|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for DHX57 |
 Gene summary |
| Gene information | Gene symbol | DHX57 | Gene ID | 90957 |
| Gene name | DExH-box helicase 57 | |
| Synonyms | DDX57 | |
| Cytomap | 2p22.1 | |
| Type of gene | protein-coding | |
| Description | putative ATP-dependent RNA helicase DHX57DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57DEAH box protein 57DEAH-box RNA/DNA helicase AAM73547DEAH-box helicase 57 | |
| Modification date | 20180523 | |
| UniProtAcc | Q6P158 | |
| Context | PubMed: DHX57 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for DHX57 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for DHX57 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for DHX57 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_338456 | 2 | 39025493:39025584:39029856:39030057:39033700:39033835 | 39029856:39030057 | ENSG00000163214.16 | ENST00000460193.1,ENST00000295373.6,ENST00000457308.1 |
| exon_skip_338457 | 2 | 39025493:39025584:39029856:39030057:39040962:39041037 | 39029856:39030057 | ENSG00000163214.16 | ENST00000452978.1 |
| exon_skip_338462 | 2 | 39029856:39030057:39033700:39033835:39040962:39041037 | 39033700:39033835 | ENSG00000163214.16 | ENST00000460193.1,ENST00000295373.6,ENST00000457308.1 |
| exon_skip_338465 | 2 | 39040962:39041037:39042662:39042797:39046018:39046102 | 39042662:39042797 | ENSG00000163214.16 | ENST00000295373.6,ENST00000457308.1,ENST00000452978.1,ENST00000497514.2 |
| exon_skip_338468 | 2 | 39042662:39042797:39046014:39046102:39046190:39046250 | 39046014:39046102 | ENSG00000163214.16 | ENST00000460193.1 |
| exon_skip_338470 | 2 | 39042662:39042797:39046018:39046102:39046190:39046250 | 39046018:39046102 | ENSG00000163214.16 | ENST00000295373.6,ENST00000457308.1,ENST00000452978.1 |
| exon_skip_338471 | 2 | 39053657:39053831:39055481:39055578:39064972:39065089 | 39055481:39055578 | ENSG00000163214.16 | ENST00000460193.1,ENST00000295373.6,ENST00000457308.1,ENST00000452978.1 |
| exon_skip_338472 | 2 | 39055481:39055578:39064972:39065089:39070146:39070352 | 39064972:39065089 | ENSG00000163214.16 | ENST00000460193.1,ENST00000295373.6,ENST00000457308.1,ENST00000452978.1 |
| exon_skip_338473 | 2 | 39074160:39074215:39075410:39075544:39081195:39081320 | 39075410:39075544 | ENSG00000163214.16 | ENST00000460193.1,ENST00000295373.6,ENST00000457308.1 |
| exon_skip_338475 | 2 | 39075410:39075544:39081195:39081320:39082198:39082394 | 39081195:39081320 | ENSG00000163214.16 | ENST00000295373.6,ENST00000457308.1 |
| exon_skip_338476 | 2 | 39082198:39082394:39083481:39083603:39085802:39085978 | 39083481:39083603 | ENSG00000163214.16 | ENST00000460193.1,ENST00000474104.1,ENST00000295373.6 |
| exon_skip_338481 | 2 | 39090502:39090661:39095323:39095553:39102928:39103021 | 39095323:39095553 | ENSG00000163214.16 | ENST00000460193.1,ENST00000474104.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for DHX57 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_338456 | 2 | 39025493:39025584:39029856:39030057:39033700:39033835 | 39029856:39030057 | ENSG00000163214.16 | ENST00000295373.6,ENST00000460193.1,ENST00000457308.1 |
| exon_skip_338457 | 2 | 39025493:39025584:39029856:39030057:39040962:39041037 | 39029856:39030057 | ENSG00000163214.16 | ENST00000452978.1 |
| exon_skip_338462 | 2 | 39029856:39030057:39033700:39033835:39040962:39041037 | 39033700:39033835 | ENSG00000163214.16 | ENST00000295373.6,ENST00000460193.1,ENST00000457308.1 |
| exon_skip_338465 | 2 | 39040962:39041037:39042662:39042797:39046018:39046102 | 39042662:39042797 | ENSG00000163214.16 | ENST00000295373.6,ENST00000452978.1,ENST00000457308.1,ENST00000497514.2 |
| exon_skip_338468 | 2 | 39042662:39042797:39046014:39046102:39046190:39046250 | 39046014:39046102 | ENSG00000163214.16 | ENST00000460193.1 |
| exon_skip_338470 | 2 | 39042662:39042797:39046018:39046102:39046190:39046250 | 39046018:39046102 | ENSG00000163214.16 | ENST00000295373.6,ENST00000452978.1,ENST00000457308.1 |
| exon_skip_338471 | 2 | 39053657:39053831:39055481:39055578:39064972:39065089 | 39055481:39055578 | ENSG00000163214.16 | ENST00000295373.6,ENST00000452978.1,ENST00000460193.1,ENST00000457308.1 |
| exon_skip_338472 | 2 | 39055481:39055578:39064972:39065089:39070146:39070352 | 39064972:39065089 | ENSG00000163214.16 | ENST00000295373.6,ENST00000452978.1,ENST00000460193.1,ENST00000457308.1 |
| exon_skip_338473 | 2 | 39074160:39074215:39075410:39075544:39081195:39081320 | 39075410:39075544 | ENSG00000163214.16 | ENST00000295373.6,ENST00000460193.1,ENST00000457308.1 |
| exon_skip_338475 | 2 | 39075410:39075544:39081195:39081320:39082198:39082394 | 39081195:39081320 | ENSG00000163214.16 | ENST00000295373.6,ENST00000457308.1 |
| exon_skip_338476 | 2 | 39082198:39082394:39083481:39083603:39085802:39085978 | 39083481:39083603 | ENSG00000163214.16 | ENST00000295373.6,ENST00000460193.1,ENST00000474104.1 |
| exon_skip_338481 | 2 | 39090502:39090661:39095323:39095553:39102928:39103021 | 39095323:39095553 | ENSG00000163214.16 | ENST00000460193.1,ENST00000474104.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for DHX57 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
Top |
Infer the effects of exon skipping event on protein functional features for DHX57 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for DHX57 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
DHX57_LIHC_exon_skip_338470_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39030009 | 39030009 | Frame_Shift_Del | T | - | p.T1289fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39030009 | 39030009 | Frame_Shift_Del | T | - | p.T1289fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39030009 | 39030009 | Frame_Shift_Del | T | - | p.T1289fs |
| KIRP | TCGA-EV-5902-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39030017 | 39030017 | Frame_Shift_Del | T | - | p.K1286fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_338462 | 39033701 | 39033835 | 39033812 | 39033812 | Frame_Shift_Del | A | - | p.F1235fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_338462 | 39033701 | 39033835 | 39033812 | 39033812 | Frame_Shift_Del | A | - | p.Q1236fs |
| LIHC | TCGA-5C-AAPD-01 | exon_skip_338470 exon_skip_338468 | 39046015 | 39046102 | 39046078 | 39046104 | Frame_Shift_Del | CTTCTTTTGTACTTAGCTGCCATCCCT | - | p.1130_1138del |
| LIHC | TCGA-5C-AAPD-01 | exon_skip_338470 exon_skip_338468 | 39046019 | 39046102 | 39046078 | 39046104 | Frame_Shift_Del | CTTCTTTTGTACTTAGCTGCCATCCCT | - | p.1130_1138del |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_338472 | 39064973 | 39065089 | 39065046 | 39065046 | Frame_Shift_Del | A | - | p.F823fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_338472 | 39064973 | 39065089 | 39065087 | 39065087 | Frame_Shift_Del | C | - | p.V810fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_338473 | 39075411 | 39075544 | 39075450 | 39075450 | Frame_Shift_Del | A | - | p.S709fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_338473 | 39075411 | 39075544 | 39075450 | 39075450 | Frame_Shift_Del | A | - | p.S709fs |
| KIRC | TCGA-A3-3311-01 | exon_skip_338473 | 39075411 | 39075544 | 39075474 | 39075474 | Frame_Shift_Del | C | - | p.A701fs |
| SKCM | TCGA-FR-A726-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39029922 | 39029922 | Nonsense_Mutation | G | A | p.Q1318* |
| STAD | TCGA-VQ-A8DU-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39029991 | 39029991 | Nonsense_Mutation | G | A | p.R1295* |
| STAD | TCGA-VQ-A8DU-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39029991 | 39029991 | Nonsense_Mutation | G | A | p.R1295X |
| PAAD | TCGA-IB-7651-01 | exon_skip_338456 exon_skip_338457 | 39029857 | 39030057 | 39030003 | 39030003 | Nonsense_Mutation | G | A | p.R1291* |
| UCS | TCGA-ND-A4WC-01 | exon_skip_338471 | 39055482 | 39055578 | 39055483 | 39055483 | Nonsense_Mutation | G | A | p.R880X |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-5C-AAPD-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_338468 | |
| Skipped exon start: 39046019 | |
| Skipped exon end: 39046102 | |
| Mutation start: 39046078 | |
| Mutation end: 39046104 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: CTTCTTTTGTACTTAGCTGCCATCCCT | |
| Mutation seq: - | |
| AAchange: p.1130_1138del | |
| Sample: TCGA-5C-AAPD-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_338468 | |
| Skipped exon start: 39046015 | |
| Skipped exon end: 39046102 | |
| Mutation start: 39046078 | |
| Mutation end: 39046104 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: CTTCTTTTGTACTTAGCTGCCATCCCT | |
| Mutation seq: - | |
| AAchange: p.1130_1138del | |
exon_skip_338468_LIHC_TCGA-5C-AAPD-01.png | |
exon_skip_338470_LIHC_TCGA-5C-AAPD-01.png | |
 | Sample: TCGA-5C-AAPD-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_338468 | |
| Skipped exon start: 39046019 | |
| Skipped exon end: 39046102 | |
| Mutation start: 39046078 | |
| Mutation end: 39046104 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: CTTCTTTTGTACTTAGCTGCCATCCCT | |
| Mutation seq: - | |
| AAchange: p.1130_1138del | |
| Sample: TCGA-5C-AAPD-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_338468 | |
| Skipped exon start: 39046015 | |
| Skipped exon end: 39046102 | |
| Mutation start: 39046078 | |
| Mutation end: 39046104 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: CTTCTTTTGTACTTAGCTGCCATCCCT | |
| Mutation seq: - | |
| AAchange: p.1130_1138del | |
| exon_skip_338468_LIHC_TCGA-5C-AAPD-01.png | |
| exon_skip_338470_LIHC_TCGA-5C-AAPD-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| M059K_CENTRAL_NERVOUS_SYSTEM | 39075411 | 39075544 | 39075449 | 39075450 | Frame_Shift_Ins | - | A | p.S709fs |
| MCC13_SKIN | 39029857 | 39030057 | 39029972 | 39029972 | Missense_Mutation | G | A | p.S1301F |
| OV17R_OVARY | 39029857 | 39030057 | 39030000 | 39030000 | Missense_Mutation | C | T | p.V1292I |
| HEC6_ENDOMETRIUM | 39029857 | 39030057 | 39030002 | 39030002 | Missense_Mutation | C | T | p.R1291Q |
| ISHIKAWAHERAKLIO02ER_ENDOMETRIUM | 39033701 | 39033835 | 39033726 | 39033726 | Missense_Mutation | A | G | p.I1264T |
| CHAGOK1_LUNG | 39033701 | 39033835 | 39033766 | 39033766 | Missense_Mutation | C | T | p.E1251K |
| HEC50B_ENDOMETRIUM | 39042663 | 39042797 | 39042697 | 39042697 | Missense_Mutation | C | T | p.G1191E |
| U2OS_BONE | 39046019 | 39046102 | 39046021 | 39046021 | Missense_Mutation | G | T | p.Q1157K |
| U2OS_BONE | 39046015 | 39046102 | 39046021 | 39046021 | Missense_Mutation | G | T | p.Q1157K |
| SAS_UPPER_AERODIGESTIVE_TRACT | 39046019 | 39046102 | 39046071 | 39046071 | Missense_Mutation | C | T | p.R1140H |
| SAS_UPPER_AERODIGESTIVE_TRACT | 39046015 | 39046102 | 39046071 | 39046071 | Missense_Mutation | C | T | p.R1140H |
| 2313287_STOMACH | 39046019 | 39046102 | 39046072 | 39046072 | Missense_Mutation | G | A | p.R1140C |
| 2313287_STOMACH | 39046015 | 39046102 | 39046072 | 39046072 | Missense_Mutation | G | A | p.R1140C |
| OVMIU_OVARY | 39055482 | 39055578 | 39055533 | 39055533 | Missense_Mutation | A | G | p.L863P |
| KE37_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 39064973 | 39065089 | 39064997 | 39064997 | Missense_Mutation | C | A | p.D840Y |
| BCP1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 39064973 | 39065089 | 39065009 | 39065009 | Missense_Mutation | C | G | p.E836Q |
| KGN_OVARY | 39064973 | 39065089 | 39065087 | 39065087 | Missense_Mutation | C | T | p.V810I |
| HCC2998_LARGE_INTESTINE | 39075411 | 39075544 | 39075440 | 39075440 | Missense_Mutation | A | C | p.F712C |
| C33A_CERVIX | 39075411 | 39075544 | 39075512 | 39075512 | Missense_Mutation | A | G | p.V688A |
| RMGI_OVARY | 39081196 | 39081320 | 39081289 | 39081289 | Missense_Mutation | G | A | p.T646M |
| HCC1569_BREAST | 39083482 | 39083603 | 39083489 | 39083489 | Missense_Mutation | T | C | p.M568V |
| DV90_LUNG | 39083482 | 39083603 | 39083507 | 39083507 | Missense_Mutation | C | T | p.V562M |
| SNUC2A_LARGE_INTESTINE | 39083482 | 39083603 | 39083519 | 39083519 | Missense_Mutation | G | A | p.R558C |
| SNUC2B_LARGE_INTESTINE | 39083482 | 39083603 | 39083519 | 39083519 | Missense_Mutation | G | A | p.R558C |
| SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 39083482 | 39083603 | 39083519 | 39083519 | Missense_Mutation | G | A | p.R558C |
| EWS834_BONE | 39083482 | 39083603 | 39083567 | 39083567 | Missense_Mutation | G | T | p.Q542K |
| OC316_OVARY | 39095324 | 39095553 | 39095334 | 39095334 | Missense_Mutation | G | A | p.R72C |
| OC314_OVARY | 39095324 | 39095553 | 39095334 | 39095334 | Missense_Mutation | G | A | p.R72C |
| BE2M17_AUTONOMIC_GANGLIA | 39095324 | 39095553 | 39095350 | 39095350 | Missense_Mutation | G | C | p.I66M |
| SKNBE2_AUTONOMIC_GANGLIA | 39095324 | 39095553 | 39095350 | 39095350 | Missense_Mutation | G | C | p.I66M |
| HCC2450_LUNG | 39095324 | 39095553 | 39095477 | 39095477 | Missense_Mutation | C | G | p.R24T |
| C8166_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 39095324 | 39095553 | 39095501 | 39095501 | Missense_Mutation | C | A | p.G16V |
| NB13_AUTONOMIC_GANGLIA | 39095324 | 39095553 | 39095528 | 39095528 | Missense_Mutation | C | A | p.R7I |
| HEC6_ENDOMETRIUM | 39046019 | 39046102 | 39046021 | 39046021 | Nonsense_Mutation | G | A | p.Q1157* |
| HEC6_ENDOMETRIUM | 39046015 | 39046102 | 39046021 | 39046021 | Nonsense_Mutation | G | A | p.Q1157* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for DHX57 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DHX57 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DHX57 |
Top |
RelatedDrugs for DHX57 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for DHX57 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|