTGTAATTCCAAATATAAATATGTTTATGACACTAATCATATGCTTTTAACAATAACTTTTT
GATAACTTATTGCCCTGTAAGTTAAACCTTACACGGAGTGACTGTTGCCATCAGAAAATCCCCTTTCACCTGCTAGAGAGAGTGAAAGTA
GTGCGTGGCCTCCACTTTTCAGTTAACGAGTAGCAAGCTTCTAGTAGGGGCTGCTTATCTGACCCATGTGGGGTCTTGGGCCTTGTTACT
TTCCTGGGTTCGTCCCTTCAGCTGGAAAGGCTGTTGAAAACACTTGCCAGGAAACAGTAAAGCTGTGAGAGAATCTTCTAGTCTTAGATA
TAGAGAAATGAGTACCAGTTGATGCTAACACGATACTTAGACTTTGAGGGGCTTCCATCCAAGCTTTGGCATGAATCTGTTAGACACGGT
TTTCTTCACTCCTCTGATAATCTTTTTTTCCAGAATGGTTTTTTGTTGTTGTTGTTGTTAACAAATTCTAAACATCCAGTGTTACTTTTT
GTTTTGTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTGCCCTTCAGGAAAGTCCTTTTTCGAGTAGGTATTGATTGTTCCCTGGAAACT
CTCAGCAGTGTCTGTGCAGGCTCTGTGCATGCTTTGTATGAGTTCGGCTTGAACAATGCATTTGAAGTCACCTGGGATGTCCAGTTCTGG
CATGTCTTCATTGATTGTGTTTTTAAACATGTTTCATGTTTCATGTCATTTTCCAAACCTCACTTTACATCTTACTCAGAGAAGTTAATC
AAGGAATGAAATTTCTAGGGGGATAGGGATGATGAGGGTGGGTTGGGGGCTTGAGTGAAGTCAACTTGGGGTATTTGCTTTAAAGTGTTT
TCTAAAGCAGTTCCTAACAGTATTTAGAGATTCCCTGGGATGTTTGTGGCTCAACTTATTCTGGACAAAGTGTGTGTGGGGGTGGTCTTA
CTGAGATTTGCATTCTTAATGCAGGACAGGCTCTAAATTTCATCTGTACTCTAAATTTGTGATTGAATCCAAGAAGATAACAGAGACAGT
GCTCCTGTTGTAATGTTTCTGGCAAGTGCTCCCTAAAATGCACATCGAATTCTGTTTTCTGGGCCTTTTCTCCAATGGTGCTAGGAGATA
CCGTTGATTTCTGCAGCTCTTCTCAGTGGTGGGAAGAAGTCTTTGGGATTGTTGAGCAAGGGGCAGCTGGACCATCCACTAAATTTTTTT
GTTCAAGACACATTAGAGACCCTCCTGTATATCTAGTAAGTCATAATAAAGGTGCTTGGGAAAGCCTTAAATTTGAAGACACATGGAGGC
GGTAGAAAATTAAACTTGTAAGAGGAGAAAAACATGCCATTAGGTAACGCAGAGTTGTAACTACTGGCTAAGACTCAATGGAACTTCCAC
TTGCTCTAAAACCAGGGAAATCTTAGATAACTGGGTGTGATCTACCTATAGATCTACCTAGTCTATAGGTAATAATTTCCAGAAGGAGGA
TCTTGCTGTCAGTTGGGGATCCTCTGGTTTGGTCTGTACCAAATTGTGAATACTCTTGCTGTGTTGTACCCAGTTGCTTTATATTAATAC
TGCAACTTGAAACGGGGAGGGTGGGGGGACAATGGGGTGGGGGAGGGAAGGGAGTGGGACGATAAGTCTTTTGAAGACATCAGCTCACTG
TGCTGAGAGAGGGACCAAACTCAAGGAAACCTCTGATCTATACATTCAACTGCTGCATTTTTTTATAAATACATGTAAATGTCCTGTTGT


Top

FusionGenePPI for EIF4E_UBXN7


check button Go to ChiPPI (Chimeric Protein-Protein interactions) to see the chimeric PPI interaction in

ChiPPI page

.

check button Protein-protein interactors with each fusion partner protein in wild-type (BIOGRID-3.4.160)
HgeneHgene's interactorsTgeneTgene's interactors
EIF4EEIF4EBP1, EIF4A2, EIF4A1, EIF4ENIF1, PML, EIF4G1, EIF4EBP2, EIF3B, MKNK1, EIF4EBP3, EIF3F, STUB1, DCC, HSPB2, RPTOR, APP, EIF4H, GEMIN5, ITGA4, CD83, PRDM4, AHSA1, ASS1, CAPN1, HSPA9, NANS, EIF6, HSPD1, PEPD, PROSC, TYMP, KANK2, TDO2, TRIM27, UBXN11, RPS6KB1, MTOR, TRIM22, EIF4G3, ANGEL1, DDX19A, CSK, UBFD1, KIAA0368, PABPC1, PABPC3, PABPC4, PDXK, NTRK1, CYLDUBXN7VCP, NPLOC4, UFD1L, CUL1, CUL2, CUL3, UBR1, PSMD2, HIF1A, ALPP, SKP1, RBX1, TCEB2, TCEB1, VHL, KLHL12, KLHL13, KLHL22, KBTBD7, KBTBD2, KLHDC3, CUL4A, CUL4B, DDB1, VPRBP, WDR26, WDR11, BRWD1, BRWD3, AMFR, UBR2, UBR4, PJA2, BIRC2, TOPORS, UBR5, NEDD8, APP, OXCT1, UBE2V2, ATP6V1F, USP34, UBE2B, SSSCA1, TTLL12, ATP6V1B2, ZFYVE19, TYMS, UBE2D1, UBE2L3, UBE2V1, UBE2D2, ZYX, NUBP2, UBE2C, UCHL3, VPS26A, ZPR1, ZRANB2, SDHAF2, SEC23A, UBE4B, SULT1A1, RAD23B, SRXN1, UFC1, UFM1, YAP1, USP9X, UBC, DPP8, LZTFL1, NSUN2, MAP3K1, KCNK16, NTRK1, ERCC8, ACAD11, ERCC3, CSNK1G3, ASPSCR1, KCTD10, BTBD9, KCTD13, FAF2, ABCF1, JUN, RANBP6, SETD7, RNF138, KIFC1, MORF4L2, PHF6, PHIP, CSNK1E, POU3F2, CSTF1, NSFL1C, VCPIP1, FAF1, FAM91A1, KLHDC2, KLHDC10, KPNA3, TNFAIP1, UBXN1, SMURF1, TCEANC2, RNF111, FAM189B, NUAK2, ATG9A, XKRX, TGIF2LY


check button - Retained PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenStill interaction with


check button - Lost PPIs in in-frame fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


check button - Retained PPIs, but lost function due to frame-shift fusion.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenInteraction lost with


Top

RelatedDrugs for EIF4E_UBXN7


check button Drugs targeting genes involved in this fusion gene.
(DrugBank Version 5.1.0 2018-04-02)
PartnerGeneUniProtAccDrugBank IDDrug nameDrug activityDrug typeDrug status

Top

RelatedDiseases for EIF4E_UBXN7


check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgeneEIF4EC0334634Malignant lymphoma, lymphocytic, intermediate differentiation, diffuse1CTD_human