|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for BAP1 |
 Gene summary |
| Gene information | Gene symbol | BAP1 | Gene ID | 8314 |
| Gene name | BRCA1 associated protein 1 | |
| Synonyms | HUCEP-13|UCHL2|hucep-6 | |
| Cytomap | 3p21.1 | |
| Type of gene | protein-coding | |
| Description | ubiquitin carboxyl-terminal hydrolase BAP1BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)cerebral protein 6cerebral protein-13 | |
| Modification date | 20180527 | |
| UniProtAcc | Q92560 | |
| Context | PubMed: BAP1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| BAP1 | GO:0016579 | protein deubiquitination | 18757409|19815555 |
| BAP1 | GO:0035520 | monoubiquitinated protein deubiquitination | 24703950 |
| BAP1 | GO:0035522 | monoubiquitinated histone H2A deubiquitination | 20436459 |
Top |
Exon skipping events across known transcript of Ensembl for BAP1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for BAP1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for BAP1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_384798 | 3 | 52436617:52436690:52436794:52436887:52437153:52437314 | 52436794:52436887 | ENSG00000163930.5 | ENST00000296288.5,ENST00000460680.1 |
| exon_skip_384801 | 3 | 52436617:52436690:52436794:52436956:52437153:52437314 | 52436794:52436956 | ENSG00000163930.5 | ENST00000478368.1 |
| exon_skip_384808 | 3 | 52437198:52437314:52437431:52437910:52438468:52438493 | 52437431:52437910 | ENSG00000163930.5 | ENST00000296288.5,ENST00000460680.1 |
| exon_skip_384809 | 3 | 52438468:52438602:52439125:52439310:52439780:52439928 | 52439125:52439310 | ENSG00000163930.5 | ENST00000296288.5,ENST00000460680.1 |
| exon_skip_384813 | 3 | 52439125:52439310:52439780:52439928:52440268:52440338 | 52439780:52439928 | ENSG00000163930.5 | ENST00000296288.5,ENST00000460680.1 |
| exon_skip_384815 | 3 | 52440268:52440392:52440844:52440923:52441189:52441332 | 52440844:52440923 | ENSG00000163930.5 | ENST00000460680.1 |
| exon_skip_384821 | 3 | 52440844:52440923:52441189:52441332:52441414:52441476 | 52441189:52441332 | ENSG00000163930.5 | ENST00000296288.5,ENST00000471532.1,ENST00000460680.1 |
| exon_skip_384823 | 3 | 52440844:52440923:52441414:52441476:52441973:52442063 | 52441414:52441476 | ENSG00000163930.5 | ENST00000483984.1 |
| exon_skip_384824 | 3 | 52441194:52441332:52441414:52441476:52441973:52442063 | 52441414:52441476 | ENSG00000163930.5 | ENST00000470173.1,ENST00000296288.5,ENST00000471532.1,ENST00000460680.1,ENST00000490917.1 |
| exon_skip_384825 | 3 | 52441973:52442093:52442489:52442622:52443569:52443624 | 52442489:52442622 | ENSG00000163930.5 | ENST00000470173.1,ENST00000296288.5,ENST00000460680.1,ENST00000483984.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for BAP1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_384798 | 3 | 52436617:52436690:52436794:52436887:52437153:52437314 | 52436794:52436887 | ENSG00000163930.5 | ENST00000460680.1,ENST00000296288.5 |
| exon_skip_384801 | 3 | 52436617:52436690:52436794:52436956:52437153:52437314 | 52436794:52436956 | ENSG00000163930.5 | ENST00000478368.1 |
| exon_skip_384808 | 3 | 52437198:52437314:52437431:52437910:52438468:52438493 | 52437431:52437910 | ENSG00000163930.5 | ENST00000460680.1,ENST00000296288.5 |
| exon_skip_384809 | 3 | 52438468:52438602:52439125:52439310:52439780:52439928 | 52439125:52439310 | ENSG00000163930.5 | ENST00000460680.1,ENST00000296288.5 |
| exon_skip_384813 | 3 | 52439125:52439310:52439780:52439928:52440268:52440338 | 52439780:52439928 | ENSG00000163930.5 | ENST00000460680.1,ENST00000296288.5 |
| exon_skip_384815 | 3 | 52440268:52440392:52440844:52440923:52441189:52441332 | 52440844:52440923 | ENSG00000163930.5 | ENST00000460680.1 |
| exon_skip_384821 | 3 | 52440844:52440923:52441189:52441332:52441414:52441476 | 52441189:52441332 | ENSG00000163930.5 | ENST00000460680.1,ENST00000296288.5,ENST00000471532.1 |
| exon_skip_384823 | 3 | 52440844:52440923:52441414:52441476:52441973:52442063 | 52441414:52441476 | ENSG00000163930.5 | ENST00000483984.1 |
| exon_skip_384824 | 3 | 52441194:52441332:52441414:52441476:52441973:52442063 | 52441414:52441476 | ENSG00000163930.5 | ENST00000460680.1,ENST00000296288.5,ENST00000471532.1,ENST00000490917.1,ENST00000470173.1 |
| exon_skip_384825 | 3 | 52441973:52442093:52442489:52442622:52443569:52443624 | 52442489:52442622 | ENSG00000163930.5 | ENST00000460680.1,ENST00000296288.5,ENST00000483984.1,ENST00000470173.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for BAP1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000460680 | 52437431 | 52437910 | Frame-shift |
| ENST00000460680 | 52439125 | 52439310 | Frame-shift |
| ENST00000460680 | 52439780 | 52439928 | Frame-shift |
| ENST00000460680 | 52440844 | 52440923 | Frame-shift |
| ENST00000460680 | 52441189 | 52441332 | Frame-shift |
| ENST00000460680 | 52441414 | 52441476 | Frame-shift |
| ENST00000460680 | 52442489 | 52442622 | Frame-shift |
| ENST00000460680 | 52436794 | 52436887 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000460680 | 52437431 | 52437910 | Frame-shift |
| ENST00000460680 | 52439125 | 52439310 | Frame-shift |
| ENST00000460680 | 52439780 | 52439928 | Frame-shift |
| ENST00000460680 | 52440844 | 52440923 | Frame-shift |
| ENST00000460680 | 52441189 | 52441332 | Frame-shift |
| ENST00000460680 | 52441414 | 52441476 | Frame-shift |
| ENST00000460680 | 52442489 | 52442622 | Frame-shift |
| ENST00000460680 | 52436794 | 52436887 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for BAP1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000460680 | 3954 | 729 | 52436794 | 52436887 | 2363 | 2455 | 630 | 661 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000460680 | 3954 | 729 | 52436794 | 52436887 | 2363 | 2455 | 630 | 661 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q92560 | 630 | 661 | 1 | 729 | Chain | ID=PRO_0000211069;Note=Ubiquitin carboxyl-terminal hydrolase BAP1 |
| Q92560 | 630 | 661 | 630 | 661 | Coiled coil | Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q92560 | 630 | 661 | 656 | 661 | Mutagenesis | Note=Does not affect nuclear localization. KRKKFK->AAAAAA;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:18757409;Dbxref=PMID:18757409 |
| Q92560 | 630 | 661 | 596 | 721 | Region | Note=Interaction with BRCA1 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q92560 | 630 | 661 | 1 | 729 | Chain | ID=PRO_0000211069;Note=Ubiquitin carboxyl-terminal hydrolase BAP1 |
| Q92560 | 630 | 661 | 630 | 661 | Coiled coil | Ontology_term=ECO:0000255;evidence=ECO:0000255 |
| Q92560 | 630 | 661 | 656 | 661 | Mutagenesis | Note=Does not affect nuclear localization. KRKKFK->AAAAAA;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:18757409;Dbxref=PMID:18757409 |
| Q92560 | 630 | 661 | 596 | 721 | Region | Note=Interaction with BRCA1 |
Top |
SNVs in the skipped exons for BAP1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
BAP1_CESC_exon_skip_384808_psi_boxplot.png |
BAP1_KIRC_exon_skip_384808_psi_boxplot.png |
BAP1_KIRP_exon_skip_384808_psi_boxplot.png |
BAP1_LIHC_exon_skip_384808_psi_boxplot.png |
BAP1_LIHC_exon_skip_384809_psi_boxplot.png |
BAP1_LUAD_exon_skip_384808_psi_boxplot.png |
BAP1_LUAD_exon_skip_384825_psi_boxplot.png |
BAP1_MESO_exon_skip_384808_psi_boxplot.png |
BAP1_STAD_exon_skip_384809_psi_boxplot.png |
BAP1_UVM_exon_skip_384808_psi_boxplot.png |
BAP1_UVM_exon_skip_384809_psi_boxplot.png |
BAP1_UVM_exon_skip_384821_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| MESO | TCGA-TS-A7P1-01 | exon_skip_384798 | 52436795 | 52436887 | 52436847 | 52436847 | Frame_Shift_Del | G | - | p.A644fs |
| MESO | TCGA-TS-A7P1-01 | exon_skip_384801 | 52436795 | 52436956 | 52436847 | 52436847 | Frame_Shift_Del | G | - | p.A644fs |
| LIHC | TCGA-CC-5260-01 | exon_skip_384808 | 52437432 | 52437910 | 52437456 | 52437456 | Frame_Shift_Del | C | - | p.V569fs |
| LUAD | TCGA-95-7948-01 | exon_skip_384808 | 52437432 | 52437910 | 52437500 | 52437500 | Frame_Shift_Del | C | - | p.G554fs |
| KIRC | TCGA-CW-6097-01 | exon_skip_384808 | 52437432 | 52437910 | 52437530 | 52437533 | Frame_Shift_Del | ATGC | - | p.CI543fs |
| KIRP | TCGA-2Z-A9JD-01 | exon_skip_384808 | 52437432 | 52437910 | 52437652 | 52437652 | Frame_Shift_Del | G | - | p.N504fs |
| KIRP | TCGA-G7-A8LD-01 | exon_skip_384808 | 52437432 | 52437910 | 52437709 | 52437709 | Frame_Shift_Del | G | - | p.S485fs |
| UVM | TCGA-V4-A9F0-01 | exon_skip_384808 | 52437432 | 52437910 | 52437795 | 52437795 | Frame_Shift_Del | G | - | p.Q456fs |
| CHOL | TCGA-4G-AAZO-01 | exon_skip_384808 | 52437432 | 52437910 | 52437802 | 52437802 | Frame_Shift_Del | T | - | p.E454fs |
| CHOL | TCGA-4G-AAZO-01 | exon_skip_384808 | 52437432 | 52437910 | 52437802 | 52437802 | Frame_Shift_Del | T | - | p.K453fs |
| LIHC | TCGA-WQ-A9G7-01 | exon_skip_384808 | 52437432 | 52437910 | 52437802 | 52437803 | Frame_Shift_Del | TT | - | p.453_454del |
| CHOL | TCGA-4G-AAZO-01 | exon_skip_384808 | 52437432 | 52437910 | 52437804 | 52437805 | Frame_Shift_Del | TG | - | p.453_453del |
| KIRP | TCGA-AL-3473-01 | exon_skip_384808 | 52437432 | 52437910 | 52437889 | 52437889 | Frame_Shift_Del | C | - | p.G424fs |
| KIRP | TCGA-AL-3473-01 | exon_skip_384808 | 52437432 | 52437910 | 52437889 | 52437889 | Frame_Shift_Del | C | - | p.K425fs |
| UVM | TCGA-YZ-A984-01 | exon_skip_384808 | 52437432 | 52437910 | 52437898 | 52437899 | Frame_Shift_Del | CT | - | p.K421fs |
| MESO | TCGA-3H-AB3U-01 | exon_skip_384808 | 52437432 | 52437910 | 52437899 | 52437908 | Frame_Shift_Del | TTCCCCTTAT | - | p.YKGK418fs |
| UVM | TCGA-YZ-A984-01 | exon_skip_384808 | 52437432 | 52437910 | 52437899 | 52437899 | Frame_Shift_Del | T | - | p.K421fs |
| LIHC | TCGA-DD-AA3A-01 | exon_skip_384808 | 52437432 | 52437910 | 52437901 | 52437901 | Frame_Shift_Del | C | - | p.K421fs |
| LIHC | TCGA-2Y-A9H2-01 | exon_skip_384809 | 52439126 | 52439310 | 52439158 | 52439167 | Frame_Shift_Del | CTAGAAAGGC | - | p.359_362del |
| KIRC | TCGA-B0-5709-01 | exon_skip_384809 | 52439126 | 52439310 | 52439161 | 52439161 | Frame_Shift_Del | G | - | p.L361fs |
| KIRC | TCGA-CJ-4869-01 | exon_skip_384809 | 52439126 | 52439310 | 52439196 | 52439196 | Frame_Shift_Del | T | - | p.N349fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_384809 | 52439126 | 52439310 | 52439198 | 52439198 | Frame_Shift_Del | G | - | p.P348fs |
| STAD | TCGA-CG-4437-01 | exon_skip_384809 | 52439126 | 52439310 | 52439202 | 52439220 | Frame_Shift_Del | TGAACCCCATTGAGGCTGC | - | p.341_347del |
| STAD | TCGA-CG-4437-01 | exon_skip_384809 | 52439126 | 52439310 | 52439202 | 52439220 | Frame_Shift_Del | TGAACCCCATTGAGGCTGC | - | p.S341fs |
| KIRC | TCGA-B0-5080-01 | exon_skip_384809 | 52439126 | 52439310 | 52439206 | 52439206 | Frame_Shift_Del | C | - | p.V346fs |
| KIRC | TCGA-B0-5075-01 | exon_skip_384809 | 52439126 | 52439310 | 52439219 | 52439238 | Frame_Shift_Del | GCTGCCTGGAGGCTTCACCA | - | p.335_342del |
| KIRC | TCGA-B0-5075-01 | exon_skip_384809 | 52439126 | 52439310 | 52439219 | 52439238 | Frame_Shift_Del | GCTGCCTGGAGGCTTCACCA | - | p.VVKPPGS335fs |
| UVM | TCGA-YZ-A980-01 | exon_skip_384809 | 52439126 | 52439310 | 52439228 | 52439229 | Frame_Shift_Del | AG | - | p.P339fs |
| UVM | TCGA-YZ-A980-01 | exon_skip_384809 | 52439126 | 52439310 | 52439229 | 52439229 | Frame_Shift_Del | G | - | p.P338fs |
| UVM | TCGA-YZ-A980-01 | exon_skip_384809 | 52439126 | 52439310 | 52439229 | 52439229 | Frame_Shift_Del | G | - | p.P339fs |
| KIRP | TCGA-MH-A560-01 | exon_skip_384809 | 52439126 | 52439310 | 52439271 | 52439271 | Frame_Shift_Del | G | - | p.P324fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_384809 | 52439126 | 52439310 | 52439271 | 52439271 | Frame_Shift_Del | G | - | p.P324fs |
| MESO | TCGA-ZN-A9VV-01 | exon_skip_384813 | 52439781 | 52439928 | 52439815 | 52439836 | Frame_Shift_Del | GTTTGCTTCCAGCACCAGCGGG | - | p.SPLVLEAN292fs |
| KIRC | TCGA-B0-4827-01 | exon_skip_384813 | 52439781 | 52439928 | 52439864 | 52439864 | Frame_Shift_Del | T | - | p.E283fs |
| KIRC | TCGA-B0-4827-01 | exon_skip_384813 | 52439781 | 52439928 | 52439864 | 52439864 | Frame_Shift_Del | T | - | p.E284fs |
| HNSC | TCGA-CV-7263-01 | exon_skip_384813 | 52439781 | 52439928 | 52439912 | 52439913 | Frame_Shift_Del | TG | - | p.Q267fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_384815 | 52440845 | 52440923 | 52440912 | 52440912 | Frame_Shift_Del | C | - | p.E198fs |
| STAD | TCGA-BR-4363-01 | exon_skip_384815 | 52440845 | 52440923 | 52440912 | 52440912 | Frame_Shift_Del | C | - | p.E198fs |
| KIRP | TCGA-2Z-A9JK-01 | exon_skip_384821 | 52441190 | 52441332 | 52441229 | 52441230 | Frame_Shift_Del | AG | - | p.181_181del |
| MESO | TCGA-3U-A98H-01 | exon_skip_384821 | 52441190 | 52441332 | 52441265 | 52441265 | Frame_Shift_Del | G | - | p.H169fs |
| UVM | TCGA-V4-A9E7-01 | exon_skip_384821 | 52441190 | 52441332 | 52441330 | 52441383 | Frame_Shift_Del | GGCCTGGGGAAAAACAGAGTCAGGGCCCAAAAAATGATACTCCCCCTACTCCCA | - | p.146_147del |
| KIRC | TCGA-CJ-5680-01 | exon_skip_384825 | 52442490 | 52442622 | 52442523 | 52442523 | Frame_Shift_Del | A | - | p.D75fs |
| MESO | TCGA-3H-AB3K-01 | exon_skip_384825 | 52442490 | 52442622 | 52442605 | 52442606 | Frame_Shift_Del | AT | - | p.I47fs |
| MESO | TCGA-XT-AASU-01 | exon_skip_384798 | 52436795 | 52436887 | 52436846 | 52436847 | Frame_Shift_Ins | - | G | p.E644fs |
| MESO | TCGA-XT-AASU-01 | exon_skip_384801 | 52436795 | 52436956 | 52436846 | 52436847 | Frame_Shift_Ins | - | G | p.E644fs |
| ACC | TCGA-PK-A5HB-01 | exon_skip_384808 | 52437432 | 52437910 | 52437564 | 52437565 | Frame_Shift_Ins | - | A | p.G533fs |
| UVM | TCGA-VD-AA8T-01 | exon_skip_384808 | 52437432 | 52437910 | 52437669 | 52437670 | Frame_Shift_Ins | - | A | p.D498fs |
| UVM | TCGA-VD-AA8T-01 | exon_skip_384808 | 52437432 | 52437910 | 52437669 | 52437670 | Frame_Shift_Ins | - | A | p.E498fs |
| UVM | TCGA-VD-AA8T-01 | exon_skip_384808 | 52437432 | 52437910 | 52437669 | 52437670 | Frame_Shift_Ins | - | A | p.E498_I499delinsX |
| CHOL | TCGA-W5-AA36-01 | exon_skip_384808 | 52437432 | 52437910 | 52437677 | 52437678 | Frame_Shift_Ins | - | T | p.G495fs |
| UCEC | TCGA-D1-A0ZP-01 | exon_skip_384821 | 52441190 | 52441332 | 52441327 | 52441328 | Frame_Shift_Ins | - | C | p.E148fs |
| CESC | TCGA-C5-A1BM-01 | exon_skip_384808 | 52437432 | 52437910 | 52437782 | 52437782 | Nonsense_Mutation | G | C | p.S460* |
| KIRC | TCGA-B0-5095-01 | exon_skip_384808 | 52437432 | 52437910 | 52437782 | 52437782 | Nonsense_Mutation | G | C | p.S460* |
| KIRC | TCGA-B0-5095-01 | exon_skip_384808 | 52437432 | 52437910 | 52437782 | 52437782 | Nonsense_Mutation | G | C | p.S460X |
| LUAD | TCGA-97-A4LX-01 | exon_skip_384808 | 52437432 | 52437910 | 52437782 | 52437782 | Nonsense_Mutation | G | C | p.S460* |
| KIRC | TCGA-DV-A4W0-01 | exon_skip_384808 | 52437432 | 52437910 | 52437795 | 52437795 | Nonsense_Mutation | G | A | p.Q456X |
| LIHC | TCGA-DD-AADA-01 | exon_skip_384808 | 52437432 | 52437910 | 52437795 | 52437795 | Nonsense_Mutation | G | A | p.Q456X |
| MESO | TCGA-LK-A4O7-01 | exon_skip_384808 | 52437432 | 52437910 | 52437795 | 52437795 | Nonsense_Mutation | G | A | p.Q456* |
| UVM | TCGA-V4-A9EU-01 | exon_skip_384808 | 52437432 | 52437910 | 52437840 | 52437840 | Nonsense_Mutation | G | A | p.Q441* |
| UVM | TCGA-V4-A9EU-01 | exon_skip_384808 | 52437432 | 52437910 | 52437840 | 52437840 | Nonsense_Mutation | G | A | p.Q441X |
| CESC | TCGA-EK-A2RC-01 | exon_skip_384808 | 52437432 | 52437910 | 52437848 | 52437848 | Nonsense_Mutation | G | C | p.S438* |
| MESO | TCGA-3H-AB3T-01 | exon_skip_384813 | 52439781 | 52439928 | 52439862 | 52439862 | Nonsense_Mutation | C | A | p.E284* |
| LIHC | TCGA-G3-A25T-01 | exon_skip_384813 | 52439781 | 52439928 | 52439874 | 52439874 | Nonsense_Mutation | G | A | p.Q280* |
| LIHC | TCGA-G3-A25T-01 | exon_skip_384813 | 52439781 | 52439928 | 52439874 | 52439874 | Nonsense_Mutation | G | A | p.Q280X |
| MESO | TCGA-UT-A88C-01 | exon_skip_384813 | 52439781 | 52439928 | 52439874 | 52439874 | Nonsense_Mutation | G | A | p.Q280* |
| KIRC | TCGA-BP-4163-01 | exon_skip_384813 | 52439781 | 52439928 | 52439876 | 52439876 | Nonsense_Mutation | G | T | p.S279X |
| CESC | TCGA-EA-A44S-01 | exon_skip_384813 | 52439781 | 52439928 | 52439883 | 52439883 | Nonsense_Mutation | G | A | p.Q277* |
| CESC | TCGA-EK-A2RB-01 | exon_skip_384813 | 52439781 | 52439928 | 52439883 | 52439883 | Nonsense_Mutation | G | A | p.Q277* |
| BLCA | TCGA-DK-A3X2-01 | exon_skip_384813 | 52439781 | 52439928 | 52439898 | 52439898 | Nonsense_Mutation | G | A | p.Q272* |
| COAD | TCGA-AZ-6599-01 | exon_skip_384813 | 52439781 | 52439928 | 52439898 | 52439898 | Nonsense_Mutation | G | A | p.Q272X |
| KIRC | TCGA-B0-5092-01 | exon_skip_384813 | 52439781 | 52439928 | 52439913 | 52439913 | Nonsense_Mutation | G | A | p.Q267* |
| KIRC | TCGA-B0-5092-01 | exon_skip_384813 | 52439781 | 52439928 | 52439913 | 52439913 | Nonsense_Mutation | G | A | p.Q267X |
| CHOL | TCGA-W5-AA31-01 | exon_skip_384815 | 52440845 | 52440923 | 52440916 | 52440916 | Nonsense_Mutation | C | T | p.W196* |
| CHOL | TCGA-W5-AA31-01 | exon_skip_384815 | 52440845 | 52440923 | 52440916 | 52440916 | Nonsense_Mutation | C | T | p.W196X |
| KIRC | TCGA-CJ-4641-01 | exon_skip_384821 | 52441190 | 52441332 | 52441304 | 52441304 | Nonsense_Mutation | G | A | p.Q156X |
| LIHC | TCGA-DD-AADA-01 | exon_skip_384821 | 52441190 | 52441332 | 52441304 | 52441304 | Nonsense_Mutation | G | A | p.Q156X |
| LUAD | TCGA-73-4670-01 | exon_skip_384825 | 52442490 | 52442622 | 52442492 | 52442492 | Nonsense_Mutation | G | A | p.Q85* |
| KIRC | TCGA-CZ-5985-01 | exon_skip_384809 | 52439126 | 52439310 | 52439311 | 52439311 | Splice_Site | C | A | . |
| CHOL | TCGA-4G-AAZT-01 | exon_skip_384813 | 52439781 | 52439928 | 52439930 | 52439930 | Splice_Site | T | C | . |
| LIHC | TCGA-DD-A3A9-01 | exon_skip_384821 | 52441190 | 52441332 | 52441334 | 52441334 | Splice_Site | T | A | . |
| SKCM | TCGA-D3-A5GU-06 | exon_skip_384823 exon_skip_384824 | 52441415 | 52441476 | 52441477 | 52441477 | Splice_Site | C | T | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-73-4670-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_384825 | |
| Skipped exon start: 52442490 | |
| Skipped exon end: 52442622 | |
| Mutation start: 52442492 | |
| Mutation end: 52442492 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.Q85* | |
exon_skip_384825_LUAD_TCGA-73-4670-01.png | |
 | Sample: TCGA-DD-A3A9-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_384821 | |
| Skipped exon start: 52441190 | |
| Skipped exon end: 52441332 | |
| Mutation start: 52441334 | |
| Mutation end: 52441334 | |
| Mutation type: Splice_Site | |
| Reference seq: T | |
| Mutation seq: A | |
| AAchange: . | |
exon_skip_384821_LIHC_TCGA-DD-A3A9-01.png | |
 | Sample: TCGA-V4-A9E7-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384821 | |
| Skipped exon start: 52441190 | |
| Skipped exon end: 52441332 | |
| Mutation start: 52441330 | |
| Mutation end: 52441383 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: GGCCTGGGGAAAAACAGAGTCAGGGCCCAAAAAATGATACTCCCCCTACTCCCA | |
| Mutation seq: - | |
| AAchange: p.146_147del | |
exon_skip_384821_UVM_TCGA-V4-A9E7-01.png | |
 | Sample: TCGA-YZ-A980-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384809 | |
| Skipped exon start: 52439126 | |
| Skipped exon end: 52439310 | |
| Mutation start: 52439229 | |
| Mutation end: 52439229 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P338fs | |
| Sample: TCGA-YZ-A980-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384809 | |
| Skipped exon start: 52439126 | |
| Skipped exon end: 52439310 | |
| Mutation start: 52439229 | |
| Mutation end: 52439229 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.P339fs | |
| Sample: TCGA-YZ-A980-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384809 | |
| Skipped exon start: 52439126 | |
| Skipped exon end: 52439310 | |
| Mutation start: 52439228 | |
| Mutation end: 52439229 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: AG | |
| Mutation seq: - | |
| AAchange: p.P339fs | |
exon_skip_384809_UVM_TCGA-YZ-A980-01.png | |
 | Sample: TCGA-C5-A1BM-01 |
| Cancer type: CESC | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437782 | |
| Mutation end: 52437782 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: C | |
| AAchange: p.S460* | |
exon_skip_384808_CESC_TCGA-C5-A1BM-01.png | |
 | Sample: TCGA-EK-A2RC-01 |
| Cancer type: CESC | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437848 | |
| Mutation end: 52437848 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: C | |
| AAchange: p.S438* | |
exon_skip_384808_CESC_TCGA-EK-A2RC-01.png | |
 | Sample: TCGA-DV-A4W0-01 |
| Cancer type: KIRC | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437795 | |
| Mutation end: 52437795 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.Q456X | |
exon_skip_290456_KIRC_TCGA-DV-A4W0-01.png | |
exon_skip_384808_KIRC_TCGA-DV-A4W0-01.png | |
exon_skip_463121_KIRC_TCGA-DV-A4W0-01.png | |
 | Sample: TCGA-B0-5095-01 |
| Cancer type: KIRC | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437782 | |
| Mutation end: 52437782 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: C | |
| AAchange: p.S460X | |
| Sample: TCGA-B0-5095-01 |
| Cancer type: KIRC | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437782 | |
| Mutation end: 52437782 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: C | |
| AAchange: p.S460* | |
exon_skip_384808_KIRC_TCGA-B0-5095-01.png | |
 | Sample: TCGA-97-A4LX-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437782 | |
| Mutation end: 52437782 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: C | |
| AAchange: p.S460* | |
exon_skip_384808_LUAD_TCGA-97-A4LX-01.png | |
 | Sample: TCGA-LK-A4O7-01 |
| Cancer type: MESO | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437795 | |
| Mutation end: 52437795 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: G | |
| Mutation seq: A | |
| AAchange: p.Q456* | |
exon_skip_337136_MESO_TCGA-LK-A4O7-01.png | |
exon_skip_384808_MESO_TCGA-LK-A4O7-01.png | |
 | Sample: TCGA-CW-6097-01 |
| Cancer type: KIRC | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437530 | |
| Mutation end: 52437533 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: ATGC | |
| Mutation seq: - | |
| AAchange: p.CI543fs | |
exon_skip_384808_KIRC_TCGA-CW-6097-01.png | |
 | Sample: TCGA-G7-A8LD-01 |
| Cancer type: KIRP | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437709 | |
| Mutation end: 52437709 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.S485fs | |
exon_skip_384808_KIRP_TCGA-G7-A8LD-01.png | |
exon_skip_516648_KIRP_TCGA-G7-A8LD-01.png | |
 | Sample: TCGA-AL-3473-01 |
| Cancer type: KIRP | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437889 | |
| Mutation end: 52437889 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.K425fs | |
| Sample: TCGA-AL-3473-01 |
| Cancer type: KIRP | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437889 | |
| Mutation end: 52437889 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.G424fs | |
exon_skip_384808_KIRP_TCGA-AL-3473-01.png | |
 | Sample: TCGA-CC-5260-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437456 | |
| Mutation end: 52437456 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.V569fs | |
exon_skip_379495_LIHC_TCGA-CC-5260-01.png | |
exon_skip_384808_LIHC_TCGA-CC-5260-01.png | |
 | Sample: TCGA-95-7948-01 |
| Cancer type: LUAD | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437500 | |
| Mutation end: 52437500 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: C | |
| Mutation seq: - | |
| AAchange: p.G554fs | |
exon_skip_384808_LUAD_TCGA-95-7948-01.png | |
 | Sample: TCGA-3H-AB3U-01 |
| Cancer type: MESO | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437899 | |
| Mutation end: 52437908 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: TTCCCCTTAT | |
| Mutation seq: - | |
| AAchange: p.YKGK418fs | |
exon_skip_384808_MESO_TCGA-3H-AB3U-01.png | |
 | Sample: TCGA-YZ-A984-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437899 | |
| Mutation end: 52437899 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: T | |
| Mutation seq: - | |
| AAchange: p.K421fs | |
| Sample: TCGA-YZ-A984-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437898 | |
| Mutation end: 52437899 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: CT | |
| Mutation seq: - | |
| AAchange: p.K421fs | |
exon_skip_121129_UVM_TCGA-YZ-A984-01.png | |
exon_skip_384808_UVM_TCGA-YZ-A984-01.png | |
 | Sample: TCGA-V4-A9F0-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437795 | |
| Mutation end: 52437795 | |
| Mutation type: Frame_Shift_Del | |
| Reference seq: G | |
| Mutation seq: - | |
| AAchange: p.Q456fs | |
exon_skip_384808_UVM_TCGA-V4-A9F0-01.png | |
 | Sample: TCGA-VD-AA8T-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437669 | |
| Mutation end: 52437670 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: A | |
| AAchange: p.E498_I499delinsX | |
| Sample: TCGA-VD-AA8T-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437669 | |
| Mutation end: 52437670 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: A | |
| AAchange: p.D498fs | |
| Sample: TCGA-VD-AA8T-01 |
| Cancer type: UVM | |
| ESID: exon_skip_384808 | |
| Skipped exon start: 52437432 | |
| Skipped exon end: 52437910 | |
| Mutation start: 52437669 | |
| Mutation end: 52437670 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: A | |
| AAchange: p.E498fs | |
exon_skip_384808_UVM_TCGA-VD-AA8T-01.png | |
 | Sample: TCGA-XT-AASU-01 |
| Cancer type: MESO | |
| ESID: exon_skip_384801 | |
| Skipped exon start: 52436795 | |
| Skipped exon end: 52436956 | |
| Mutation start: 52436846 | |
| Mutation end: 52436847 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: G | |
| AAchange: p.E644fs | |
| Sample: TCGA-XT-AASU-01 |
| Cancer type: MESO | |
| ESID: exon_skip_384798 | |
| Skipped exon start: 52436795 | |
| Skipped exon end: 52436887 | |
| Mutation start: 52436846 | |
| Mutation end: 52436847 | |
| Mutation type: Frame_Shift_Ins | |
| Reference seq: - | |
| Mutation seq: G | |
| AAchange: p.E644fs | |
exon_skip_384801_MESO_TCGA-XT-AASU-01.png | |
exon_skip_60189_MESO_TCGA-XT-AASU-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| SLR23_KIDNEY | 52437432 | 52437910 | 52437599 | 52437599 | Frame_Shift_Del | C | - | p.S521fs |
| NCIBL1770_MATCHED_NORMAL_TISSUE | 52436795 | 52436956 | 52436847 | 52436847 | Missense_Mutation | G | A | p.A644V |
| NCIBL1770_MATCHED_NORMAL_TISSUE | 52436795 | 52436887 | 52436847 | 52436847 | Missense_Mutation | G | A | p.A644V |
| NCIH1770_LUNG | 52436795 | 52436956 | 52436847 | 52436847 | Missense_Mutation | G | A | p.A644V |
| NCIH1770_LUNG | 52436795 | 52436887 | 52436847 | 52436847 | Missense_Mutation | G | A | p.A644V |
| NCIH2106_LUNG | 52436795 | 52436956 | 52436847 | 52436847 | Missense_Mutation | G | A | p.A644V |
| NCIH2106_LUNG | 52436795 | 52436887 | 52436847 | 52436847 | Missense_Mutation | G | A | p.A644V |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52436795 | 52436956 | 52436863 | 52436863 | Missense_Mutation | C | A | p.V639L |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52436795 | 52436887 | 52436863 | 52436863 | Missense_Mutation | C | A | p.V639L |
| 639V_URINARY_TRACT | 52437432 | 52437910 | 52437594 | 52437594 | Missense_Mutation | C | T | p.V523I |
| RKO_LARGE_INTESTINE | 52437432 | 52437910 | 52437597 | 52437597 | Missense_Mutation | G | T | p.P522T |
| ES6_BONE | 52437432 | 52437910 | 52437599 | 52437599 | Missense_Mutation | C | A | p.S521I |
| HCT15_LARGE_INTESTINE | 52437432 | 52437910 | 52437611 | 52437611 | Missense_Mutation | G | A | p.T517M |
| HRT18_LARGE_INTESTINE | 52437432 | 52437910 | 52437611 | 52437611 | Missense_Mutation | G | A | p.T517M |
| SNUC5_LARGE_INTESTINE | 52437432 | 52437910 | 52437617 | 52437617 | Missense_Mutation | T | C | p.N515S |
| CALU6_LUNG | 52437432 | 52437910 | 52437626 | 52437626 | Missense_Mutation | C | A | p.R512L |
| CW2_LARGE_INTESTINE | 52437432 | 52437910 | 52437639 | 52437639 | Missense_Mutation | G | A | p.R508C |
| DV90_LUNG | 52437432 | 52437910 | 52437662 | 52437662 | Missense_Mutation | C | T | p.G500D |
| PWR1E_PROSTATE | 52437432 | 52437910 | 52437691 | 52437691 | Missense_Mutation | A | C | p.N490K |
| GP2D_LARGE_INTESTINE | 52437432 | 52437910 | 52437716 | 52437716 | Missense_Mutation | G | A | p.S482L |
| GP5D_LARGE_INTESTINE | 52437432 | 52437910 | 52437716 | 52437716 | Missense_Mutation | G | A | p.S482L |
| PA1_OVARY | 52437432 | 52437910 | 52437753 | 52437753 | Missense_Mutation | C | T | p.G470R |
| MDAMB361_BREAST | 52437432 | 52437910 | 52437774 | 52437774 | Missense_Mutation | G | C | p.L463V |
| HEC1B_ENDOMETRIUM | 52437432 | 52437910 | 52437822 | 52437822 | Missense_Mutation | C | T | p.V447I |
| ISTMEL1_SKIN | 52437432 | 52437910 | 52437827 | 52437827 | Missense_Mutation | A | C | p.I445S |
| SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52437432 | 52437910 | 52437836 | 52437836 | Missense_Mutation | G | T | p.P442H |
| UMUC5_URINARY_TRACT | 52437432 | 52437910 | 52437848 | 52437848 | Missense_Mutation | G | A | p.S438L |
| DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52437432 | 52437910 | 52437851 | 52437851 | Missense_Mutation | A | G | p.L437P |
| NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52439126 | 52439310 | 52439211 | 52439211 | Missense_Mutation | T | C | p.N344S |
| CCK81_LARGE_INTESTINE | 52439781 | 52439928 | 52439792 | 52439792 | Missense_Mutation | C | T | p.G307D |
| SUPHD1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52439781 | 52439928 | 52439816 | 52439816 | Missense_Mutation | T | C | p.N299S |
| A3KAW_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52439781 | 52439928 | 52439923 | 52439923 | Missense_Mutation | T | C | p.I263M |
| MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52440845 | 52440923 | 52440867 | 52440867 | Missense_Mutation | G | A | p.R213C |
| CW2_LARGE_INTESTINE | 52440845 | 52440923 | 52440881 | 52440881 | Missense_Mutation | C | T | p.R208Q |
| PACADD137_PANCREAS | 52441190 | 52441332 | 52441235 | 52441235 | Missense_Mutation | G | A | p.R179W |
| NCIH211_LUNG | 52441190 | 52441332 | 52441237 | 52441237 | Missense_Mutation | C | A | p.G178V |
| HEC151_ENDOMETRIUM | 52441190 | 52441332 | 52441247 | 52441247 | Missense_Mutation | G | A | p.P175S |
| C8166_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52441190 | 52441332 | 52441283 | 52441283 | Missense_Mutation | G | A | p.R163W |
| R262_CENTRAL_NERVOUS_SYSTEM | 52441415 | 52441476 | 52441433 | 52441433 | Missense_Mutation | G | A | p.A140V |
| LU139_LUNG | 52436795 | 52436956 | 52436839 | 52436839 | Nonsense_Mutation | C | A | p.E647* |
| LU139_LUNG | 52436795 | 52436887 | 52436839 | 52436839 | Nonsense_Mutation | C | A | p.E647* |
| TFK1_BILIARY_TRACT | 52437432 | 52437910 | 52437795 | 52437795 | Nonsense_Mutation | G | A | p.Q456* |
| TUHR14TKB_KIDNEY | 52439781 | 52439928 | 52439852 | 52439852 | Nonsense_Mutation | G | T | p.S287* |
| MOLT3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 52440845 | 52440923 | 52440870 | 52440870 | Nonsense_Mutation | C | A | p.E212* |
| NCIH28_PLEURA | 52441190 | 52441332 | 52441329 | 52441351 | Splice_Site | GGGCCTGGGGAAAAACAGAGTCA | - | p.SD146fs |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for BAP1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BAP1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BAP1 |
Top |
RelatedDrugs for BAP1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for BAP1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| BAP1 | C0007134 | Renal Cell Carcinoma | 4 | CTD_human |
| BAP1 | C0025500 | Mesothelioma | 4 | CTD_human |
| BAP1 | C0345967 | Malignant mesothelioma | 4 | CTD_human |
| BAP1 | C0220633 | Uveal melanoma | 3 | CTD_human;HPO |
| BAP1 | C0038356 | Stomach Neoplasms | 2 | CTD_human |
| BAP1 | C0151779 | Cutaneous Melanoma | 2 | CTD_human |
| BAP1 | C0206698 | Cholangiocarcinoma | 2 | CTD_human |
| BAP1 | C1458155 | Mammary Neoplasms | 2 | CTD_human |
| BAP1 | C0005695 | Bladder Neoplasm | 1 | CTD_human |
| BAP1 | C0005967 | Bone neoplasms | 1 | CTD_human |
| BAP1 | C0007117 | Basal cell carcinoma | 1 | CTD_human |
| BAP1 | C0009375 | Colonic Neoplasms | 1 | CTD_human |
| BAP1 | C0018671 | Head and Neck Neoplasms | 1 | CTD_human |
| BAP1 | C0022665 | Kidney Neoplasm | 1 | CTD_human |
| BAP1 | C0023418 | leukemia | 1 | CTD_human |
| BAP1 | C0023798 | Lipoma | 1 | CTD_human |
| BAP1 | C0023903 | Liver neoplasms | 1 | CTD_human |
| BAP1 | C0024121 | Lung Neoplasms | 1 | CTD_human |
| BAP1 | C0025286 | Meningioma | 1 | CTD_human;HPO |
| BAP1 | C0030297 | Pancreatic Neoplasm | 1 | CTD_human |
| BAP1 | C0030421 | Paraganglioma | 1 | CTD_human |
| BAP1 | C0033578 | Prostatic Neoplasms | 1 | CTD_human |
| BAP1 | C0039590 | Testicular Neoplasms | 1 | CTD_human |
| BAP1 | C0040100 | Thymoma | 1 | CTD_human |
| BAP1 | C0042138 | Uterine Neoplasms | 1 | CTD_human |
| BAP1 | C0085136 | Central Nervous System Neoplasms | 1 | CTD_human |
| BAP1 | C0152013 | Adenocarcinoma of lung (disorder) | 1 | CTD_human;HPO |
| BAP1 | C0206686 | Adrenocortical carcinoma | 1 | CTD_human |
| BAP1 | C0206694 | Mucoepidermoid Carcinoma | 1 | CTD_human |
| BAP1 | C0206739 | Epithelioid and spindle cell nevus | 1 | CTD_human |
| BAP1 | C0206754 | Neuroendocrine Tumors | 1 | CTD_human |
| BAP1 | C0206769 | Nevi and Melanomas | 1 | CTD_human |
| BAP1 | C0919267 | ovarian neoplasm | 1 | CTD_human |
| BAP1 | C2931822 | Nasopharyngeal carcinoma | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|