|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for VIM |
 Gene summary |
| Gene information | Gene symbol | VIM | Gene ID | 7431 |
| Gene name | vimentin | |
| Synonyms | - | |
| Cytomap | 10p13 | |
| Type of gene | protein-coding | |
| Description | vimentin | |
| Modification date | 20180527 | |
| UniProtAcc | P08670 | |
| Context | PubMed: VIM [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for VIM from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for VIM |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for VIM |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_39915 | 10 | 17271289:17271984:17272648:17272709:17275585:17275681 | 17272648:17272709 | ENSG00000026025.9 | ENST00000487938.1,ENST00000544301.1,ENST00000224237.5 |
| exon_skip_39921 | 10 | 17272648:17272709:17275585:17275681:17275768:17275930 | 17275585:17275681 | ENSG00000026025.9 | ENST00000487938.1,ENST00000544301.1,ENST00000469543.1,ENST00000224237.5,ENST00000421459.2 |
| exon_skip_39928 | 10 | 17275768:17275930:17276691:17276817:17277167:17277388 | 17276691:17276817 | ENSG00000026025.9 | ENST00000487938.1,ENST00000544301.1,ENST00000469543.1,ENST00000224237.5 |
| exon_skip_39933 | 10 | 17276691:17276817:17277167:17277388:17277844:17277888 | 17277167:17277388 | ENSG00000026025.9 | ENST00000487938.1,ENST00000544301.1,ENST00000224237.5 |
| exon_skip_39936 | 10 | 17277168:17277388:17277844:17277888:17278292:17278378 | 17277844:17277888 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5 |
| exon_skip_39939 | 10 | 17277167:17277388:17277844:17278378:17279228:17279584 | 17277844:17278378 | ENSG00000026025.9 | ENST00000487938.1 |
| exon_skip_39942 | 10 | 17277844:17277888:17278292:17278378:17279228:17279285 | 17278292:17278378 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for VIM |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_39915 | 10 | 17271289:17271984:17272648:17272709:17275585:17275681 | 17272648:17272709 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5,ENST00000487938.1 |
| exon_skip_39921 | 10 | 17272648:17272709:17275585:17275681:17275768:17275930 | 17275585:17275681 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5,ENST00000487938.1,ENST00000469543.1,ENST00000421459.2 |
| exon_skip_39928 | 10 | 17275768:17275930:17276691:17276817:17277167:17277388 | 17276691:17276817 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5,ENST00000487938.1,ENST00000469543.1 |
| exon_skip_39933 | 10 | 17276691:17276817:17277167:17277388:17277844:17277888 | 17277167:17277388 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5,ENST00000487938.1 |
| exon_skip_39936 | 10 | 17277168:17277388:17277844:17277888:17278292:17278378 | 17277844:17277888 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5 |
| exon_skip_39939 | 10 | 17277167:17277388:17277844:17278378:17279228:17279584 | 17277844:17278378 | ENSG00000026025.9 | ENST00000487938.1 |
| exon_skip_39942 | 10 | 17277844:17277888:17278292:17278378:17279228:17279285 | 17278292:17278378 | ENSG00000026025.9 | ENST00000544301.1,ENST00000224237.5 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for VIM |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000224237 | 17272648 | 17272709 | Frame-shift |
| ENST00000544301 | 17272648 | 17272709 | Frame-shift |
| ENST00000224237 | 17277167 | 17277388 | Frame-shift |
| ENST00000544301 | 17277167 | 17277388 | Frame-shift |
| ENST00000224237 | 17277844 | 17277888 | Frame-shift |
| ENST00000544301 | 17277844 | 17277888 | Frame-shift |
| ENST00000224237 | 17278292 | 17278378 | Frame-shift |
| ENST00000544301 | 17278292 | 17278378 | Frame-shift |
| ENST00000224237 | 17275585 | 17275681 | In-frame |
| ENST00000544301 | 17275585 | 17275681 | In-frame |
| ENST00000224237 | 17276691 | 17276817 | In-frame |
| ENST00000544301 | 17276691 | 17276817 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000224237 | 17272648 | 17272709 | Frame-shift |
| ENST00000544301 | 17272648 | 17272709 | Frame-shift |
| ENST00000224237 | 17277167 | 17277388 | Frame-shift |
| ENST00000544301 | 17277167 | 17277388 | Frame-shift |
| ENST00000224237 | 17277844 | 17277888 | Frame-shift |
| ENST00000544301 | 17277844 | 17277888 | Frame-shift |
| ENST00000224237 | 17278292 | 17278378 | Frame-shift |
| ENST00000544301 | 17278292 | 17278378 | Frame-shift |
| ENST00000224237 | 17275585 | 17275681 | In-frame |
| ENST00000544301 | 17275585 | 17275681 | In-frame |
| ENST00000224237 | 17276691 | 17276817 | In-frame |
| ENST00000544301 | 17276691 | 17276817 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for VIM |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000224237 | 1885 | 466 | 17275585 | 17275681 | 770 | 865 | 208 | 240 |
| ENST00000544301 | 2145 | 466 | 17275585 | 17275681 | 1038 | 1133 | 208 | 240 |
| ENST00000224237 | 1885 | 466 | 17276691 | 17276817 | 1028 | 1153 | 294 | 336 |
| ENST00000544301 | 2145 | 466 | 17276691 | 17276817 | 1296 | 1421 | 294 | 336 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000224237 | 1885 | 466 | 17275585 | 17275681 | 770 | 865 | 208 | 240 |
| ENST00000544301 | 2145 | 466 | 17275585 | 17275681 | 1038 | 1133 | 208 | 240 |
| ENST00000224237 | 1885 | 466 | 17276691 | 17276817 | 1028 | 1153 | 294 | 336 |
| ENST00000544301 | 2145 | 466 | 17276691 | 17276817 | 1296 | 1421 | 294 | 336 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for VIM |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_39921 | 17275586 | 17275681 | 17275658 | 17275658 | Frame_Shift_Del | T | - | p.F233fs |
| LUAD | TCGA-86-A4JF-01 | exon_skip_39921 | 17275586 | 17275681 | 17275658 | 17275658 | Frame_Shift_Del | T | - | p.F233fs |
| UCEC | TCGA-B5-A0JZ-01 | exon_skip_39915 | 17272649 | 17272709 | 17272668 | 17272669 | Frame_Shift_Ins | - | AG | p.E198fs |
| UCEC | TCGA-B5-A0JZ-01 | exon_skip_39915 | 17272649 | 17272709 | 17272668 | 17272669 | Frame_Shift_Ins | - | AG | p.Q195fs |
| LIHC | TCGA-BC-A10U-01 | exon_skip_39933 | 17277168 | 17277388 | 17277290 | 17277291 | Frame_Shift_Ins | - | C | p.A377fs |
| LIHC | TCGA-BC-A10U-01 | exon_skip_39933 | 17277168 | 17277388 | 17277290 | 17277291 | Frame_Shift_Ins | - | C | p.S378fs |
| LUAD | TCGA-44-7671-01 | exon_skip_39921 | 17275586 | 17275681 | 17275634 | 17275634 | Nonsense_Mutation | G | T | p.E225* |
| LUAD | TCGA-95-7043-01 | exon_skip_39928 | 17276692 | 17276817 | 17276749 | 17276749 | Nonsense_Mutation | C | T | p.Q314* |
| UCEC | TCGA-EY-A1GS-01 | exon_skip_39939 | 17277845 | 17278378 | 17278332 | 17278332 | Nonsense_Mutation | C | G | p.S438* |
| UCEC | TCGA-EY-A1GS-01 | exon_skip_39942 | 17278293 | 17278378 | 17278332 | 17278332 | Nonsense_Mutation | C | G | p.S438* |
| COAD | TCGA-AA-3510-01 | exon_skip_39942 | 17278293 | 17278378 | 17278292 | 17278292 | Splice_Site | G | T | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-EY-A1GS-01 |
| Cancer type: UCEC | |
| ESID: exon_skip_39942 | |
| Skipped exon start: 17278293 | |
| Skipped exon end: 17278378 | |
| Mutation start: 17278332 | |
| Mutation end: 17278332 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: C | |
| Mutation seq: G | |
| AAchange: p.S438* | |
| Sample: TCGA-EY-A1GS-01 |
| Cancer type: UCEC | |
| ESID: exon_skip_39939 | |
| Skipped exon start: 17277845 | |
| Skipped exon end: 17278378 | |
| Mutation start: 17278332 | |
| Mutation end: 17278332 | |
| Mutation type: Nonsense_Mutation | |
| Reference seq: C | |
| Mutation seq: G | |
| AAchange: p.S438* | |
exon_skip_39939_UCEC_TCGA-EY-A1GS-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| JAR_PLACENTA | 17278293 | 17278378 | 17278303 | 17278303 | Frame_Shift_Del | G | - | p.L428fs |
| JAR_PLACENTA | 17277845 | 17278378 | 17278303 | 17278303 | Frame_Shift_Del | G | - | p.L428fs |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 17272649 | 17272709 | 17272687 | 17272687 | Missense_Mutation | A | G | p.N201S |
| NCIH2126_LUNG | 17275586 | 17275681 | 17275655 | 17275655 | Missense_Mutation | G | T | p.A232S |
| CORL311_LUNG | 17276692 | 17276817 | 17276707 | 17276707 | Missense_Mutation | G | A | p.E300K |
| JSC1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 17276692 | 17276817 | 17276720 | 17276720 | Missense_Mutation | G | A | p.R304Q |
| NCIH460_LUNG | 17276692 | 17276817 | 17276731 | 17276731 | Missense_Mutation | G | T | p.A308S |
| DU4475_BREAST | 17276692 | 17276817 | 17276731 | 17276731 | Missense_Mutation | G | T | p.A308S |
| HT115_LARGE_INTESTINE | 17276692 | 17276817 | 17276755 | 17276755 | Missense_Mutation | T | C | p.S316P |
| CP66MEL_SKIN | 17276692 | 17276817 | 17276804 | 17276804 | Missense_Mutation | C | T | p.A332V |
| NCIH69_LUNG | 17277168 | 17277388 | 17277243 | 17277243 | Missense_Mutation | A | G | p.I362V |
| SIMA_AUTONOMIC_GANGLIA | 17277168 | 17277388 | 17277249 | 17277249 | Missense_Mutation | C | T | p.R364C |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 17277845 | 17277888 | 17277865 | 17277865 | Missense_Mutation | A | C | p.N417T |
| BICR18_UPPER_AERODIGESTIVE_TRACT | 17277845 | 17278378 | 17277865 | 17277865 | Missense_Mutation | A | C | p.N417T |
| LOXIMVI_SKIN | 17278293 | 17278378 | 17278308 | 17278308 | Missense_Mutation | C | T | p.S430L |
| LOXIMVI_SKIN | 17277845 | 17278378 | 17278308 | 17278308 | Missense_Mutation | C | T | p.S430L |
| K2_SKIN | 17278293 | 17278378 | 17278313 | 17278313 | Missense_Mutation | C | T | p.P432S |
| K2_SKIN | 17277845 | 17278378 | 17278313 | 17278313 | Missense_Mutation | C | T | p.P432S |
| HT3_CERVIX | 17278293 | 17278378 | 17278332 | 17278332 | Missense_Mutation | C | T | p.S438L |
| HT3_CERVIX | 17277845 | 17278378 | 17278332 | 17278332 | Missense_Mutation | C | T | p.S438L |
| NCIH513_PLEURA | 17278293 | 17278378 | 17278376 | 17278376 | Missense_Mutation | C | G | p.Q453E |
| NCIH513_PLEURA | 17277845 | 17278378 | 17278376 | 17278376 | Missense_Mutation | C | G | p.Q453E |
| SH10TC_STOMACH | 17278293 | 17278378 | 17278280 | 17278299 | Splice_Site | TTTGTTTATTTAGAAACTAA | - | p.FVY425fs |
| SH10TC_STOMACH | 17277845 | 17278378 | 17278280 | 17278299 | Splice_Site | TTTGTTTATTTAGAAACTAA | - | p.FVY425fs |
| SNU878_LIVER | 17278293 | 17278378 | 17278294 | 17278294 | Splice_Site | A | C | p.E425D |
| SNU878_LIVER | 17277845 | 17278378 | 17278294 | 17278294 | Splice_Site | A | C | p.E425D |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for VIM |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for VIM |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for VIM |
Top |
RelatedDrugs for VIM |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for VIM |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| VIM | C1458155 | Mammary Neoplasms | 3 | CTD_human |
| VIM | C0023890 | Liver Cirrhosis | 2 | CTD_human |
| VIM | C0029408 | Degenerative polyarthritis | 2 | CTD_human |
| VIM | C0033578 | Prostatic Neoplasms | 2 | CTD_human |
| VIM | C0007140 | Carcinosarcoma | 1 | CTD_human |
| VIM | C0007621 | Neoplastic Cell Transformation | 1 | CTD_human |
| VIM | C0023893 | Liver Cirrhosis, Experimental | 1 | CTD_human |
| VIM | C0027627 | Neoplasm Metastasis | 1 | CTD_human |
| VIM | C0027720 | Nephrosis | 1 | CTD_human |
| VIM | C0031149 | Peritoneal Neoplasms | 1 | CTD_human |
| VIM | C0035126 | Reperfusion Injury | 1 | CTD_human |
| VIM | C0035309 | Retinal Diseases | 1 | CTD_human |
| VIM | C0039101 | synovial sarcoma | 1 | CTD_human |
| VIM | C0043094 | Weight Gain | 1 | CTD_human |
| VIM | C0085084 | Motor Neuron Disease | 1 | CTD_human |
| VIM | C0086543 | Cataract | 1 | CTD_human |
| VIM | C0345967 | Malignant mesothelioma | 1 | CTD_human |
| VIM | C0524851 | Neurodegenerative Disorders | 1 | CTD_human |
| VIM | C0948089 | Acute Coronary Syndrome | 1 | CTD_human |
| VIM | C1862939 | AMYOTROPHIC LATERAL SCLEROSIS 1 | 1 | CTD_human |
| VIM | C3805411 | CATARACT 30 | 1 | UNIPROT |
| VIM | C4277682 | Chemical and Drug Induced Liver Injury | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|