ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for HLA-B

Gene summary

Gene information	Gene symbol	HLA-B
	Gene ID	3106
	Gene name	major histocompatibility complex, class I, B
	Synonyms	AS\|B-4901\|HLAB
	Cytomap	6p21.33
	Type of gene	protein-coding
	Description	major histocompatibility complex, class I, BHLA class I antigen HLA-BHLA class I histocompatibility antigen, B alpha chainMHC HLA-B cell surface glycoproteinMHC HLA-B transmembrane glycoproteinMHC class 1 antigenMHC class I antigen HLA-B alpha chain
	Modification date	20180527
	UniProtAcc	Q95365
	Context	PubMed: HLA-B [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for HLA-B from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for HLA-B

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for HLA-B

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_457449	6	31322255:31322303:31322409:31322442:31322883:31322937	31322409:31322442	ENSG00000234745.5	ENST00000412585.2
exon_skip_457524	6	31322409:31322442:31322883:31323000:31323093:31323104	31322883:31323000	ENSG00000234745.5	ENST00000412585.2
exon_skip_457580	6	31323283:31323369:31323943:31324219:31324464:31324569	31323943:31324219	ENSG00000234745.5	ENST00000434333.1,ENST00000412585.2
exon_skip_457585	6	31323283:31323369:31323943:31324734:31324862:31324956	31323943:31324734	ENSG00000234745.5	ENST00000498007.1
exon_skip_457596	6	31323943:31324219:31324464:31324734:31324862:31324956	31324464:31324734	ENSG00000234745.5	ENST00000412585.2

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for HLA-B

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_457449	6	31322255:31322303:31322409:31322442:31322883:31322937	31322409:31322442	ENSG00000234745.5	ENST00000412585.2
exon_skip_457524	6	31322409:31322442:31322883:31323000:31323093:31323104	31322883:31323000	ENSG00000234745.5	ENST00000412585.2
exon_skip_457580	6	31323283:31323369:31323943:31324219:31324464:31324569	31323943:31324219	ENSG00000234745.5	ENST00000412585.2,ENST00000434333.1
exon_skip_457585	6	31323283:31323369:31323943:31324734:31324862:31324956	31323943:31324734	ENSG00000234745.5	ENST00000498007.1
exon_skip_457596	6	31323943:31324219:31324464:31324734:31324862:31324956	31324464:31324734	ENSG00000234745.5	ENST00000412585.2

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for HLA-B

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST

Start of skipped exon

End of skipped exon

ORF

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST

Start of skipped exon

End of skipped exon

ORF

Top

Infer the effects of exon skipping event on protein functional features for HLA-B

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST

Length of mRNA

Length of AA seq.

Genomic start

Genomic end

mRNA start

mRNA end

AA start

AA end

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST

Length of mRNA

Length of AA seq.

Genomic start

Genomic end

mRNA start

mRNA end

AA start

AA end

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.

Start of exon skipping (AA)

End of exon skipping (AA)

Protein feature start (AA)

Protein feature end (AA)

Category of protein feature

Description of feature

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.

Start of exon skipping (AA)

End of exon skipping (AA)

Protein feature start (AA)

Protein feature end (AA)

Category of protein feature

Description of feature

Top

SNVs in the skipped exons for HLA-B

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
CESC	TCGA-EA-A1QT-01	exon_skip_457524	31322884	31323000	31322921	31322939	Frame_Shift_Del	AGCTCCGATGACCACAACT	-	p.AVVVIGA319fs
HNSC	TCGA-CV-5973-01	exon_skip_457524	31322884	31323000	31322969	31322970	Frame_Shift_Del	CA	-	p.V309fs
COAD	TCGA-D5-6931-01	exon_skip_457524	31322884	31323000	31322979	31322979	Frame_Shift_Del	A	-	p.V306fs
ACC	TCGA-OR-A5J5-01	exon_skip_457580	31323944	31324219	31323953	31323960	Frame_Shift_Del	CCAGCTTG	-	p.202_204del
ACC	TCGA-OR-A5J5-01	exon_skip_457585	31323944	31324734	31323953	31323960	Frame_Shift_Del	CCAGCTTG	-	p.202_204del
ACC	TCGA-OR-A5JO-01	exon_skip_457580	31323944	31324219	31323953	31323960	Frame_Shift_Del	CCAGCTTG	-	p.202_204del
ACC	TCGA-OR-A5JO-01	exon_skip_457585	31323944	31324734	31323953	31323960	Frame_Shift_Del	CCAGCTTG	-	p.202_204del
ACC	TCGA-OR-A5LK-01	exon_skip_457580	31323944	31324219	31323953	31323960	Frame_Shift_Del	CCAGCTTG	-	p.202_204del
ACC	TCGA-OR-A5LK-01	exon_skip_457585	31323944	31324734	31323953	31323960	Frame_Shift_Del	CCAGCTTG	-	p.202_204del
ACC	TCGA-OR-A5JY-01	exon_skip_457580	31323944	31324219	31324003	31324025	Frame_Shift_Del	TCGCCCTCCAGGTAGGCTCTCCG	-	p.180_187del
ACC	TCGA-OR-A5JY-01	exon_skip_457585	31323944	31324734	31324003	31324025	Frame_Shift_Del	TCGCCCTCCAGGTAGGCTCTCCG	-	p.180_187del
DLBC	TCGA-GS-A9TZ-01	exon_skip_457580	31323944	31324219	31324195	31324201	Frame_Shift_Del	TACATGC	-	p.121_123del
DLBC	TCGA-GS-A9TZ-01	exon_skip_457585	31323944	31324734	31324195	31324201	Frame_Shift_Del	TACATGC	-	p.121_123del
BRCA	TCGA-A8-A06U-01	exon_skip_457585	31323944	31324734	31324373	31324373	Frame_Shift_Del	A	-	p.L136fs
UCEC	TCGA-BS-A0U9-01	exon_skip_457585	31323944	31324734	31324373	31324374	Frame_Shift_Del	AG	-	p.L136fs
COAD	TCGA-A6-5665-01	exon_skip_457585	31323944	31324734	31324568	31324568	Frame_Shift_Del	C	-	p.P81fs
COAD	TCGA-A6-5665-01	exon_skip_457596	31324465	31324734	31324568	31324568	Frame_Shift_Del	C	-	p.P81fs
STAD	TCGA-HU-A4G8-01	exon_skip_457585	31323944	31324734	31324568	31324568	Frame_Shift_Del	C	-	p.P81fs
STAD	TCGA-HU-A4G8-01	exon_skip_457596	31324465	31324734	31324568	31324568	Frame_Shift_Del	C	-	p.P81fs
ACC	TCGA-OR-A5KZ-01	exon_skip_457585	31323944	31324734	31324595	31324604	Frame_Shift_Del	CGGCTCCTCT	-	p.69_72del
ACC	TCGA-OR-A5KZ-01	exon_skip_457596	31324465	31324734	31324595	31324604	Frame_Shift_Del	CGGCTCCTCT	-	p.69_72del
ACC	TCGA-OR-A5JC-01	exon_skip_457585	31323944	31324734	31324604	31324604	Frame_Shift_Del	T	-	p.R68fs
ACC	TCGA-OR-A5JC-01	exon_skip_457596	31324465	31324734	31324604	31324604	Frame_Shift_Del	T	-	p.R68fs
COAD	TCGA-AA-3697-01	exon_skip_457585	31323944	31324734	31324604	31324604	Frame_Shift_Del	T	-	p.E69fs
COAD	TCGA-AA-3697-01	exon_skip_457596	31324465	31324734	31324604	31324604	Frame_Shift_Del	T	-	p.E69fs
COAD	TCGA-AM-5820-01	exon_skip_457585	31323944	31324734	31324604	31324604	Frame_Shift_Del	T	-	p.E69fs
COAD	TCGA-AM-5820-01	exon_skip_457596	31324465	31324734	31324604	31324604	Frame_Shift_Del	T	-	p.E69fs
COAD	TCGA-AD-5900-01	exon_skip_457524	31322884	31323000	31322962	31322963	Frame_Shift_Ins	-	A	p.V312fs
LIHC	TCGA-FV-A23B-01	exon_skip_457580	31323944	31324219	31324160	31324161	Frame_Shift_Ins	-	A	p.R135fs
LIHC	TCGA-FV-A23B-01	exon_skip_457585	31323944	31324734	31324160	31324161	Frame_Shift_Ins	-	A	p.R135fs
ACC	TCGA-OR-A5JC-01	exon_skip_457585	31323944	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.G69fs
ACC	TCGA-OR-A5JC-01	exon_skip_457596	31324465	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.G69fs
BRCA	TCGA-A8-A09K-01	exon_skip_457585	31323944	31324734	31324601	31324602	Frame_Shift_Ins	-	A	p.E69fs
BRCA	TCGA-A8-A09K-01	exon_skip_457596	31324465	31324734	31324601	31324602	Frame_Shift_Ins	-	A	p.E69fs
BRCA	TCGA-AR-A255-01	exon_skip_457585	31323944	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
BRCA	TCGA-AR-A255-01	exon_skip_457596	31324465	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
BRCA	TCGA-E9-A1RI-01	exon_skip_457585	31323944	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
BRCA	TCGA-E9-A1RI-01	exon_skip_457596	31324465	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
BRCA	TCGA-E9-A248-01	exon_skip_457585	31323944	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
BRCA	TCGA-E9-A248-01	exon_skip_457596	31324465	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
COAD	TCGA-AA-3697-01	exon_skip_457585	31323944	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
COAD	TCGA-AA-3697-01	exon_skip_457596	31324465	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
COAD	TCGA-AM-5820-01	exon_skip_457585	31323944	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
COAD	TCGA-AM-5820-01	exon_skip_457596	31324465	31324734	31324601	31324602	Frame_Shift_Ins	-	G	p.E69fs
SKCM	TCGA-FW-A3R5-06	exon_skip_457524	31322884	31323000	31322989	31322989	Nonsense_Mutation	G	A	p.Q303*
SKCM	TCGA-FW-A3R5-06	exon_skip_457524	31322884	31323000	31322989	31322989	Nonsense_Mutation	G	A	p.Q303X
HNSC	TCGA-D6-6516-01	exon_skip_457580	31323944	31324219	31324148	31324148	Nonsense_Mutation	G	A	p.Q139*
HNSC	TCGA-D6-6516-01	exon_skip_457585	31323944	31324734	31324148	31324148	Nonsense_Mutation	G	A	p.Q139*
CESC	TCGA-JW-A5VL-01	exon_skip_457585	31323944	31324734	31324477	31324477	Nonsense_Mutation	G	A	p.Q111*
CESC	TCGA-JW-A5VL-01	exon_skip_457596	31324465	31324734	31324477	31324477	Nonsense_Mutation	G	A	p.Q111*
DLBC	TCGA-VB-A8QN-01	exon_skip_457585	31323944	31324734	31324576	31324576	Nonsense_Mutation	G	A	p.Q78X
DLBC	TCGA-VB-A8QN-01	exon_skip_457596	31324465	31324734	31324576	31324576	Nonsense_Mutation	G	A	p.Q78X
HNSC	TCGA-CR-6481-01	exon_skip_457585	31323944	31324734	31324665	31324665	Nonsense_Mutation	G	T	p.S48*
HNSC	TCGA-CR-6481-01	exon_skip_457596	31324465	31324734	31324665	31324665	Nonsense_Mutation	G	T	p.S48*
CESC	TCGA-JX-A3Q0-01	exon_skip_457585	31323944	31324734	31324681	31324681	Nonsense_Mutation	C	A	p.E43*
CESC	TCGA-JX-A3Q0-01	exon_skip_457596	31324465	31324734	31324681	31324681	Nonsense_Mutation	C	A	p.E43*
STAD	TCGA-F1-6874-01	exon_skip_457524	31322884	31323000	31322883	31322883	Splice_Site	C	T	p.G338_splice
CESC	TCGA-FU-A3TQ-01	exon_skip_457524	31322884	31323000	31323001	31323001	Splice_Site	C	G	e5-1
CESC	TCGA-IR-A3LK-01	exon_skip_457524	31322884	31323000	31323001	31323001	Splice_Site	C	T	e5-1
CESC	TCGA-IR-A3LL-01	exon_skip_457524	31322884	31323000	31323001	31323001	Splice_Site	C	T	e5-1
ESCA	TCGA-Z6-AAPN-01	exon_skip_457596	31324465	31324734	31324463	31324463	Splice_Site	A	G	.
ESCA	TCGA-Z6-AAPN-01	exon_skip_457596	31324465	31324734	31324463	31324463	Splice_Site	A	G	e2+2
ESCA	TCGA-Z6-AAPN-01	exon_skip_457596	31324465	31324734	31324464	31324464	Splice_Site	C	A	.
ESCA	TCGA-Z6-AAPN-01	exon_skip_457596	31324465	31324734	31324464	31324464	Splice_Site	C	A	e2+1

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons

Mutation description

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
BICR10_UPPER_AERODIGESTIVE_TRACT	31323944	31324734	31324554	31324555	Frame_Shift_Ins	-	C	p.D85fs
BICR10_UPPER_AERODIGESTIVE_TRACT	31324465	31324734	31324554	31324555	Frame_Shift_Ins	-	C	p.D85fs
A2780_OVARY	31323944	31324734	31324717	31324718	Frame_Shift_Ins	-	CCTCATGGAGTGGGAG	p.Y31fs
A2780_OVARY	31324465	31324734	31324717	31324718	Frame_Shift_Ins	-	CCTCATGGAGTGGGAG	p.Y31fs
TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31323944	31324734	31324075	31324086	In_Frame_Del	GCCGTGTCCGCG	-	p.159_163AADTA>A
TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31323944	31324219	31324075	31324086	In_Frame_Del	GCCGTGTCCGCG	-	p.159_163AADTA>A
HEC1A_ENDOMETRIUM	31322884	31323000	31322942	31322943	In_Frame_Ins	-	AGGACAGCC	p.318_318L>LAVL
SNU1197_LARGE_INTESTINE	31322410	31322442	31322416	31322416	Missense_Mutation	C	G	p.A347P
TCYIK_CERVIX	31322410	31322442	31322416	31322416	Missense_Mutation	C	G	p.A347P
NCIH716_LARGE_INTESTINE	31323944	31324734	31323972	31323972	Missense_Mutation	C	A	p.E197D
NCIH716_LARGE_INTESTINE	31323944	31324219	31323972	31323972	Missense_Mutation	C	A	p.E197D
CHLA32_BONE	31323944	31324734	31324013	31324013	Missense_Mutation	G	T	p.L184M
CHLA32_BONE	31323944	31324219	31324013	31324013	Missense_Mutation	G	T	p.L184M
CTB1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31323944	31324734	31324072	31324072	Missense_Mutation	G	A	p.A164V
CTB1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31323944	31324219	31324072	31324072	Missense_Mutation	G	A	p.A164V
SNU1040_LARGE_INTESTINE	31323944	31324734	31324117	31324117	Missense_Mutation	G	A	p.A149V
SNU1040_LARGE_INTESTINE	31323944	31324219	31324117	31324117	Missense_Mutation	G	A	p.A149V
SW48_LARGE_INTESTINE	31323944	31324734	31324146	31324146	Missense_Mutation	C	A	p.Q139H
SW48_LARGE_INTESTINE	31323944	31324219	31324146	31324146	Missense_Mutation	C	A	p.Q139H
KM12_LARGE_INTESTINE	31323944	31324734	31324503	31324503	Missense_Mutation	A	G	p.L102P
KM12_LARGE_INTESTINE	31324465	31324734	31324503	31324503	Missense_Mutation	A	G	p.L102P
DMS53_LUNG	31323944	31324734	31324093	31324093	Nonsense_Mutation	C	T	p.W157*
DMS53_LUNG	31323944	31324219	31324093	31324093	Nonsense_Mutation	C	T	p.W157*
CAL39_VULVA	31323944	31324734	31324137	31324137	Nonsense_Mutation	G	T	p.Y142*
CAL39_VULVA	31323944	31324219	31324137	31324137	Nonsense_Mutation	G	T	p.Y142*
A3KAW_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31323944	31324734	31324484	31324484	Nonsense_Mutation	G	C	p.Y108*
A3KAW_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31324465	31324734	31324484	31324484	Nonsense_Mutation	G	C	p.Y108*
SUPHD1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31323944	31324734	31324642	31324642	Nonsense_Mutation	G	A	p.Q56*
SUPHD1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	31324465	31324734	31324642	31324642	Nonsense_Mutation	G	A	p.Q56*

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for HLA-B

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HLA-B

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HLA-B

Top

RelatedDrugs for HLA-B

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for HLA-B

Diseases associated with this gene.
(DisGeNet 4.0)

Gene	Disease ID	Disease name	# pubmeds	Source
HLA-B	C0038325	Stevens-Johnson Syndrome	9	CTD_human;ORPHANET
HLA-B	C0041755	Adverse reaction to drug	5	CTD_human
HLA-B	C0013182	Drug Allergy	4	CTD_human
HLA-B	C0033687	Proteinuria	4	CTD_human
HLA-B	C0038013	Ankylosing spondylitis	3	CTD_human
HLA-B	C0004943	Behcet Syndrome	2	CTD_human;ORPHANET
HLA-B	C0011603	Dermatitis	2	CTD_human
HLA-B	C0026896	Myasthenia Gravis	2	CTD_human
HLA-B	C0036341	Schizophrenia	2	PSYGENET
HLA-B	C0011609	Drug Eruptions	1	CTD_human
HLA-B	C0011633	Dermatomyositis	1	CTD_human
HLA-B	C0015230	Exanthema	1	CTD_human
HLA-B	C0017638	Glioma	1	CTD_human
HLA-B	C0019693	HIV Infections	1	CTD_human
HLA-B	C0020517	Hypersensitivity	1	CTD_human
HLA-B	C0027697	Nephritis	1	CTD_human
HLA-B	C0033975	Psychotic Disorders	1	PSYGENET
HLA-B	C0039103	Synovitis	1	CTD_human
HLA-B	C4277682	Chemical and Drug Induced Liver Injury	1	CTD_human

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact

Gene summary for HLA-B

Exon skipping events across known transcript of Ensembl for HLA-B from UCSC genome browser

Gene isoform structures and expression levels for HLA-B

Exon skipping events with PSIs in TCGA for HLA-B

Exon skipping events with PSIs in GTEx for HLA-B

Open reading frame (ORF) annotation in the exon skipping event for HLA-B

Infer the effects of exon skipping event on protein functional features for HLA-B

SNVs in the skipped exons for HLA-B

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for HLA-B

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HLA-B

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for HLA-B

RelatedDrugs for HLA-B

RelatedDiseases for HLA-B