|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for RAB3A |
 Gene summary |
| Gene information | Gene symbol | RAB3A | Gene ID | 5864 |
| Gene name | RAB3A, member RAS oncogene family | |
| Synonyms | - | |
| Cytomap | 19p13.11 | |
| Type of gene | protein-coding | |
| Description | ras-related protein Rab-3ARAS-associated protein RAB3A | |
| Modification date | 20180523 | |
| UniProtAcc | P20336 | |
| Context | PubMed: RAB3A [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for RAB3A from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for RAB3A |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for RAB3A |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_316381 | 19 | 18307608:18308470:18309534:18309659:18311136:18311255 | 18309534:18309659 | ENSG00000105649.5 | ENST00000464076.3,ENST00000222256.4 |
| exon_skip_316383 | 19 | 18309534:18309659:18311136:18311255:18313322:18313550 | 18311136:18311255 | ENSG00000105649.5 | ENST00000222256.4 |
| exon_skip_316387 | 19 | 18311136:18311255:18313322:18313665:18314705:18314822 | 18313322:18313665 | ENSG00000105649.5 | ENST00000481914.2 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for RAB3A |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_316381 | 19 | 18307608:18308470:18309534:18309659:18311136:18311255 | 18309534:18309659 | ENSG00000105649.5 | ENST00000222256.4,ENST00000464076.3 |
| exon_skip_316383 | 19 | 18309534:18309659:18311136:18311255:18313322:18313550 | 18311136:18311255 | ENSG00000105649.5 | ENST00000222256.4 |
| exon_skip_316387 | 19 | 18311136:18311255:18313322:18313665:18314705:18314822 | 18313322:18313665 | ENSG00000105649.5 | ENST00000481914.2 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for RAB3A |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000222256 | 18309534 | 18309659 | Frame-shift |
| ENST00000222256 | 18311136 | 18311255 | Frame-shift |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000222256 | 18309534 | 18309659 | Frame-shift |
| ENST00000222256 | 18311136 | 18311255 | Frame-shift |
Top |
Infer the effects of exon skipping event on protein functional features for RAB3A |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for RAB3A |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| PAAD | TCGA-HV-AA8X-01 | exon_skip_316383 | 18311137 | 18311255 | 18311123 | 18311151 | Frame_Shift_Del | TGGGGTACACTCACCAGTCCTGCACTGCA | - | p.112_116del |
| KIRC | TCGA-CW-5589-01 | exon_skip_316381 | 18309535 | 18309659 | 18309636 | 18309636 | Nonsense_Mutation | G | C | p.S124X |
| BRCA | TCGA-C8-A1HM-01 | exon_skip_316381 | 18309535 | 18309659 | 18309660 | 18309660 | Splice_Site | C | G | e3-1 |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| KYSE410_OESOPHAGUS | 18309535 | 18309659 | 18309538 | 18309539 | Missense_Mutation | GG | AA | p.L157F |
| HS936T_SKIN | 18311137 | 18311255 | 18311186 | 18311186 | Missense_Mutation | G | A | p.L100F |
| NCIH345_LUNG | 18311137 | 18311255 | 18311207 | 18311207 | Missense_Mutation | G | A | p.R93W |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for RAB3A |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RAB3A |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for RAB3A |
Top |
RelatedDrugs for RAB3A |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for RAB3A |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| RAB3A | C0014474 | Ependymoma | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|