|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for THOP1 |
 Gene summary |
| Gene information | Gene symbol | THOP1 | Gene ID | 7064 |
| Gene name | thimet oligopeptidase 1 | |
| Synonyms | EP24.15|MEPD_HUMAN|MP78|TOP | |
| Cytomap | 19p13.3 | |
| Type of gene | protein-coding | |
| Description | thimet oligopeptidaseendopeptidase 24.15 | |
| Modification date | 20180523 | |
| UniProtAcc | P52888 | |
| Context | PubMed: THOP1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for THOP1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for THOP1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for THOP1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_300838 | 19 | 2785545:2785676:2786946:2787032:2790418:2790552 | 2786946:2787032 | ENSG00000172009.10 | ENST00000585338.1 |
| exon_skip_300840 | 19 | 2785564:2785676:2790418:2790631:2794761:2794910 | 2790418:2790631 | ENSG00000172009.10 | ENST00000585673.1 |
| exon_skip_300841 | 19 | 2790418:2790631:2794761:2794910:2796078:2796186 | 2794761:2794910 | ENSG00000172009.10 | ENST00000585338.1,ENST00000585673.1,ENST00000307741.6 |
| exon_skip_300842 | 19 | 2794761:2794910:2796078:2796186:2799686:2799760 | 2796078:2796186 | ENSG00000172009.10 | ENST00000585338.1,ENST00000585673.1,ENST00000307741.6 |
| exon_skip_300852 | 19 | 2808355:2808442:2810301:2810488:2810637:2810660 | 2810301:2810488 | ENSG00000172009.10 | ENST00000589087.1,ENST00000590970.1,ENST00000591363.1,ENST00000307741.6,ENST00000587401.1,ENST00000586677.1 |
| exon_skip_300853 | 19 | 2811631:2811732:2812196:2812370:2813112:2813179 | 2812196:2812370 | ENSG00000172009.10 | ENST00000395212.4 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for THOP1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_300840 | 19 | 2785564:2785676:2790418:2790631:2794761:2794910 | 2790418:2790631 | ENSG00000172009.10 | ENST00000585673.1 |
| exon_skip_300841 | 19 | 2790418:2790631:2794761:2794910:2796078:2796186 | 2794761:2794910 | ENSG00000172009.10 | ENST00000307741.6,ENST00000585673.1,ENST00000585338.1 |
| exon_skip_300842 | 19 | 2794761:2794910:2796078:2796186:2799686:2799760 | 2796078:2796186 | ENSG00000172009.10 | ENST00000307741.6,ENST00000585673.1,ENST00000585338.1 |
| exon_skip_300852 | 19 | 2808355:2808442:2810301:2810488:2810637:2810660 | 2810301:2810488 | ENSG00000172009.10 | ENST00000307741.6,ENST00000586677.1,ENST00000589087.1,ENST00000591363.1,ENST00000590970.1,ENST00000587401.1 |
| exon_skip_300853 | 19 | 2811631:2811732:2812196:2812370:2813112:2813179 | 2812196:2812370 | ENSG00000172009.10 | ENST00000395212.4 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for THOP1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000307741 | 2794761 | 2794910 | Frame-shift |
| ENST00000307741 | 2810301 | 2810488 | Frame-shift |
| ENST00000307741 | 2796078 | 2796186 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000307741 | 2794761 | 2794910 | Frame-shift |
| ENST00000307741 | 2810301 | 2810488 | Frame-shift |
| ENST00000307741 | 2796078 | 2796186 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for THOP1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000307741 | 2615 | 689 | 2796078 | 2796186 | 582 | 689 | 126 | 162 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000307741 | 2615 | 689 | 2796078 | 2796186 | 582 | 689 | 126 | 162 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P52888 | 126 | 162 | 1 | 489 | Alternative sequence | ID=VSP_056494;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| P52888 | 126 | 162 | 1 | 689 | Chain | ID=PRO_0000078153;Note=Thimet oligopeptidase |
| P52888 | 126 | 162 | 116 | 128 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
| P52888 | 126 | 162 | 136 | 151 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
| P52888 | 126 | 162 | 158 | 184 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
| P52888 | 126 | 162 | 152 | 155 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| P52888 | 126 | 162 | 1 | 489 | Alternative sequence | ID=VSP_056494;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| P52888 | 126 | 162 | 1 | 689 | Chain | ID=PRO_0000078153;Note=Thimet oligopeptidase |
| P52888 | 126 | 162 | 116 | 128 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
| P52888 | 126 | 162 | 136 | 151 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
| P52888 | 126 | 162 | 158 | 184 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
| P52888 | 126 | 162 | 152 | 155 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:2O36 |
Top |
SNVs in the skipped exons for THOP1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
THOP1_LIHC_exon_skip_300852_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_300841 | 2794762 | 2794910 | 2794880 | 2794880 | Frame_Shift_Del | G | - | p.E116fs |
| LIHC | TCGA-DD-AAE2-01 | exon_skip_300852 | 2810302 | 2810488 | 2810300 | 2810337 | Frame_Shift_Del | CCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG | - | p.486_486del |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_300852 | 2810302 | 2810488 | 2810339 | 2810339 | Frame_Shift_Del | G | - | p.R498fs |
| CESC | TCGA-DS-A1OB-01 | exon_skip_300840 | 2790419 | 2790631 | 2790517 | 2790517 | Nonsense_Mutation | G | T | p.E39* |
| LIHC | TCGA-CC-A7IH-01 | exon_skip_300852 | 2810302 | 2810488 | 2810300 | 2810300 | Splice_Site | A | T | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-CC-A7IH-01 |
| Cancer type: LIHC | |
| ESID: exon_skip_300852 | |
| Skipped exon start: 2810302 | |
| Skipped exon end: 2810488 | |
| Mutation start: 2810300 | |
| Mutation end: 2810300 | |
| Mutation type: Splice_Site | |
| Reference seq: A | |
| Mutation seq: T | |
| AAchange: . | |
exon_skip_124967_LIHC_TCGA-CC-A7IH-01.png | |
exon_skip_300852_LIHC_TCGA-CC-A7IH-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| SUPHD1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 2790419 | 2790631 | 2790523 | 2790523 | Missense_Mutation | A | G | p.I41V |
| MOLT16_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 2790419 | 2790631 | 2790539 | 2790539 | Missense_Mutation | G | A | p.R46H |
| SKMM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 2790419 | 2790631 | 2790539 | 2790539 | Missense_Mutation | G | A | p.R46H |
| PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 2790419 | 2790631 | 2790593 | 2790593 | Missense_Mutation | C | T | p.T64M |
| NB12_AUTONOMIC_GANGLIA | 2794762 | 2794910 | 2794836 | 2794836 | Missense_Mutation | G | A | p.D102N |
| OSC20_UPPER_AERODIGESTIVE_TRACT | 2794762 | 2794910 | 2794863 | 2794863 | Missense_Mutation | G | C | p.E111Q |
| NCIH2009_LUNG | 2794762 | 2794910 | 2794868 | 2794868 | Missense_Mutation | G | A | p.M112I |
| RCHACV_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 2794762 | 2794910 | 2794884 | 2794884 | Missense_Mutation | G | A | p.V118M |
| SW1271_LUNG | 2796079 | 2796186 | 2796089 | 2796089 | Missense_Mutation | A | G | p.Q130R |
| HUNS1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 2796079 | 2796186 | 2796127 | 2796127 | Missense_Mutation | G | A | p.E143K |
| SNU407_LARGE_INTESTINE | 2810302 | 2810488 | 2810405 | 2810405 | Missense_Mutation | G | A | p.R520Q |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for THOP1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for THOP1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for THOP1 |
Top |
RelatedDrugs for THOP1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for THOP1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|