ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for PTPN4

Gene summary

Gene information	Gene symbol	PTPN4
	Gene ID	5775
	Gene name	protein tyrosine phosphatase, non-receptor type 4
	Synonyms	MEG\|PTPMEG\|PTPMEG1
	Cytomap	2q14.2
	Type of gene	protein-coding
	Description	tyrosine-protein phosphatase non-receptor type 4PTPase-MEG1megakaryocyte phosphatasemegakaryocyte protein-tyrosine phosphataseprotein tyrosine phosphatase MEG1protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
	Modification date	20180519
	UniProtAcc	P29074
	Context	PubMed: PTPN4 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for PTPN4 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for PTPN4

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for PTPN4

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_329285	2	120517850:120517960:120529052:120529196:120567412:120567460	120529052:120529196	ENSG00000088179.4	ENST00000460162.1
exon_skip_329286	2	120517850:120517960:120548730:120548848:120567412:120567460	120548730:120548848	ENSG00000088179.4	ENST00000420482.1
exon_skip_329287	2	120517850:120517960:120567412:120567567:120620111:120620198	120567412:120567567	ENSG00000088179.4	ENST00000460289.1,ENST00000488279.2,ENST00000485247.1
exon_skip_329290	2	120620111:120620219:120634898:120634941:120635039:120635118	120634898:120634941	ENSG00000088179.4	ENST00000460289.1,ENST00000263708.2,ENST00000485247.1
exon_skip_329295	2	120635039:120635118:120639361:120639406:120639672:120639722	120639361:120639406	ENSG00000088179.4	ENST00000263708.2,ENST00000488279.2,ENST00000433888.1
exon_skip_329296	2	120640078:120640199:120643370:120643458:120658293:120658382	120643370:120643458	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1
exon_skip_329302	2	120640078:120640199:120658293:120658382:120672754:120672818	120658293:120658382	ENSG00000088179.4	ENST00000433888.1
exon_skip_329309	2	120643370:120643458:120658293:120658382:120672754:120672818	120658293:120658382	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1
exon_skip_329326	2	120672754:120672818:120677644:120677817:120684173:120684242	120677644:120677817	ENSG00000088179.4	ENST00000263708.2
exon_skip_329327	2	120672754:120672818:120677644:120677817:120689999:120690125	120677644:120677817	ENSG00000088179.4	ENST00000433888.1
exon_skip_329329	2	120677644:120677817:120684173:120684242:120689999:120690125	120684173:120684242	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1
exon_skip_329332	2	120690051:120690125:120692375:120692534:120702656:120702816	120692375:120692534	ENSG00000088179.4	ENST00000431283.1,ENST00000263708.2,ENST00000544261.1,ENST00000430976.1
exon_skip_329334	2	120702656:120702816:120703916:120704000:120704093:120704150	120703916:120704000	ENSG00000088179.4	ENST00000431283.1,ENST00000263708.2,ENST00000544261.1,ENST00000430976.1
exon_skip_329336	2	120709548:120709705:120712732:120712899:120714419:120714510	120712732:120712899	ENSG00000088179.4	ENST00000263708.2,ENST00000544261.1,ENST00000430976.1

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for PTPN4

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_329285	2	120517850:120517960:120529052:120529196:120567412:120567460	120529052:120529196	ENSG00000088179.4	ENST00000460162.1
exon_skip_329286	2	120517850:120517960:120548730:120548848:120567412:120567460	120548730:120548848	ENSG00000088179.4	ENST00000420482.1
exon_skip_329287	2	120517850:120517960:120567412:120567567:120620111:120620198	120567412:120567567	ENSG00000088179.4	ENST00000460289.1,ENST00000488279.2,ENST00000485247.1
exon_skip_329290	2	120620111:120620219:120634898:120634941:120635039:120635118	120634898:120634941	ENSG00000088179.4	ENST00000263708.2,ENST00000460289.1,ENST00000485247.1
exon_skip_329295	2	120635039:120635118:120639361:120639406:120639672:120639722	120639361:120639406	ENSG00000088179.4	ENST00000263708.2,ENST00000488279.2,ENST00000433888.1
exon_skip_329296	2	120640078:120640199:120643370:120643458:120658293:120658382	120643370:120643458	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1
exon_skip_329302	2	120640078:120640199:120658293:120658382:120672754:120672818	120658293:120658382	ENSG00000088179.4	ENST00000433888.1
exon_skip_329309	2	120643370:120643458:120658293:120658382:120672754:120672818	120658293:120658382	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1
exon_skip_329326	2	120672754:120672818:120677644:120677817:120684173:120684242	120677644:120677817	ENSG00000088179.4	ENST00000263708.2
exon_skip_329327	2	120672754:120672818:120677644:120677817:120689999:120690125	120677644:120677817	ENSG00000088179.4	ENST00000433888.1
exon_skip_329329	2	120677644:120677817:120684173:120684242:120689999:120690125	120684173:120684242	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1
exon_skip_329332	2	120690051:120690125:120692375:120692534:120702656:120702816	120692375:120692534	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1,ENST00000544261.1,ENST00000431283.1
exon_skip_329334	2	120702656:120702816:120703916:120704000:120704093:120704150	120703916:120704000	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1,ENST00000544261.1,ENST00000431283.1
exon_skip_329336	2	120709548:120709705:120712732:120712899:120714419:120714510	120712732:120712899	ENSG00000088179.4	ENST00000263708.2,ENST00000430976.1,ENST00000544261.1

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for PTPN4

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000263708	120634898	120634941	Frame-shift
ENST00000263708	120643370	120643458	Frame-shift
ENST00000263708	120658293	120658382	Frame-shift
ENST00000263708	120677644	120677817	Frame-shift
ENST00000263708	120712732	120712899	Frame-shift
ENST00000263708	120639361	120639406	In-frame
ENST00000263708	120684173	120684242	In-frame
ENST00000263708	120692375	120692534	In-frame
ENST00000263708	120703916	120704000	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000263708	120634898	120634941	Frame-shift
ENST00000263708	120643370	120643458	Frame-shift
ENST00000263708	120658293	120658382	Frame-shift
ENST00000263708	120677644	120677817	Frame-shift
ENST00000263708	120712732	120712899	Frame-shift
ENST00000263708	120639361	120639406	In-frame
ENST00000263708	120684173	120684242	In-frame
ENST00000263708	120692375	120692534	In-frame
ENST00000263708	120703916	120704000	In-frame

Top

Infer the effects of exon skipping event on protein functional features for PTPN4

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000263708	10317	926	120639361	120639406	1140	1184	123	137
ENST00000263708	10317	926	120684173	120684242	1773	1841	334	356
ENST00000263708	10317	926	120692375	120692534	1968	2126	399	451
ENST00000263708	10317	926	120703916	120704000	2287	2370	505	533

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000263708	10317	926	120639361	120639406	1140	1184	123	137
ENST00000263708	10317	926	120684173	120684242	1773	1841	334	356
ENST00000263708	10317	926	120692375	120692534	1968	2126	399	451
ENST00000263708	10317	926	120703916	120704000	2287	2370	505	533

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P29074	123	137	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	123	137	29	312	Domain	Note=FERM;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00084
P29074	123	137	131	131	Sequence conflict	Note=K->E;Ontology_term=ECO:0000305;evidence=ECO:0000305
P29074	334	356	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	399	451	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	505	533	516	520	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3NFK
P29074	505	533	524	526	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2CS5
P29074	505	533	530	535	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3NFK
P29074	505	533	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	505	533	517	589	Domain	Note=PDZ;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00143

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P29074	123	137	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	123	137	29	312	Domain	Note=FERM;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00084
P29074	123	137	131	131	Sequence conflict	Note=K->E;Ontology_term=ECO:0000305;evidence=ECO:0000305
P29074	334	356	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	399	451	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	505	533	516	520	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3NFK
P29074	505	533	524	526	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2CS5
P29074	505	533	530	535	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3NFK
P29074	505	533	1	926	Chain	ID=PRO_0000219434;Note=Tyrosine-protein phosphatase non-receptor type 4
P29074	505	533	517	589	Domain	Note=PDZ;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00143

Top

SNVs in the skipped exons for PTPN4

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A1EG-01	exon_skip_329295	120639362	120639406	120639371	120639371	Frame_Shift_Del	T	-	p.Y126fs
LIHC	TCGA-DD-A39Y-01	exon_skip_329295	120639362	120639406	120639371	120639371	Frame_Shift_Del	T	-	p.Y126fs
UCEC	TCGA-B5-A11F-01	exon_skip_329296	120643371	120643458	120643369	120643438	Frame_Shift_Del	TTGATTGATTGATCTCATTTTTAACTTAATGATGTCTTTATAGAGGCTTATCTCCTGCAGAAGCAGAATT	-	p.I197fs
LIHC	TCGA-DD-A3A0-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677711	120677711	Frame_Shift_Del	A	-	p.K299fs
STAD	TCGA-BR-8078-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677766	120677766	Frame_Shift_Del	A	-	p.Q317fs
LIHC	TCGA-DD-A39Y-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677773	120677773	Frame_Shift_Del	T	-	p.N319fs
STAD	TCGA-BR-4184-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677773	120677773	Frame_Shift_Del	T	-	p.N319fs
STAD	TCGA-BR-4361-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677773	120677773	Frame_Shift_Del	T	-	p.N319fs
STAD	TCGA-BR-4368-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677773	120677773	Frame_Shift_Del	T	-	p.N319fs
STAD	TCGA-D7-A6EY-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677773	120677773	Frame_Shift_Del	T	-	p.N319fs
READ	TCGA-EI-7002-01	exon_skip_329296	120643371	120643458	120643426	120643426	Nonsense_Mutation	G	T	p.E215X
LUSC	TCGA-18-3409-01	exon_skip_329329	120684174	120684242	120684190	120684190	Nonsense_Mutation	C	T	p.Q340*
PAAD	TCGA-IB-7651-01	exon_skip_329332	120692376	120692534	120692377	120692377	Nonsense_Mutation	C	T	p.R400X
LIHC	TCGA-ED-A97K-01	exon_skip_329336	120712733	120712899	120712792	120712792	Nonsense_Mutation	G	T	p.E625X
UCEC	TCGA-AP-A051-01	exon_skip_329326 exon_skip_329327	120677645	120677817	120677644	120677644	Splice_Site	G	T	e11-1

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons

Mutation description

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
SNUC2A_LARGE_INTESTINE	120677645	120677817	120677773	120677773	Frame_Shift_Del	T	-	p.N319fs
SNUC2B_LARGE_INTESTINE	120677645	120677817	120677773	120677773	Frame_Shift_Del	T	-	p.N319fs
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	120567413	120567567	120567436	120567436	Missense_Mutation	T	G	p.S3A
LOVO_LARGE_INTESTINE	120567413	120567567	120567476	120567476	Missense_Mutation	G	A	p.R16Q
NCIH1734_LUNG	120643371	120643458	120643433	120643433	Missense_Mutation	A	G	p.Y217C
A2058_SKIN	120658294	120658382	120658307	120658307	Missense_Mutation	A	G	p.N230S
CHAGOK1_LUNG	120677645	120677817	120677652	120677652	Missense_Mutation	C	G	p.S279C
NCIH187_LUNG	120677645	120677817	120677742	120677742	Missense_Mutation	G	A	p.R309H
NCIH1651_LUNG	120677645	120677817	120677783	120677783	Missense_Mutation	C	T	p.H323Y
BC3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	120684174	120684242	120684194	120684194	Missense_Mutation	C	T	p.S341L
HCT15_LARGE_INTESTINE	120684174	120684242	120684216	120684216	Missense_Mutation	G	T	p.K348N
M00921_SKIN	120692376	120692534	120692378	120692378	Missense_Mutation	G	A	p.R400Q
HCC1395_MATCHED_NORMAL_TISSUE	120703917	120704000	120703940	120703940	Missense_Mutation	T	G	p.D513E
SKMEL31_SKIN	120703917	120704000	120703942	120703942	Missense_Mutation	A	C	p.N514T
NK92MI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	120703917	120704000	120703976	120703976	Missense_Mutation	T	A	p.N525K
SNU1040_LARGE_INTESTINE	120712733	120712899	120712837	120712837	Missense_Mutation	C	T	p.R640W
BICR18_UPPER_AERODIGESTIVE_TRACT	120712733	120712899	120712888	120712888	Missense_Mutation	A	G	p.T657A
SNU475_LIVER	120567413	120567567	120567499	120567499	Nonsense_Mutation	A	T	p.R24*
NB1643_AUTONOMIC_GANGLIA	120567413	120567567	120567430	120567430	Start_Codon_SNP	A	G	p.M1V

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for PTPN4

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PTPN4

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for PTPN4

Top

RelatedDrugs for PTPN4

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene	UniProtAcc	DrugBank ID	Drug name	Drug activity	Drug type	Drug status
	P29074	DB00630	Alendronic acid	Tyrosine-protein phosphatase non-receptor type 4	small molecule	approved

Top

RelatedDiseases for PTPN4

Diseases associated with this gene.
(DisGeNet 4.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact