ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for HSPG2

Gene summary

Gene information	Gene symbol	HSPG2
	Gene ID	3339
	Gene name	heparan sulfate proteoglycan 2
	Synonyms	HSPG\|PLC\|PRCAN\|SJA\|SJS\|SJS1
	Cytomap	1p36.12
	Type of gene	protein-coding
	Description	basement membrane-specific heparan sulfate proteoglycan core proteinendorepellin (domain V region)perlecan proteoglycan
	Modification date	20180522
	UniProtAcc	P98160
	Context	PubMed: HSPG2 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for HSPG2 from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for HSPG2

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for HSPG2

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_22964	1	22150108:22150212:22150613:22150697:22150798:22150866	22150613:22150697	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22966	1	22151196:22151272:22154355:22154412:22154522:22154645	22154355:22154412	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22967	1	22154355:22154412:22154522:22154645:22154747:22154919	22154522:22154645	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22970	1	22154522:22154645:22154747:22154919:22155327:22155572	22154747:22154919	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22972	1	22155327:22155572:22155875:22156097:22156485:22156584	22155875:22156097	ENSG00000142798.12	ENST00000374695.3
exon_skip_22975	1	22155875:22156097:22156485:22156584:22157474:22157583	22156485:22156584	ENSG00000142798.12	ENST00000374695.3
exon_skip_22977	1	22156485:22156584:22157474:22157583:22157707:22157817	22157474:22157583	ENSG00000142798.12	ENST00000374695.3
exon_skip_22978	1	22158144:22158289:22158987:22159099:22159760:22159815	22158987:22159099	ENSG00000142798.12	ENST00000374695.3
exon_skip_22980	1	22161171:22161438:22162032:22162130:22163294:22163410	22162032:22162130	ENSG00000142798.12	ENST00000374695.3
exon_skip_22984	1	22162084:22162130:22163294:22163499:22165317:22165499	22163294:22163499	ENSG00000142798.12	ENST00000374695.3
exon_skip_22986	1	22167593:22167778:22168031:22168166:22168494:22168635	22168031:22168166	ENSG00000142798.12	ENST00000374695.3
exon_skip_22991	1	22169789:22169931:22170640:22170792:22172600:22172748	22170640:22170792	ENSG00000142798.12	ENST00000374695.3
exon_skip_22994	1	22175385:22175524:22176533:22176685:22176855:22176991	22176533:22176685	ENSG00000142798.12	ENST00000430507.1,ENST00000374695.3
exon_skip_23009	1	22178038:22178190:22178283:22178419:22178580:22178625	22178283:22178419	ENSG00000142798.12	ENST00000430507.1,ENST00000374695.3
exon_skip_23013	1	22179456:22179563:22180685:22180836:22181103:22181149	22180685:22180836	ENSG00000142798.12	ENST00000493940.2,ENST00000374695.3
exon_skip_23015	1	22180725:22180836:22181103:22181258:22181340:22181476	22181103:22181258	ENSG00000142798.12	ENST00000430507.1,ENST00000374695.3
exon_skip_23017	1	22181796:22181939:22182015:22182168:22182279:22182405	22182015:22182168	ENSG00000142798.12	ENST00000374695.3
exon_skip_23018	1	22186058:22186169:22186327:22186495:22186669:22186728	22186327:22186495	ENSG00000142798.12	ENST00000374695.3
exon_skip_23019	1	22188480:22188608:22190592:22190706:22191335:22191566	22190592:22190706	ENSG00000142798.12	ENST00000374695.3
exon_skip_23021	1	22192209:22192302:22198678:22198870:22199112:22199253	22198678:22198870	ENSG00000142798.12	ENST00000374695.3
exon_skip_23023	1	22199867:22199917:22200417:22200504:22200898:22201026	22200417:22200504	ENSG00000142798.12	ENST00000427897.1,ENST00000374695.3
exon_skip_23025	1	22201383:22201495:22202121:22202240:22202355:22202535	22202121:22202240	ENSG00000142798.12	ENST00000374695.3
exon_skip_23029	1	22216473:22216634:22216919:22216978:22217077:22217187	22216919:22216978	ENSG00000142798.12	ENST00000439717.2,ENST00000374695.3

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for HSPG2

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_22964	1	22150108:22150212:22150613:22150697:22150798:22150866	22150613:22150697	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22966	1	22151196:22151272:22154355:22154412:22154522:22154645	22154355:22154412	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22967	1	22154355:22154412:22154522:22154645:22154747:22154919	22154522:22154645	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22970	1	22154522:22154645:22154747:22154919:22155327:22155572	22154747:22154919	ENSG00000142798.12	ENST00000486901.1,ENST00000374695.3
exon_skip_22972	1	22155327:22155572:22155875:22156097:22156485:22156584	22155875:22156097	ENSG00000142798.12	ENST00000374695.3
exon_skip_22975	1	22155875:22156097:22156485:22156584:22157474:22157583	22156485:22156584	ENSG00000142798.12	ENST00000374695.3
exon_skip_22977	1	22156485:22156584:22157474:22157583:22157707:22157817	22157474:22157583	ENSG00000142798.12	ENST00000374695.3
exon_skip_22978	1	22158144:22158289:22158987:22159099:22159760:22159815	22158987:22159099	ENSG00000142798.12	ENST00000374695.3
exon_skip_22980	1	22161171:22161438:22162032:22162130:22163294:22163410	22162032:22162130	ENSG00000142798.12	ENST00000374695.3
exon_skip_22984	1	22162084:22162130:22163294:22163499:22165317:22165499	22163294:22163499	ENSG00000142798.12	ENST00000374695.3
exon_skip_22986	1	22167593:22167778:22168031:22168166:22168494:22168635	22168031:22168166	ENSG00000142798.12	ENST00000374695.3
exon_skip_22991	1	22169789:22169931:22170640:22170792:22172600:22172748	22170640:22170792	ENSG00000142798.12	ENST00000374695.3
exon_skip_22994	1	22175385:22175524:22176533:22176685:22176855:22176991	22176533:22176685	ENSG00000142798.12	ENST00000374695.3,ENST00000430507.1
exon_skip_23009	1	22178038:22178190:22178283:22178419:22178580:22178625	22178283:22178419	ENSG00000142798.12	ENST00000374695.3,ENST00000430507.1
exon_skip_23013	1	22179456:22179563:22180685:22180836:22181103:22181149	22180685:22180836	ENSG00000142798.12	ENST00000374695.3,ENST00000493940.2
exon_skip_23015	1	22180725:22180836:22181103:22181258:22181340:22181476	22181103:22181258	ENSG00000142798.12	ENST00000374695.3,ENST00000430507.1
exon_skip_23017	1	22181796:22181939:22182015:22182168:22182279:22182405	22182015:22182168	ENSG00000142798.12	ENST00000374695.3
exon_skip_23018	1	22186058:22186169:22186327:22186495:22186669:22186728	22186327:22186495	ENSG00000142798.12	ENST00000374695.3
exon_skip_23019	1	22188480:22188608:22190592:22190706:22191335:22191566	22190592:22190706	ENSG00000142798.12	ENST00000374695.3
exon_skip_23021	1	22192209:22192302:22198678:22198870:22199112:22199253	22198678:22198870	ENSG00000142798.12	ENST00000374695.3
exon_skip_23023	1	22199867:22199917:22200417:22200504:22200898:22201026	22200417:22200504	ENSG00000142798.12	ENST00000374695.3,ENST00000427897.1
exon_skip_23025	1	22201383:22201495:22202121:22202240:22202355:22202535	22202121:22202240	ENSG00000142798.12	ENST00000374695.3
exon_skip_23028	1	22214430:22214559:22216473:22216634:22222414:22222459	22216473:22216634	ENSG00000142798.12	ENST00000412328.1
exon_skip_23029	1	22216473:22216634:22216919:22216978:22217077:22217187	22216919:22216978	ENSG00000142798.12	ENST00000374695.3,ENST00000439717.2

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for HSPG2

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000374695	22154747	22154919	Frame-shift
ENST00000374695	22157474	22157583	Frame-shift
ENST00000374695	22158987	22159099	Frame-shift
ENST00000374695	22162032	22162130	Frame-shift
ENST00000374695	22163294	22163499	Frame-shift
ENST00000374695	22170640	22170792	Frame-shift
ENST00000374695	22176533	22176685	Frame-shift
ENST00000374695	22178283	22178419	Frame-shift
ENST00000374695	22180685	22180836	Frame-shift
ENST00000374695	22181103	22181258	Frame-shift
ENST00000374695	22202121	22202240	Frame-shift
ENST00000374695	22216919	22216978	Frame-shift
ENST00000374695	22150613	22150697	In-frame
ENST00000374695	22154355	22154412	In-frame
ENST00000374695	22154522	22154645	In-frame
ENST00000374695	22155875	22156097	In-frame
ENST00000374695	22156485	22156584	In-frame
ENST00000374695	22168031	22168166	In-frame
ENST00000374695	22182015	22182168	In-frame
ENST00000374695	22186327	22186495	In-frame
ENST00000374695	22190592	22190706	In-frame
ENST00000374695	22198678	22198870	In-frame
ENST00000374695	22200417	22200504	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000374695	22154747	22154919	Frame-shift
ENST00000374695	22157474	22157583	Frame-shift
ENST00000374695	22158987	22159099	Frame-shift
ENST00000374695	22162032	22162130	Frame-shift
ENST00000374695	22163294	22163499	Frame-shift
ENST00000374695	22170640	22170792	Frame-shift
ENST00000374695	22176533	22176685	Frame-shift
ENST00000374695	22178283	22178419	Frame-shift
ENST00000374695	22180685	22180836	Frame-shift
ENST00000374695	22181103	22181258	Frame-shift
ENST00000374695	22202121	22202240	Frame-shift
ENST00000374695	22216919	22216978	Frame-shift
ENST00000374695	22150613	22150697	In-frame
ENST00000374695	22154355	22154412	In-frame
ENST00000374695	22154522	22154645	In-frame
ENST00000374695	22155875	22156097	In-frame
ENST00000374695	22156485	22156584	In-frame
ENST00000374695	22168031	22168166	In-frame
ENST00000374695	22182015	22182168	In-frame
ENST00000374695	22186327	22186495	In-frame
ENST00000374695	22190592	22190706	In-frame
ENST00000374695	22198678	22198870	In-frame
ENST00000374695	22200417	22200504	In-frame

Top

Infer the effects of exon skipping event on protein functional features for HSPG2

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000374695	14344	4391	22200417	22200504	3737	3823	1219	1247
ENST00000374695	14344	4391	22198678	22198870	4110	4301	1343	1407
ENST00000374695	14344	4391	22190592	22190706	4707	4820	1542	1580
ENST00000374695	14344	4391	22186327	22186495	5095	5262	1671	1727
ENST00000374695	14344	4391	22182015	22182168	5782	5934	1900	1951
ENST00000374695	14344	4391	22168031	22168166	9274	9408	3064	3109
ENST00000374695	14344	4391	22156485	22156584	11752	11850	3890	3923
ENST00000374695	14344	4391	22155875	22156097	11851	12072	3923	3997
ENST00000374695	14344	4391	22154522	22154645	12490	12612	4136	4177
ENST00000374695	14344	4391	22154355	22154412	12613	12669	4177	4196
ENST00000374695	14344	4391	22150613	22150697	12896	12979	4272	4299

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000374695	14344	4391	22200417	22200504	3737	3823	1219	1247
ENST00000374695	14344	4391	22198678	22198870	4110	4301	1343	1407
ENST00000374695	14344	4391	22190592	22190706	4707	4820	1542	1580
ENST00000374695	14344	4391	22186327	22186495	5095	5262	1671	1727
ENST00000374695	14344	4391	22182015	22182168	5782	5934	1900	1951
ENST00000374695	14344	4391	22168031	22168166	9274	9408	3064	3109
ENST00000374695	14344	4391	22156485	22156584	11752	11850	3890	3923
ENST00000374695	14344	4391	22155875	22156097	11851	12072	3923	3997
ENST00000374695	14344	4391	22154522	22154645	12490	12612	4136	4177
ENST00000374695	14344	4391	22154355	22154412	12613	12669	4177	4196
ENST00000374695	14344	4391	22150613	22150697	12896	12979	4272	4299

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P98160	1219	1247	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1219	1247	1209	1224	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1219	1247	1211	1234	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1219	1247	1237	1246	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1219	1247	1209	1265	Domain	Note=Laminin EGF-like 7;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00460
P98160	1219	1247	1222	1222	Sequence conflict	Note=H->L;Ontology_term=ECO:0000305;evidence=ECO:0000305
P98160	1343	1407	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1343	1407	1344	1529	Domain	Note=Laminin IV type A 3;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00458
P98160	1343	1407	1406	1406	Sequence conflict	Note=D->G;Ontology_term=ECO:0000305;evidence=ECO:0000305
P98160	1542	1580	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1542	1580	1563	1572	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1542	1580	1565	1579	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1542	1580	1530	1562	Domain	Note=Laminin EGF-like 9%3B second part;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00460
P98160	1542	1580	1563	1612	Domain	Note=Laminin EGF-like 10;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00460
P98160	1671	1727	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1671	1727	1677	1771	Domain	Note=Ig-like C2-type 2
P98160	1671	1727	1703	1704	Sequence conflict	Note=SP->RG;Ontology_term=ECO:0000305;evidence=ECO:0000305
P98160	1900	1951	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1900	1951	1866	1955	Domain	Note=Ig-like C2-type 4
P98160	1900	1951	1919	1919	Natural variant	ID=VAR_047985;Note=R->C;Dbxref=dbSNP:rs2229474
P98160	3064	3109	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	3064	3109	3022	3112	Domain	Note=Ig-like C2-type 16
P98160	3064	3109	3072	3072	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:19159218;Dbxref=PMID:19159218
P98160	3064	3109	3105	3105	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	3890	3923	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	3890	3923	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	3890	3923	3888	3899	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	3890	3923	3893	3910	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	3890	3923	3912	3921	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	3890	3923	3884	3922	Domain	Note=EGF-like 2;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00076
P98160	3923	3997	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	3923	3997	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	3923	3997	3928	4103	Domain	Note=Laminin G-like 2;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00122
P98160	3923	3997	3933	3933	Glycosylation	Note=O-linked (Xyl...) (chondroitin sulfate) serine;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	4136	4177	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	4136	4177	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	4136	4177	4131	4140	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4147	4159	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4153	4164	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4166	4175	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4104	4141	Domain	Note=EGF-like 3;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00076
P98160	4136	4177	4143	4176	Domain	Note=EGF-like 4;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00076
P98160	4136	4177	4149	4151	Region	Note=Mediates motor neuron attachment;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	4177	4196	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	4177	4196	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	4177	4196	4179	4179	Glycosylation	Note=O-linked (Xyl...) (chondroitin sulfate) serine;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	4177	4196	4196	4197	Site	Note=Cleavage%3B by BMP1
P98160	4272	4299	4268	4274	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	4279	4283	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	4290	4292	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	4294	4301	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	4272	4299	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	4272	4299	4197	4391	Chain	ID=PRO_0000391622;Note=LG3 peptide
P98160	4272	4299	4201	4389	Domain	Note=Laminin G-like 3;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00122
P98160	4272	4299	4275	4275	Metal binding	Note=Calcium%3B via carbonyl oxygen
P98160	4272	4299	4299	4301	Region	Note=Mediates motor neuron attachment;Ontology_term=ECO:0000255;evidence=ECO:0000255

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
P98160	1219	1247	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1219	1247	1209	1224	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1219	1247	1211	1234	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1219	1247	1237	1246	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1219	1247	1209	1265	Domain	Note=Laminin EGF-like 7;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00460
P98160	1219	1247	1222	1222	Sequence conflict	Note=H->L;Ontology_term=ECO:0000305;evidence=ECO:0000305
P98160	1343	1407	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1343	1407	1344	1529	Domain	Note=Laminin IV type A 3;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00458
P98160	1343	1407	1406	1406	Sequence conflict	Note=D->G;Ontology_term=ECO:0000305;evidence=ECO:0000305
P98160	1542	1580	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1542	1580	1563	1572	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1542	1580	1565	1579	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	1542	1580	1530	1562	Domain	Note=Laminin EGF-like 9%3B second part;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00460
P98160	1542	1580	1563	1612	Domain	Note=Laminin EGF-like 10;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00460
P98160	1671	1727	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1671	1727	1677	1771	Domain	Note=Ig-like C2-type 2
P98160	1671	1727	1703	1704	Sequence conflict	Note=SP->RG;Ontology_term=ECO:0000305;evidence=ECO:0000305
P98160	1900	1951	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	1900	1951	1866	1955	Domain	Note=Ig-like C2-type 4
P98160	1900	1951	1919	1919	Natural variant	ID=VAR_047985;Note=R->C;Dbxref=dbSNP:rs2229474
P98160	3064	3109	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	3064	3109	3022	3112	Domain	Note=Ig-like C2-type 16
P98160	3064	3109	3072	3072	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:19159218;Dbxref=PMID:19159218
P98160	3064	3109	3105	3105	Glycosylation	Note=N-linked (GlcNAc...) asparagine;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	3890	3923	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	3890	3923	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	3890	3923	3888	3899	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	3890	3923	3893	3910	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	3890	3923	3912	3921	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	3890	3923	3884	3922	Domain	Note=EGF-like 2;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00076
P98160	3923	3997	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	3923	3997	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	3923	3997	3928	4103	Domain	Note=Laminin G-like 2;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00122
P98160	3923	3997	3933	3933	Glycosylation	Note=O-linked (Xyl...) (chondroitin sulfate) serine;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	4136	4177	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	4136	4177	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	4136	4177	4131	4140	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4147	4159	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4153	4164	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4166	4175	Disulfide bond	Ontology_term=ECO:0000250;evidence=ECO:0000250
P98160	4136	4177	4104	4141	Domain	Note=EGF-like 3;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00076
P98160	4136	4177	4143	4176	Domain	Note=EGF-like 4;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00076
P98160	4136	4177	4149	4151	Region	Note=Mediates motor neuron attachment;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	4177	4196	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	4177	4196	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	4177	4196	4179	4179	Glycosylation	Note=O-linked (Xyl...) (chondroitin sulfate) serine;Ontology_term=ECO:0000255;evidence=ECO:0000255
P98160	4177	4196	4196	4197	Site	Note=Cleavage%3B by BMP1
P98160	4272	4299	4268	4274	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	4279	4283	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	4290	4292	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	4294	4301	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:3SH4
P98160	4272	4299	22	4391	Chain	ID=PRO_0000026696;Note=Basement membrane-specific heparan sulfate proteoglycan core protein
P98160	4272	4299	3687	4391	Chain	ID=PRO_0000391621;Note=Endorepellin
P98160	4272	4299	4197	4391	Chain	ID=PRO_0000391622;Note=LG3 peptide
P98160	4272	4299	4201	4389	Domain	Note=Laminin G-like 3;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00122
P98160	4272	4299	4275	4275	Metal binding	Note=Calcium%3B via carbonyl oxygen
P98160	4272	4299	4299	4301	Region	Note=Mediates motor neuron attachment;Ontology_term=ECO:0000255;evidence=ECO:0000255

Top

SNVs in the skipped exons for HSPG2

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

HSPG2_STAD_exon_skip_23021_psi_boxplot.png
boxplot

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
LIHC	TCGA-DD-A3A0-01	exon_skip_22964	22150614	22150697	22150678	22150678	Frame_Shift_Del	C	-	p.E4279fs
BRCA	TCGA-A8-A07R-01	exon_skip_22972	22155876	22156097	22155911	22155911	Frame_Shift_Del	C	-	p.G3986fs
STAD	TCGA-CG-4306-01	exon_skip_22972	22155876	22156097	22155955	22155955	Frame_Shift_Del	C	-	p.K3972fs
STAD	TCGA-CG-4306-01	exon_skip_22972	22155876	22156097	22155955	22155955	Frame_Shift_Del	C	-	p.K3973fs
LIHC	TCGA-DD-A39Y-01	exon_skip_22972	22155876	22156097	22156038	22156038	Frame_Shift_Del	G	-	p.L3944fs
LIHC	TCGA-DD-A3A0-01	exon_skip_22978	22158988	22159099	22159003	22159003	Frame_Shift_Del	C	-	p.G3731fs
LIHC	TCGA-DD-A1EG-01	exon_skip_22991	22170641	22170792	22170777	22170777	Frame_Shift_Del	G	-	p.P2828fs
LIHC	TCGA-DD-A1EG-01	exon_skip_22994	22176534	22176685	22176669	22176669	Frame_Shift_Del	G	-	p.P2437fs
STAD	TCGA-BR-8081-01	exon_skip_22994	22176534	22176685	22176669	22176669	Frame_Shift_Del	G	-	p.T2438fs
STAD	TCGA-BR-8081-01	exon_skip_22994	22176534	22176685	22176669	22176669	Frame_Shift_Del	G	-	p.T2439fs
LIHC	TCGA-DD-A1EG-01	exon_skip_23009	22178284	22178419	22178299	22178299	Frame_Shift_Del	C	-	p.A2331fs
LIHC	TCGA-DD-A39Y-01	exon_skip_23013	22180686	22180836	22180748	22180748	Frame_Shift_Del	T	-	p.K2126fs
LIHC	TCGA-DD-A3A0-01	exon_skip_23013	22180686	22180836	22180754	22180754	Frame_Shift_Del	C	-	p.G2124fs
UVM	TCGA-V4-A9EM-01	exon_skip_23017	22182016	22182168	22182161	22182161	Frame_Shift_Del	G	-	p.P1903fs
LIHC	TCGA-DD-A39Y-01	exon_skip_23018	22186328	22186495	22186376	22186376	Frame_Shift_Del	G	-	p.R1712fs
LIHC	TCGA-DD-A39Y-01	exon_skip_23018	22186328	22186495	22186442	22186442	Frame_Shift_Del	G	-	p.Q1690fs
BLCA	TCGA-DK-A6B5-01	exon_skip_23019	22190593	22190706	22190636	22190636	Frame_Shift_Del	T	-	p.N1566fs
STAD	TCGA-D7-6524-01	exon_skip_23021	22198679	22198870	22198725	22198725	Frame_Shift_Del	T	-	p.H1392fs
LIHC	TCGA-DD-A3A0-01	exon_skip_23021	22198679	22198870	22198759	22198759	Frame_Shift_Del	G	-	p.Q1381fs
BLCA	TCGA-GC-A6I3-01	exon_skip_23029	22216920	22216978	22216939	22216940	Frame_Shift_Ins	-	A	p.V132fs
THYM	TCGA-XU-AAXX-01	exon_skip_22964	22150614	22150697	22150694	22150694	Nonsense_Mutation	G	T	p.Y4273X
LUAD	TCGA-62-A470-01	exon_skip_22994	22176534	22176685	22176570	22176570	Nonsense_Mutation	C	T	p.W2470*
COAD	TCGA-D5-6930-01	exon_skip_23015	22181104	22181258	22181133	22181133	Nonsense_Mutation	G	A	p.R2087X
HNSC	TCGA-CR-7371-01	exon_skip_22977	22157475	22157583	22157584	22157584	Splice_Site	C	G	p.N3855_splice
LUAD	TCGA-05-4398-01	exon_skip_22977	22157475	22157583	22157584	22157584	Splice_Site	C	G	p.N3855_splice
BLCA	TCGA-G2-A2EF-01	exon_skip_23009	22178284	22178419	22178283	22178283	Splice_Site	C	T	p.P2336_splice

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons	Mutation description
	Sample: TCGA-D7-6524-01
	Cancer type: STAD
	ESID: exon_skip_23021
	Skipped exon start: 22198679
	Skipped exon end: 22198870
	Mutation start: 22198725
	Mutation end: 22198725
	Mutation type: Frame_Shift_Del
	Reference seq: T
	Mutation seq: -
	AAchange: p.H1392fs
exon_skip_23021_STAD_TCGA-D7-6524-01.png

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
SNUC5_LARGE_INTESTINE	22155876	22156097	22155955	22155955	Frame_Shift_Del	C	-	p.G3971fs
HEC59_ENDOMETRIUM	22150614	22150697	22150636	22150636	Missense_Mutation	A	G	p.W4293R
HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22150614	22150697	22150636	22150636	Missense_Mutation	A	C	p.W4293G
RF48_STOMACH	22154356	22154412	22154380	22154380	Missense_Mutation	G	A	p.H4189Y
HEC6_ENDOMETRIUM	22154523	22154645	22154535	22154535	Missense_Mutation	G	A	p.R4174C
NCIH1770_LUNG	22154523	22154645	22154552	22154552	Missense_Mutation	G	A	p.P4168L
NCIH2106_LUNG	22154523	22154645	22154552	22154552	Missense_Mutation	G	A	p.P4168L
LUDLU1_LUNG	22154523	22154645	22154553	22154553	Missense_Mutation	G	A	p.P4168S
JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22154748	22154919	22154778	22154778	Missense_Mutation	A	T	p.F4127I
HEC6_ENDOMETRIUM	22154748	22154919	22154792	22154792	Missense_Mutation	G	A	p.A4122V
REH_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22154748	22154919	22154828	22154828	Missense_Mutation	C	T	p.R4110H
SNU1076_UPPER_AERODIGESTIVE_TRACT	22155876	22156097	22155893	22155893	Missense_Mutation	C	T	p.R3992H
SNU349_KIDNEY	22155876	22156097	22155977	22155977	Missense_Mutation	C	T	p.G3964E
MZ7MEL_SKIN	22155876	22156097	22155993	22155993	Missense_Mutation	G	A	p.P3959S
LU135_LUNG	22155876	22156097	22156023	22156023	Missense_Mutation	G	C	p.H3949D
KATOIII_STOMACH	22156486	22156584	22156544	22156544	Missense_Mutation	G	T	p.D3904E
HSC1_SKIN	22156486	22156584	22156552	22156552	Missense_Mutation	G	A	p.R3902W
MKN1_STOMACH	22156486	22156584	22156552	22156552	Missense_Mutation	G	A	p.R3902W
MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22156486	22156584	22156552	22156552	Missense_Mutation	G	A	p.R3902W
NCIH2081_LUNG	22157475	22157583	22157482	22157482	Missense_Mutation	G	C	p.C3888W
TTC642_SOFT_TISSUE	22158988	22159099	22159010	22159010	Missense_Mutation	C	T	p.V3729M
HEC251_ENDOMETRIUM	22162033	22162130	22162057	22162057	Missense_Mutation	C	T	p.A3477T
JHH5_LIVER	22163295	22163499	22163333	22163333	Missense_Mutation	C	A	p.Q3439H
KE39_STOMACH	22163295	22163499	22163333	22163333	Missense_Mutation	C	A	p.Q3439H
SKMEL3_SKIN	22163295	22163499	22163467	22163467	Missense_Mutation	G	A	p.P3395S
KARPAS231_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22168032	22168166	22168068	22168068	Missense_Mutation	C	T	p.G3098S
CCRFCEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22168032	22168166	22168091	22168091	Missense_Mutation	C	T	p.R3090H
SCABER_URINARY_TRACT	22168032	22168166	22168092	22168092	Missense_Mutation	G	A	p.R3090C
639V_URINARY_TRACT	22168032	22168166	22168098	22168098	Missense_Mutation	T	C	p.T3088A
RERFLCAD1_LUNG	22168032	22168166	22168135	22168135	Missense_Mutation	G	C	p.I3075M
LC41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22168032	22168166	22168157	22168157	Missense_Mutation	T	C	p.H3068R
COLO792_SKIN	22170641	22170792	22170736	22170736	Missense_Mutation	C	T	p.G2841R
MEWO_SKIN	22170641	22170792	22170753	22170753	Missense_Mutation	G	A	p.S2835F
SNU1040_LARGE_INTESTINE	22176534	22176685	22176602	22176602	Missense_Mutation	C	T	p.V2460I
LOVO_LARGE_INTESTINE	22176534	22176685	22176668	22176668	Missense_Mutation	T	C	p.T2438A
SNGM_ENDOMETRIUM	22178284	22178419	22178344	22178344	Missense_Mutation	C	T	p.G2316S
NCIH929_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22178284	22178419	22178409	22178409	Missense_Mutation	G	A	p.S2294F
HT1197_URINARY_TRACT	22180686	22180836	22180781	22180781	Missense_Mutation	T	A	p.Y2115F
SLR26_KIDNEY	22181104	22181258	22181117	22181117	Missense_Mutation	G	C	p.P2092R
CAL33_UPPER_AERODIGESTIVE_TRACT	22181104	22181258	22181240	22181240	Missense_Mutation	G	A	p.P2051L
RL952_ENDOMETRIUM	22182016	22182168	22182108	22182108	Missense_Mutation	G	A	p.P1921L
AML193_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22186328	22186495	22186334	22186334	Missense_Mutation	G	A	p.H1726Y
CORL279_LUNG	22186328	22186495	22186412	22186412	Missense_Mutation	C	A	p.V1700F
NCIH838_LUNG	22186328	22186495	22186414	22186414	Missense_Mutation	T	G	p.Q1699P
SNU175_LARGE_INTESTINE	22186328	22186495	22186421	22186421	Missense_Mutation	G	A	p.R1697W
SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22186328	22186495	22186421	22186421	Missense_Mutation	G	A	p.R1697W
SKMEL24_SKIN	22186328	22186495	22186426	22186426	Missense_Mutation	G	A	p.S1695F
HEC1B_ENDOMETRIUM	22186328	22186495	22186438	22186438	Missense_Mutation	C	T	p.G1691D
KARPAS45_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22186328	22186495	22186487	22186487	Missense_Mutation	C	T	p.A1675T
MDAMB436_BREAST	22198679	22198870	22198713	22198713	Missense_Mutation	T	G	p.Y1396S
22RV1_PROSTATE	22198679	22198870	22198776	22198776	Missense_Mutation	G	A	p.P1375L
HCC2998_LARGE_INTESTINE	22198679	22198870	22198812	22198812	Missense_Mutation	C	T	p.R1363Q
MZ7B_MATCHED_NORMAL_TISSUE	22200418	22200504	22200445	22200445	Missense_Mutation	G	A	p.P1239L
MZ7MEL_SKIN	22200418	22200504	22200445	22200445	Missense_Mutation	G	A	p.P1239L
MHHPREB1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	22200418	22200504	22200472	22200472	Missense_Mutation	C	T	p.G1230D
SNUC2A_LARGE_INTESTINE	22202122	22202240	22202186	22202186	Missense_Mutation	C	T	p.A1080T
D542MG_CENTRAL_NERVOUS_SYSTEM	22216920	22216978	22216971	22216971	Missense_Mutation	G	A	p.S121L
L542_MATCHED_NORMAL_TISSUE	22216920	22216978	22216971	22216971	Missense_Mutation	G	A	p.S121L
HEC59_ENDOMETRIUM	22198679	22198870	22198813	22198813	Nonsense_Mutation	G	A	p.R1363*
HS852T_SKIN	22150614	22150697	22150695	22150795	Splice_Site	TACCTGCAGTCATCCAGGCCCAAGAAGTATGAGCTGGGGCAGGACCGGGGGGTGGGGTGCTGGGACCAGGGAAGGGAGAGGAAGGGCCAGGTGCCAGGACC	-	p.RV4272fs

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for HSPG2

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HSPG2

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HSPG2

Top

RelatedDrugs for HSPG2

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene	UniProtAcc	DrugBank ID	Drug name	Drug activity	Drug type	Drug status
	P98160	DB00039	Palifermin	Basement membrane-specific heparan sulfate proteoglycan core protein	biotech	approved

Top

RelatedDiseases for HSPG2

Diseases associated with this gene.
(DisGeNet 4.0)

Gene	Disease ID	Disease name	# pubmeds	Source
HSPG2	C0029422	Osteochondrodysplasias	2	CTD_human;HPO
HSPG2	C0036391	Schwartz-Jampel Syndrome	1	ORPHANET;UNIPROT
HSPG2	C0376634	Craniofacial Abnormalities	1	CTD_human
HSPG2	C1857100	Dyssegmental dysplasia	1	CTD_human;ORPHANET

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact