|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for CASR |
 Gene summary |
| Gene information | Gene symbol | CASR | Gene ID | 846 |
| Gene name | calcium sensing receptor | |
| Synonyms | CAR|EIG8|FHH|FIH|GPRC2A|HHC|HHC1|HYPOC1|NSHPT|PCAR1|hCasR | |
| Cytomap | 3q13.33-q21.1 | |
| Type of gene | protein-coding | |
| Description | extracellular calcium-sensing receptorparathyroid Ca(2+)-sensing receptor 1parathyroid cell calcium-sensing receptor 1 | |
| Modification date | 20180527 | |
| UniProtAcc | P41180 | |
| Context | PubMed: CASR [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| CASR | GO:0005513 | detection of calcium ion | 27434672 |
| CASR | GO:0006874 | cellular calcium ion homeostasis | 27434672 |
| CASR | GO:0007186 | G-protein coupled receptor signaling pathway | 27434672 |
| CASR | GO:0070509 | calcium ion import | 20846291 |
Top |
Exon skipping events across known transcript of Ensembl for CASR from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for CASR |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for CASR |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_377050 | 3 | 121973177:121973221:121975927:121976234:121980374:121981259 | 121975927:121976234 | ENSG00000036828.9 | ENST00000490131.1,ENST00000498619.1,ENST00000296154.5 |
| exon_skip_377052 | 3 | 121980374:121981259:121994658:121994889:122000959:122001083 | 121994658:121994889 | ENSG00000036828.9 | ENST00000490131.1,ENST00000296154.5 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for CASR |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_377050 | 3 | 121973177:121973221:121975927:121976234:121980374:121981259 | 121975927:121976234 | ENSG00000036828.9 | ENST00000490131.1,ENST00000498619.1,ENST00000296154.5 |
| exon_skip_377052 | 3 | 121980374:121981259:121994658:121994889:122000959:122001083 | 121994658:121994889 | ENSG00000036828.9 | ENST00000490131.1,ENST00000296154.5 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for CASR |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
Top |
Infer the effects of exon skipping event on protein functional features for CASR |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for CASR |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| BRCA | TCGA-C8-A27B-01 | exon_skip_377050 | 121975928 | 121976234 | 121975971 | 121975992 | Frame_Shift_Del | GCCATAGAGGAGATAAACAGCA | - | p.I78fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_377050 | 121975928 | 121976234 | 121976034 | 121976034 | Frame_Shift_Del | T | - | p.F98fs |
| COAD | TCGA-F4-6570-01 | exon_skip_377050 | 121975928 | 121976234 | 121976092 | 121976092 | Frame_Shift_Del | A | - | p.Q117fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_377050 | 121975928 | 121976234 | 121976097 | 121976097 | Frame_Shift_Del | A | - | p.K119fs |
| ACC | TCGA-OR-A5JA-01 | exon_skip_377050 | 121975928 | 121976234 | 121976121 | 121976121 | Nonsense_Mutation | G | T | p.E127* |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| BT20_BREAST | 121975928 | 121976234 | 121975964 | 121975964 | Missense_Mutation | G | A | p.M74I |
| HOP62_LUNG | 121975928 | 121976234 | 121975992 | 121975992 | Missense_Mutation | A | G | p.S84G |
| NCIH650_LUNG | 121975928 | 121976234 | 121976030 | 121976030 | Missense_Mutation | G | T | p.R96S |
| GP2D_LARGE_INTESTINE | 121975928 | 121976234 | 121976131 | 121976131 | Missense_Mutation | A | T | p.N130I |
| GP5D_LARGE_INTESTINE | 121975928 | 121976234 | 121976131 | 121976131 | Missense_Mutation | A | T | p.N130I |
| HCC1937_BREAST | 121975928 | 121976234 | 121976196 | 121976196 | Missense_Mutation | G | A | p.A152T |
| NCIH23_LUNG | 121994659 | 121994889 | 121994702 | 121994702 | Missense_Mutation | G | T | p.G474V |
| PACADD137_PANCREAS | 121994659 | 121994889 | 121994803 | 121994803 | Missense_Mutation | G | T | p.V508F |
| HEC251_ENDOMETRIUM | 121994659 | 121994889 | 121994818 | 121994818 | Missense_Mutation | G | A | p.V513I |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for CASR |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CASR |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for CASR |
Top |
RelatedDrugs for CASR |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
| P41180 | DB01012 | Cinacalcet | Extracellular calcium-sensing receptor {ECO:0000305} | small molecule | approved | |
| P41180 | DB11348 | Calcium Phosphate | Extracellular calcium-sensing receptor {ECO:0000305} | small molecule | approved | |
| P41180 | DB11093 | Calcium Citrate | Extracellular calcium-sensing receptor {ECO:0000305} | small molecule | approved|investigational | |
| P41180 | DB12865 | Etelcalcetide | Extracellular calcium-sensing receptor {ECO:0000305} | small molecule | approved|investigational | |
| P41180 | DB00994 | Neomycin | Extracellular calcium-sensing receptor {ECO:0000305} | small molecule | approved|vet_approved |
Top |
RelatedDiseases for CASR |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| CASR | C3715128 | HYPOCALCEMIA, AUTOSOMAL DOMINANT 1 | 15 | ORPHANET;UNIPROT |
| CASR | C0342637 | Hypocalciuric hypercalcemia, familial, type 1 | 12 | CTD_human;ORPHANET;UNIPROT |
| CASR | C1832615 | HYPERPARATHYROIDISM, NEONATAL SEVERE | 4 | CTD_human;ORPHANET;UNIPROT |
| CASR | C0020502 | Hyperparathyroidism | 2 | CTD_human;HPO |
| CASR | C0020598 | Hypocalcemia | 2 | CTD_human;HPO |
| CASR | C0020437 | Hypercalcemia | 1 | CTD_human;HPO |
| CASR | C0020626 | Hypoparathyroidism | 1 | CTD_human |
| CASR | C1832648 | Hypoparathyroidism familial isolated | 1 | CTD_human |
| CASR | C2752062 | EPILEPSY, IDIOPATHIC GENERALIZED, SUSCEPTIBILITY TO, 8 | 1 | UNIPROT |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|