|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for RARB |
 Gene summary |
| Gene information | Gene symbol | RARB | Gene ID | 5915 |
| Gene name | retinoic acid receptor beta | |
| Synonyms | HAP|MCOPS12|NR1B2|RARbeta1|RRB2 | |
| Cytomap | 3p24.2 | |
| Type of gene | protein-coding | |
| Description | retinoic acid receptor betaHBV-activated proteinRAR-betaRAR-epsilonhepatitis B virus activated proteinnuclear receptor subfamily 1 group B member 2retinoic acid receptor, beta polypeptide | |
| Modification date | 20180523 | |
| UniProtAcc | P10826 | |
| Context | PubMed: RARB [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for RARB from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for RARB |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for RARB |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_372200 | 3 | 25542672:25542814:25611248:25611409:25622036:25622213 | 25611248:25611409 | ENSG00000077092.14 | ENST00000462272.1,ENST00000458646.1,ENST00000437042.2,ENST00000330688.4,ENST00000404969.1,ENST00000480001.1,ENST00000383772.4 |
| exon_skip_372201 | 3 | 25622036:25622213:25634993:25635198:25636010:25636169 | 25634993:25635198 | ENSG00000077092.14 | ENST00000479097.1,ENST00000458646.1,ENST00000437042.2,ENST00000330688.4,ENST00000404969.1,ENST00000383772.4 |
| exon_skip_372202 | 3 | 25622036:25622213:25635131:25635198:25636010:25636169 | 25635131:25635198 | ENSG00000077092.14 | ENST00000462272.1 |
| exon_skip_372203 | 3 | 25622036:25622213:25636010:25636169:25637910:25637946 | 25636010:25636169 | ENSG00000077092.14 | ENST00000480001.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for RARB |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_372200 | 3 | 25542672:25542814:25611248:25611409:25622036:25622213 | 25611248:25611409 | ENSG00000077092.14 | ENST00000383772.4,ENST00000404969.1,ENST00000437042.2,ENST00000330688.4,ENST00000480001.1,ENST00000462272.1,ENST00000458646.1 |
| exon_skip_372201 | 3 | 25622036:25622213:25634993:25635198:25636010:25636169 | 25634993:25635198 | ENSG00000077092.14 | ENST00000383772.4,ENST00000404969.1,ENST00000437042.2,ENST00000330688.4,ENST00000479097.1,ENST00000458646.1 |
| exon_skip_372202 | 3 | 25622036:25622213:25635131:25635198:25636010:25636169 | 25635131:25635198 | ENSG00000077092.14 | ENST00000462272.1 |
| exon_skip_372203 | 3 | 25622036:25622213:25636010:25636169:25637910:25637946 | 25636010:25636169 | ENSG00000077092.14 | ENST00000480001.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for RARB |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
Top |
Infer the effects of exon skipping event on protein functional features for RARB |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for RARB |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| STAD | TCGA-D7-A6EZ-01 | exon_skip_372203 | 25636011 | 25636169 | 25636066 | 25636115 | Frame_Shift_Del | GGAAGCACTAAAAATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACA | - | p.349_365del |
| CESC | TCGA-IR-A3LK-01 | exon_skip_372203 | 25636011 | 25636169 | 25636104 | 25636104 | Frame_Shift_Del | G | - | p.S369fs |
| KIRC | TCGA-A3-3374-01 | exon_skip_372200 | 25611249 | 25611409 | 25611305 | 25611305 | Nonsense_Mutation | G | T | p.E169* |
| THYM | TCGA-XU-A92V-01 | exon_skip_372200 | 25611249 | 25611409 | 25611353 | 25611353 | Nonsense_Mutation | C | T | p.R185* |
| SARC | TCGA-X9-A973-01 | exon_skip_372201 | 25634994 | 25635198 | 25635144 | 25635144 | Nonsense_Mutation | G | T | p.E313* |
| SARC | TCGA-X9-A973-01 | exon_skip_372202 | 25635132 | 25635198 | 25635144 | 25635144 | Nonsense_Mutation | G | T | p.E313* |
| SKCM | TCGA-FR-A44A-06 | exon_skip_372203 | 25636011 | 25636169 | 25636062 | 25636062 | Nonsense_Mutation | T | A | p.L348* |
| SKCM | TCGA-FR-A44A-06 | exon_skip_372203 | 25636011 | 25636169 | 25636062 | 25636062 | Nonsense_Mutation | T | A | p.L348X |
| COAD | TCGA-AA-A00J-01 | exon_skip_372203 | 25636011 | 25636169 | 25636097 | 25636097 | Nonsense_Mutation | C | T | p.R360X |
| COAD | TCGA-G4-6588-01 | exon_skip_372203 | 25636011 | 25636169 | 25636097 | 25636097 | Nonsense_Mutation | C | T | p.R360X |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LNCAPCLONEFGC_PROSTATE | 25611249 | 25611409 | 25611342 | 25611342 | Missense_Mutation | C | T | p.T188I |
| KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 25611249 | 25611409 | 25611407 | 25611407 | Missense_Mutation | A | G | p.T210A |
| NCIH1944_LUNG | 25634994 | 25635198 | 25635019 | 25635020 | Missense_Mutation | CC | AA | p.T278K |
| NCIH1944_LUNG | 25634994 | 25635198 | 25635019 | 25635019 | Missense_Mutation | C | A | p.T278N |
| JSC1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 25634994 | 25635198 | 25635046 | 25635046 | Missense_Mutation | C | T | p.S287L |
| SISO_CERVIX | 25634994 | 25635198 | 25635064 | 25635064 | Missense_Mutation | A | G | p.N293S |
| GRST_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 25634994 | 25635198 | 25635064 | 25635064 | Missense_Mutation | A | G | p.N293S |
| HCT116_LARGE_INTESTINE | 25634994 | 25635198 | 25635078 | 25635078 | Missense_Mutation | C | T | p.H298Y |
| GP5D_LARGE_INTESTINE | 25634994 | 25635198 | 25635094 | 25635094 | Missense_Mutation | G | A | p.G303D |
| SNU1040_LARGE_INTESTINE | 25635132 | 25635198 | 25635132 | 25635132 | Missense_Mutation | C | T | p.L316F |
| SNU1040_LARGE_INTESTINE | 25634994 | 25635198 | 25635132 | 25635132 | Missense_Mutation | C | T | p.L316F |
| COLO699_LUNG | 25635132 | 25635198 | 25635157 | 25635157 | Missense_Mutation | C | G | p.T324R |
| COLO699_LUNG | 25634994 | 25635198 | 25635157 | 25635157 | Missense_Mutation | C | G | p.T324R |
| CHL1_SKIN | 25635132 | 25635198 | 25635157 | 25635157 | Missense_Mutation | C | G | p.T324R |
| CHL1_SKIN | 25634994 | 25635198 | 25635157 | 25635157 | Missense_Mutation | C | G | p.T324R |
| SNU1040_LARGE_INTESTINE | 25635132 | 25635198 | 25635172 | 25635172 | Missense_Mutation | T | G | p.L329R |
| SNU1040_LARGE_INTESTINE | 25634994 | 25635198 | 25635172 | 25635172 | Missense_Mutation | T | G | p.L329R |
| COLO699_LUNG | 25636011 | 25636169 | 25636031 | 25636031 | Missense_Mutation | C | G | p.P345A |
| CHL1_SKIN | 25636011 | 25636169 | 25636031 | 25636031 | Missense_Mutation | C | G | p.P345A |
| KMRC2_KIDNEY | 25636011 | 25636169 | 25636116 | 25636116 | Missense_Mutation | T | C | p.M373T |
| ISHIKAWAHERAKLIO02ER_ENDOMETRIUM | 25636011 | 25636169 | 25636125 | 25636125 | Missense_Mutation | A | C | p.K376T |
| DMS79_LUNG | 25636011 | 25636169 | 25636134 | 25636134 | Missense_Mutation | T | C | p.M379T |
| COLO699_LUNG | 25636011 | 25636169 | 25636164 | 25636164 | Missense_Mutation | C | G | p.A389G |
| CHL1_SKIN | 25636011 | 25636169 | 25636164 | 25636164 | Missense_Mutation | C | G | p.A389G |
| SNU1040_LARGE_INTESTINE | 25611249 | 25611409 | 25611353 | 25611353 | Nonsense_Mutation | C | T | p.R192* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for RARB |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RARB |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RARB |
Top |
RelatedDrugs for RARB |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
| P10826 | DB00210 | Adapalene | Retinoic acid receptor beta | small molecule | approved | |
| P10826 | DB00459 | Acitretin | Retinoic acid receptor beta | small molecule | approved | |
| P10826 | DB00523 | Alitretinoin | Retinoic acid receptor beta | small molecule | approved|investigational | |
| P10826 | DB00799 | Tazarotene | Retinoic acid receptor beta | small molecule | approved|investigational | |
| P10826 | DB00755 | Tretinoin | Retinoic acid receptor beta | small molecule | approved|investigational|nutraceutical |
Top |
RelatedDiseases for RARB |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| RARB | C0001418 | Adenocarcinoma | 1 | CTD_human |
| RARB | C0007137 | Squamous cell carcinoma | 1 | CTD_human |
| RARB | C0007873 | Uterine Cervical Neoplasm | 1 | CTD_human |
| RARB | C0014175 | Endometriosis | 1 | CTD_human |
| RARB | C0018671 | Head and Neck Neoplasms | 1 | CTD_human |
| RARB | C0024121 | Lung Neoplasms | 1 | CTD_human |
| RARB | C0038356 | Stomach Neoplasms | 1 | CTD_human |
| RARB | C0149940 | Sciatic Neuropathy | 1 | CTD_human |
| RARB | C1458155 | Mammary Neoplasms | 1 | CTD_human |
| RARB | C3809803 | MICROPHTHALMIA, SYNDROMIC 12 | 1 | UNIPROT |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|