ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for TSC2

Gene summary

Gene information	Gene symbol	TSC2
	Gene ID	7249
	Gene name	TSC complex subunit 2
	Synonyms	LAM\|PPP1R160\|TSC4
	Cytomap	16p13.3
	Type of gene	protein-coding
	Description	tuberinprotein phosphatase 1, regulatory subunit 160tuberous sclerosis 2 protein
	Modification date	20180527
	UniProtAcc	P49815
	Context	PubMed: TSC2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for TSC2 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for TSC2

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for TSC2

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_132417	16	2098033:2098066:2098587:2098754:2100400:2100487	2098587:2098754	ENSG00000103197.12	ENST00000461648.2,ENST00000353929.4,ENST00000350773.4,ENST00000439117.2,ENST00000401874.2,ENST00000439673.2
exon_skip_132419	16	2098587:2098754:2100400:2100487:2103342:2103453	2100400:2100487	ENSG00000103197.12	ENST00000461648.2,ENST00000353929.4,ENST00000568454.1,ENST00000350773.4,ENST00000219476.3,ENST00000401874.2
exon_skip_132421	16	2100400:2100487:2103342:2103453:2104296:2104441	2103342:2103453	ENSG00000103197.12	ENST00000353929.4,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000401874.2
exon_skip_132424	16	2107105:2107179:2108747:2108874:2110670:2110814	2108747:2108874	ENSG00000103197.12	ENST00000353929.4,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000439673.2
exon_skip_132426	16	2108747:2108874:2110670:2110814:2111871:2112009	2110670:2110814	ENSG00000103197.12	ENST00000353929.4,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000439673.2
exon_skip_132435	16	2112529:2112601:2112972:2113054:2114272:2114428	2112972:2113054	ENSG00000103197.12	ENST00000353929.4,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000439673.2
exon_skip_132438	16	2114272:2114428:2115519:2115636:2120456:2120579	2115519:2115636	ENSG00000103197.12	ENST00000353929.4,ENST00000568566.1,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000439673.2
exon_skip_132443	16	2126491:2126586:2127598:2127727:2129032:2129197	2127598:2127727	ENSG00000103197.12	ENST00000350773.4,ENST00000219476.3
exon_skip_132449	16	2129035:2129197:2129276:2129429:2129557:2129596	2129276:2129429	ENSG00000103197.12	ENST00000471143.1,ENST00000353929.4,ENST00000483020.1,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000568366.1,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000497886.1,ENST00000439673.2
exon_skip_132457	16	2131672:2131799:2132436:2132505:2133695:2133817	2132436:2132505	ENSG00000103197.12	ENST00000353929.4,ENST00000219476.3,ENST00000439117.2
exon_skip_132467	16	2133695:2133817:2134228:2134716:2134951:2135027	2134228:2134716	ENSG00000103197.12	ENST00000353929.4,ENST00000569110.1,ENST00000569930.1,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000497886.1,ENST00000439673.2
exon_skip_132472	16	2134951:2135027:2135230:2135323:2136193:2136380	2135230:2135323	ENSG00000103197.12	ENST00000353929.4,ENST00000569110.1,ENST00000569930.1,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000497886.1,ENST00000439673.2
exon_skip_132479	16	2137863:2137942:2138048:2138140:2138227:2138326	2138048:2138140	ENSG00000103197.12	ENST00000353929.4,ENST00000569110.1,ENST00000569930.1,ENST00000568454.1,ENST00000350773.4,ENST00000382538.6,ENST00000219476.3,ENST00000439117.2,ENST00000401874.2,ENST00000497886.1,ENST00000439673.2

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for TSC2

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_132417	16	2098033:2098066:2098587:2098754:2100400:2100487	2098587:2098754	ENSG00000103197.12	ENST00000401874.2,ENST00000353929.4,ENST00000461648.2,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2
exon_skip_132419	16	2098587:2098754:2100400:2100487:2103342:2103453	2100400:2100487	ENSG00000103197.12	ENST00000219476.3,ENST00000401874.2,ENST00000353929.4,ENST00000461648.2,ENST00000350773.4,ENST00000568454.1
exon_skip_132421	16	2100400:2100487:2103342:2103453:2104296:2104441	2103342:2103453	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000350773.4,ENST00000568454.1
exon_skip_132424	16	2107105:2107179:2108747:2108874:2110670:2110814	2108747:2108874	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1
exon_skip_132426	16	2108747:2108874:2110670:2110814:2111871:2112009	2110670:2110814	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1
exon_skip_132435	16	2112529:2112601:2112972:2113054:2114272:2114428	2112972:2113054	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1
exon_skip_132438	16	2114272:2114428:2115519:2115636:2120456:2120579	2115519:2115636	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1,ENST00000568566.1
exon_skip_132440	16	2116229:2116451:2118558:2118777:2120456:2120579	2118558:2118777	ENSG00000103197.12	ENST00000562474.1
exon_skip_132443	16	2126491:2126586:2127598:2127727:2129032:2129197	2127598:2127727	ENSG00000103197.12	ENST00000219476.3,ENST00000350773.4
exon_skip_132449	16	2129035:2129197:2129276:2129429:2129557:2129596	2129276:2129429	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1,ENST00000483020.1,ENST00000471143.1,ENST00000568366.1,ENST00000497886.1
exon_skip_132457	16	2131672:2131799:2132436:2132505:2133695:2133817	2132436:2132505	ENSG00000103197.12	ENST00000219476.3,ENST00000353929.4,ENST00000439117.2
exon_skip_132467	16	2133695:2133817:2134228:2134716:2134951:2135027	2134228:2134716	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1,ENST00000497886.1,ENST00000569930.1,ENST00000569110.1
exon_skip_132472	16	2134951:2135027:2135230:2135323:2136193:2136380	2135230:2135323	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1,ENST00000497886.1,ENST00000569930.1,ENST00000569110.1
exon_skip_132479	16	2137863:2137942:2138048:2138140:2138227:2138326	2138048:2138140	ENSG00000103197.12	ENST00000219476.3,ENST00000382538.6,ENST00000401874.2,ENST00000353929.4,ENST00000439673.2,ENST00000350773.4,ENST00000439117.2,ENST00000568454.1,ENST00000497886.1,ENST00000569930.1,ENST00000569110.1

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for TSC2

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000219476	2108747	2108874	Frame-shift
ENST00000219476	2112972	2113054	Frame-shift
ENST00000219476	2134228	2134716	Frame-shift
ENST00000219476	2138048	2138140	Frame-shift
ENST00000219476	2100400	2100487	In-frame
ENST00000219476	2103342	2103453	In-frame
ENST00000219476	2110670	2110814	In-frame
ENST00000219476	2115519	2115636	In-frame
ENST00000219476	2127598	2127727	In-frame
ENST00000219476	2129276	2129429	In-frame
ENST00000219476	2132436	2132505	In-frame
ENST00000219476	2135230	2135323	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000219476	2108747	2108874	Frame-shift
ENST00000219476	2112972	2113054	Frame-shift
ENST00000219476	2134228	2134716	Frame-shift
ENST00000219476	2138048	2138140	Frame-shift
ENST00000219476	2100400	2100487	In-frame
ENST00000219476	2103342	2103453	In-frame
ENST00000219476	2110670	2110814	In-frame
ENST00000219476	2115519	2115636	In-frame
ENST00000219476	2127598	2127727	In-frame
ENST00000219476	2129276	2129429	In-frame
ENST00000219476	2132436	2132505	In-frame
ENST00000219476	2135230	2135323	In-frame

Top

Infer the effects of exon skipping event on protein functional features for TSC2

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000219476	6173	1807	2100400	2100487	769	855	46	75
ENST00000219476	6173	1807	2103342	2103453	856	966	75	112
ENST00000219476	6173	1807	2110670	2110814	1606	1749	325	373
ENST00000219476	6173	1807	2115519	2115636	2230	2346	533	572
ENST00000219476	6173	1807	2127598	2127727	3468	3596	946	988
ENST00000219476	6173	1807	2129276	2129429	3762	3914	1044	1094
ENST00000219476	6173	1807	2132436	2132505	4445	4513	1271	1294
ENST00000219476	6173	1807	2135230	2135323	5200	5292	1523	1554

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000219476	6173	1807	2100400	2100487	769	855	46	75
ENST00000219476	6173	1807	2103342	2103453	856	966	75	112
ENST00000219476	6173	1807	2110670	2110814	1606	1749	325	373
ENST00000219476	6173	1807	2115519	2115636	2230	2346	533	572
ENST00000219476	6173	1807	2127598	2127727	3468	3596	946	988
ENST00000219476	6173	1807	2129276	2129429	3762	3914	1044	1094
ENST00000219476	6173	1807	2132436	2132505	4445	4513	1271	1294
ENST00000219476	6173	1807	2135230	2135323	5200	5292	1523	1554

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.

Start of exon skipping (AA)

End of exon skipping (AA)

Protein feature start (AA)

Protein feature end (AA)

Category of protein feature

Description of feature

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.

Start of exon skipping (AA)

End of exon skipping (AA)

Protein feature start (AA)

Protein feature end (AA)

Category of protein feature

Description of feature

Top

SNVs in the skipped exons for TSC2

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A39Y-01	exon_skip_132417	2098588	2098754	2098593	2098593	Frame_Shift_Del	T	-	p.F4fs
STAD	TCGA-HU-A4GX-01	exon_skip_132417	2098588	2098754	2098716	2098716	Frame_Shift_Del	A	-	p.G33fs
LIHC	TCGA-DD-A39Y-01	exon_skip_132424	2108748	2108874	2108788	2108788	Frame_Shift_Del	T	-	p.F298fs
SARC	TCGA-MO-A47P-01	exon_skip_132426	2110671	2110814	2110734	2110734	Frame_Shift_Del	A	-	p.K348fs
SARC	TCGA-QC-AA9N-01	exon_skip_132438	2115520	2115636	2115569	2115596	Frame_Shift_Del	TGGCCGCATACTCGGCCTCCTTGGAGGA	-	p.A551fs
SARC	TCGA-QC-AA9N-01	exon_skip_132438	2115520	2115636	2115569	2115596	Frame_Shift_Del	TGGCCGCATACTCGGCCTCCTTGGAGGA	-	p.VAAYSASLED550fs
LIHC	TCGA-DD-A39Y-01	exon_skip_132438	2115520	2115636	2115615	2115615	Frame_Shift_Del	G	-	p.L565fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_132438	2115520	2115636	2115615	2115615	Frame_Shift_Del	G	-	p.L565fs
LIHC	TCGA-DD-A3A1-01	exon_skip_132467	2134229	2134716	2134287	2134287	Frame_Shift_Del	G	-	p.R1355fs
LIHC	TCGA-DD-A39Y-01	exon_skip_132467	2134229	2134716	2134294	2134294	Frame_Shift_Del	C	-	p.I1357fs
LIHC	TCGA-DD-A3A0-01	exon_skip_132467	2134229	2134716	2134294	2134294	Frame_Shift_Del	C	-	p.I1357fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_132467	2134229	2134716	2134364	2134364	Frame_Shift_Del	C	-	p.P1381fs
LIHC	TCGA-CC-A7IJ-01	exon_skip_132479	2138049	2138140	2138085	2138088	Frame_Shift_Del	TCGT	-	p.1702_1703del
LIHC	TCGA-CC-A7IJ-01	exon_skip_132479	2138049	2138140	2138085	2138088	Frame_Shift_Del	TCGT	-	p.IV1702fs
KIRP	TCGA-KV-A74V-01	exon_skip_132472	2135231	2135323	2135239	2135240	Frame_Shift_Ins	-	T	p.S1526fs
LIHC	TCGA-DD-A114-01	exon_skip_132417	2098588	2098754	2098719	2098719	Nonsense_Mutation	C	T	p.Q35*
LIHC	TCGA-DD-A114-01	exon_skip_132417	2098588	2098754	2098719	2098719	Nonsense_Mutation	C	T	p.Q35X
LIHC	TCGA-DD-A1EE-01	exon_skip_132417	2098588	2098754	2098719	2098719	Nonsense_Mutation	C	T	p.Q35X
LIHC	TCGA-EP-A3RK-01	exon_skip_132417	2098588	2098754	2098752	2098752	Nonsense_Mutation	A	T	p.R46*
LIHC	TCGA-CC-A9FS-01	exon_skip_132424	2108748	2108874	2108810	2108810	Nonsense_Mutation	G	A	p.W304X
LIHC	TCGA-DD-A4NH-01	exon_skip_132467	2134229	2134716	2134406	2134406	Nonsense_Mutation	C	T	p.Q1395*
LIHC	TCGA-DD-A4NH-01	exon_skip_132467	2134229	2134716	2134406	2134406	Nonsense_Mutation	C	T	p.Q1395X
ESCA	TCGA-VR-A8EQ-01	exon_skip_132467	2134229	2134716	2134649	2134649	Nonsense_Mutation	G	T	p.E1476*
ESCA	TCGA-VR-A8EQ-01	exon_skip_132467	2134229	2134716	2134649	2134649	Nonsense_Mutation	G	T	p.E1476X
LUAD	TCGA-55-7907-01	exon_skip_132438	2115520	2115636	2115637	2115637	Splice_Site	G	T	p.Q572_splice

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons

Mutation description

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
SNU407_LARGE_INTESTINE	2127599	2127727	2127615	2127615	Frame_Shift_Del	C	-	p.P953fs
CW2_LARGE_INTESTINE	2108748	2108874	2108787	2108788	Frame_Shift_Ins	-	T	p.F297fs
HEC151_ENDOMETRIUM	2108748	2108874	2108787	2108788	Frame_Shift_Ins	-	T	p.F297fs
HGC27_STOMACH	2108748	2108874	2108787	2108788	Frame_Shift_Ins	-	T	p.F297fs
JHESOAD1_OESOPHAGUS	2108748	2108874	2108787	2108788	Frame_Shift_Ins	-	T	p.F297fs
NIHOVCAR3_OVARY	2108748	2108874	2108787	2108788	Frame_Shift_Ins	-	T	p.F297fs
NUGC3_STOMACH	2108748	2108874	2108787	2108788	Frame_Shift_Ins	-	T	p.F297fs
RERFLCAD2_LUNG	2108748	2108874	2108787	2108788	Frame_Shift_Ins	-	T	p.F297fs
TGBC11TKB_STOMACH	2108748	2108874	2108809	2108810	Frame_Shift_Ins	-	G	p.W304fs
HEC6_ENDOMETRIUM	2100401	2100487	2100442	2100442	Missense_Mutation	G	A	p.M60I
JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2100401	2100487	2100444	2100444	Missense_Mutation	T	C	p.I61T
SNU1040_LARGE_INTESTINE	2103343	2103453	2103346	2103346	Missense_Mutation	G	A	p.A77T
HCT15_LARGE_INTESTINE	2103343	2103453	2103373	2103373	Missense_Mutation	G	A	p.A86T
DBTRG05MG_CENTRAL_NERVOUS_SYSTEM	2103343	2103453	2103373	2103373	Missense_Mutation	G	A	p.A86T
BCP1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2103343	2103453	2103378	2103378	Missense_Mutation	T	A	p.D87E
HCT15_LARGE_INTESTINE	2108748	2108874	2108752	2108752	Missense_Mutation	T	C	p.Y285H
MET2B	2108748	2108874	2108768	2108768	Missense_Mutation	C	T	p.P290L
ZR7530_BREAST	2108748	2108874	2108785	2108785	Missense_Mutation	G	A	p.V296M
SNU407_LARGE_INTESTINE	2110671	2110814	2110689	2110689	Missense_Mutation	G	C	p.E332Q
M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2110671	2110814	2110710	2110710	Missense_Mutation	G	A	p.V339I
TE4_OESOPHAGUS	2115520	2115636	2115530	2115530	Missense_Mutation	G	C	p.R537P
M980513_SKIN	2115520	2115636	2115533	2115534	Missense_Mutation	CC	TT	p.S538F
NCC010_KIDNEY	2115520	2115636	2115596	2115596	Missense_Mutation	A	T	p.D559V
NB1_AUTONOMIC_GANGLIA	2127599	2127727	2127648	2127648	Missense_Mutation	G	A	p.V963M
SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2127599	2127727	2127648	2127648	Missense_Mutation	G	A	p.V963M
BICR18_UPPER_AERODIGESTIVE_TRACT	2127599	2127727	2127670	2127670	Missense_Mutation	C	G	p.S970C
SNU1040_LARGE_INTESTINE	2127599	2127727	2127723	2127723	Missense_Mutation	C	T	p.R988C
IGROV1_OVARY	2129277	2129429	2129309	2129309	Missense_Mutation	G	A	p.G1055D
BICR18_UPPER_AERODIGESTIVE_TRACT	2132437	2132505	2132463	2132463	Missense_Mutation	T	C	p.S1281P
VMRCLCD_LUNG	2134229	2134716	2134269	2134269	Missense_Mutation	C	T	p.A1349V
HEC1A_ENDOMETRIUM	2134229	2134716	2134281	2134281	Missense_Mutation	T	A	p.V1353D
KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2134229	2134716	2134292	2134292	Missense_Mutation	A	C	p.I1357L
PACADD137_PANCREAS	2134229	2134716	2134310	2134310	Missense_Mutation	G	A	p.V1363I
DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2134229	2134716	2134337	2134337	Missense_Mutation	G	A	p.V1372M
NALM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2134229	2134716	2134449	2134449	Missense_Mutation	G	A	p.R1409Q
TE10_OESOPHAGUS	2134229	2134716	2134449	2134449	Missense_Mutation	G	A	p.R1409Q
NCIH345_LUNG	2134229	2134716	2134454	2134454	Missense_Mutation	A	C	p.S1411R
SEKI_SKIN	2134229	2134716	2134470	2134470	Missense_Mutation	C	T	p.A1416V
ISHIKAWAHERAKLIO02ER_ENDOMETRIUM	2134229	2134716	2134526	2134526	Missense_Mutation	G	A	p.E1435K
DMS53_LUNG	2134229	2134716	2134595	2134595	Missense_Mutation	C	A	p.P1458T
CW2_LARGE_INTESTINE	2134229	2134716	2134638	2134638	Missense_Mutation	G	A	p.G1472D
SNU685_ENDOMETRIUM	2134229	2134716	2134649	2134649	Missense_Mutation	G	C	p.E1476Q
HUG1N_STOMACH	2134229	2134716	2134654	2134654	Missense_Mutation	G	C	p.R1477S
OVCAR4_OVARY	2134229	2134716	2134713	2134713	Missense_Mutation	C	A	p.P1497H
DND41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2135231	2135323	2135235	2135235	Missense_Mutation	A	G	p.Q1525R
HEC108_ENDOMETRIUM	2135231	2135323	2135247	2135247	Missense_Mutation	G	A	p.R1529Q
KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2135231	2135323	2135250	2135250	Missense_Mutation	C	T	p.S1530L
HRT18_LARGE_INTESTINE	2138049	2138140	2138060	2138060	Missense_Mutation	C	A	p.L1694I
NCIH1373_LUNG	2138049	2138140	2138087	2138087	Missense_Mutation	G	T	p.V1703L
MOLT3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2138049	2138140	2138100	2138100	Missense_Mutation	A	G	p.N1707S
MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	2138049	2138140	2138100	2138100	Missense_Mutation	A	G	p.N1707S
SKUT1_SOFT_TISSUE	2103343	2103453	2103385	2103385	Nonsense_Mutation	C	T	p.Q90*
NCIH1651_LUNG	2100401	2100487	2100401	2100401	Splice_Site	G	T	p.E47*

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for TSC2

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for TSC2

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for TSC2

Top

RelatedDrugs for TSC2

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for TSC2

Diseases associated with this gene.
(DisGeNet 4.0)

Gene	Disease ID	Disease name	# pubmeds	Source
TSC2	C1860707	TUBEROUS SCLEROSIS 2 (disorder)	13	CTD_human;UNIPROT
TSC2	C0041341	Tuberous Sclerosis	4	CTD_human;ORPHANET
TSC2	C0022665	Kidney Neoplasm	3	CTD_human
TSC2	C0004352	Autistic Disorder	1	CTD_human;HPO
TSC2	C0006111	Brain Diseases	1	CTD_human
TSC2	C0007137	Squamous cell carcinoma	1	CTD_human
TSC2	C0014544	Epilepsy	1	CTD_human;HPO
TSC2	C0023267	Fibroid Tumor	1	CTD_human
TSC2	C0023467	Leukemia, Myelocytic, Acute	1	CTD_human
TSC2	C0026640	Mouth Neoplasms	1	CTD_human
TSC2	C0027746	Nerve Degeneration	1	CTD_human
TSC2	C0030297	Pancreatic Neoplasm	1	CTD_human
TSC2	C0036572	Seizures	1	CTD_human;HPO
TSC2	C0037769	West Syndrome	1	CTD_human

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact