ExonSkipDB: functional annotation of exon skipping event in human

Gene summary for BAZ2B

Gene summary

Gene information	Gene symbol	BAZ2B
	Gene ID	29994
	Gene name	bromodomain adjacent to zinc finger domain 2B
	Synonyms	WALp4
	Cytomap	2q24.2
	Type of gene	protein-coding
	Description	bromodomain adjacent to zinc finger domain protein 2B
	Modification date	20180519
	UniProtAcc	Q9UIF8
	Context	PubMed: BAZ2B [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID)

Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Gene

GO ID

GO term

PubMed ID

Top

Exon skipping events across known transcript of Ensembl for BAZ2B from UCSC genome browser

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Gene isoform structures and expression levels for BAZ2B

Expression levels of gene isoforms across TCGA.

Expression levels of gene isoforms across GTEx.

Top

Exon skipping events with PSIs in TCGA for BAZ2B

Information of exkip skipping event in TCGA.

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_344262	2	160175489:160176929:160181321:160181465:160182163:160182429	160181321:160181465	ENSG00000123636.13	ENST00000343439.5,ENST00000392782.1,ENST00000355831.2,ENST00000392783.2
exon_skip_344263	2	160181321:160181465:160182163:160182429:160189050:160189197	160182163:160182429	ENSG00000123636.13	ENST00000343439.5,ENST00000392782.1,ENST00000548440.1,ENST00000355831.2,ENST00000392783.2
exon_skip_344266	2	160189050:160189197:160193452:160193588:160194077:160194283	160193452:160193588	ENSG00000123636.13	ENST00000343439.5,ENST00000392782.1,ENST00000355831.2,ENST00000392783.2
exon_skip_344270	2	160252279:160252345:160253584:160253611:160253855:160253893	160253584:160253611	ENSG00000123636.13	ENST00000294905.4
exon_skip_344271	2	160253855:160253900:160255339:160255405:160257109:160257161	160255339:160255405	ENSG00000123636.13	ENST00000294905.4,ENST00000343439.5,ENST00000392782.1,ENST00000355831.2,ENST00000392783.2
exon_skip_344274	2	160255339:160255405:160257109:160257175:160261359:160261421	160257109:160257175	ENSG00000123636.13	ENST00000343439.5,ENST00000392782.1,ENST00000355831.2,ENST00000392783.2
exon_skip_344276	2	160268942:160269056:160284451:160284553:160284821:160284930	160284451:160284553	ENSG00000123636.13	ENST00000343439.5,ENST00000441143.1,ENST00000392783.2,ENST00000472953.1
exon_skip_344277	2	160285710:160285771:160287373:160287667:160289267:160289461	160287373:160287667	ENSG00000123636.13	ENST00000392782.1,ENST00000355831.2,ENST00000392783.2,ENST00000472953.1
exon_skip_344281	2	160303346:160303486:160304752:160304914:160310123:160310312	160304752:160304914	ENSG00000123636.13	ENST00000343439.5,ENST00000392782.1,ENST00000482503.1
exon_skip_344283	2	160303346:160303486:160304752:160304920:160310123:160310312	160304752:160304920	ENSG00000123636.13	ENST00000355831.2,ENST00000392783.2
exon_skip_344284	2	160303346:160303486:160304752:160304920:160335085:160335232	160304752:160304920	ENSG00000123636.13	ENST00000467184.1
exon_skip_344288	2	160304752:160304914:160310123:160310312:160335085:160335232	160310123:160310312	ENSG00000123636.13	ENST00000343439.5,ENST00000392782.1,ENST00000482503.1
exon_skip_344289	2	160304826:160304920:160310123:160310312:160335085:160335232	160310123:160310312	ENSG00000123636.13	ENST00000437839.1,ENST00000355831.2,ENST00000392783.2
exon_skip_344291	2	160310123:160310312:160335085:160335232:160412333:160412375	160335085:160335232	ENSG00000123636.13	ENST00000343439.5,ENST00000437839.1,ENST00000392782.1,ENST00000355831.2,ENST00000392783.2
exon_skip_344294	2	160335085:160335232:160412333:160412376:160471904:160471935	160412333:160412376	ENSG00000123636.13	ENST00000437839.1
exon_skip_344295	2	160335085:160335232:160412333:160412376:160472752:160472961	160412333:160412376	ENSG00000123636.13	ENST00000343439.5,ENST00000483316.1,ENST00000541068.2,ENST00000355831.2,ENST00000392783.2

PSI values of skipped exons in TCGA.

Top

Exon skipping events with PSIs in GTEx for BAZ2B

Information of exkip skipping event in GTEx

Exon skip ID	chr	Exons involved in exon skipping	Skipped exon	ENSG	ENSTs
exon_skip_344262	2	160175489:160176929:160181321:160181465:160182163:160182429	160181321:160181465	ENSG00000123636.13	ENST00000392782.1,ENST00000392783.2,ENST00000355831.2,ENST00000343439.5
exon_skip_344263	2	160181321:160181465:160182163:160182429:160189050:160189197	160182163:160182429	ENSG00000123636.13	ENST00000392782.1,ENST00000392783.2,ENST00000355831.2,ENST00000343439.5,ENST00000548440.1
exon_skip_344266	2	160189050:160189197:160193452:160193588:160194077:160194283	160193452:160193588	ENSG00000123636.13	ENST00000392782.1,ENST00000392783.2,ENST00000355831.2,ENST00000343439.5
exon_skip_344270	2	160252279:160252345:160253584:160253611:160253855:160253893	160253584:160253611	ENSG00000123636.13	ENST00000294905.4
exon_skip_344271	2	160253855:160253900:160255339:160255405:160257109:160257161	160255339:160255405	ENSG00000123636.13	ENST00000392782.1,ENST00000392783.2,ENST00000355831.2,ENST00000343439.5,ENST00000294905.4
exon_skip_344274	2	160255339:160255405:160257109:160257175:160261359:160261421	160257109:160257175	ENSG00000123636.13	ENST00000392782.1,ENST00000392783.2,ENST00000355831.2,ENST00000343439.5
exon_skip_344276	2	160268942:160269056:160284451:160284553:160284821:160284930	160284451:160284553	ENSG00000123636.13	ENST00000392783.2,ENST00000343439.5,ENST00000472953.1,ENST00000441143.1
exon_skip_344277	2	160285710:160285771:160287373:160287667:160289267:160289461	160287373:160287667	ENSG00000123636.13	ENST00000392782.1,ENST00000392783.2,ENST00000355831.2,ENST00000472953.1
exon_skip_344281	2	160303346:160303486:160304752:160304914:160310123:160310312	160304752:160304914	ENSG00000123636.13	ENST00000392782.1,ENST00000343439.5,ENST00000482503.1
exon_skip_344283	2	160303346:160303486:160304752:160304920:160310123:160310312	160304752:160304920	ENSG00000123636.13	ENST00000392783.2,ENST00000355831.2
exon_skip_344284	2	160303346:160303486:160304752:160304920:160335085:160335232	160304752:160304920	ENSG00000123636.13	ENST00000467184.1
exon_skip_344288	2	160304752:160304914:160310123:160310312:160335085:160335232	160310123:160310312	ENSG00000123636.13	ENST00000392782.1,ENST00000343439.5,ENST00000482503.1
exon_skip_344289	2	160304826:160304920:160310123:160310312:160335085:160335232	160310123:160310312	ENSG00000123636.13	ENST00000392783.2,ENST00000355831.2,ENST00000437839.1
exon_skip_344291	2	160310123:160310312:160335085:160335232:160412333:160412375	160335085:160335232	ENSG00000123636.13	ENST00000392782.1,ENST00000392783.2,ENST00000355831.2,ENST00000343439.5,ENST00000437839.1
exon_skip_344294	2	160335085:160335232:160412333:160412376:160471904:160471935	160412333:160412376	ENSG00000123636.13	ENST00000437839.1
exon_skip_344295	2	160335085:160335232:160412333:160412376:160472752:160472961	160412333:160412376	ENSG00000123636.13	ENST00000392783.2,ENST00000355831.2,ENST00000343439.5,ENST00000541068.2,ENST00000483316.1

PSI values of skipped exons in GTEx.

* Skipped exon sequences.

Top

Open reading frame (ORF) annotation in the exon skipping event for BAZ2B

Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000392783	160335085	160335232	3UTR-3CDS
ENST00000392783	160412333	160412376	3UTR-3UTR
ENST00000392783	160182163	160182429	Frame-shift
ENST00000392783	160193452	160193588	Frame-shift
ENST00000392783	160181321	160181465	In-frame
ENST00000392783	160255339	160255405	In-frame
ENST00000392783	160257109	160257175	In-frame
ENST00000392783	160284451	160284553	In-frame
ENST00000392783	160287373	160287667	In-frame
ENST00000392783	160304752	160304920	In-frame
ENST00000392783	160310123	160310312	In-frame

Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms.

ENST	Start of skipped exon	End of skipped exon	ORF
ENST00000392783	160335085	160335232	3UTR-3CDS
ENST00000392783	160412333	160412376	3UTR-3UTR
ENST00000392783	160182163	160182429	Frame-shift
ENST00000392783	160193452	160193588	Frame-shift
ENST00000392783	160181321	160181465	In-frame
ENST00000392783	160255339	160255405	In-frame
ENST00000392783	160257109	160257175	In-frame
ENST00000392783	160284451	160284553	In-frame
ENST00000392783	160287373	160287667	In-frame
ENST00000392783	160304752	160304920	In-frame
ENST00000392783	160310123	160310312	In-frame

Top

Infer the effects of exon skipping event on protein functional features for BAZ2B

Exon skipping at the protein sequence level and followed lost functional features.
* Click on the image to enlarge it in a new window.

Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000392783	8306	2168	160310123	160310312	642	830	48	111
ENST00000392783	8306	2168	160304752	160304920	831	998	111	167
ENST00000392783	8306	2168	160287373	160287667	2397	2690	633	731
ENST00000392783	8306	2168	160284451	160284553	2861	2962	788	822
ENST00000392783	8306	2168	160257109	160257175	3329	3394	944	966
ENST00000392783	8306	2168	160255339	160255405	3395	3460	966	988
ENST00000392783	8306	2168	160181321	160181465	6706	6849	2070	2117

Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases.

ENST	Length of mRNA	Length of AA seq.	Genomic start	Genomic end	mRNA start	mRNA end	AA start	AA end
ENST00000392783	8306	2168	160310123	160310312	642	830	48	111
ENST00000392783	8306	2168	160304752	160304920	831	998	111	167
ENST00000392783	8306	2168	160287373	160287667	2397	2690	633	731
ENST00000392783	8306	2168	160284451	160284553	2861	2962	788	822
ENST00000392783	8306	2168	160257109	160257175	3329	3394	944	966
ENST00000392783	8306	2168	160255339	160255405	3395	3460	966	988
ENST00000392783	8306	2168	160181321	160181465	6706	6849	2070	2117

Lost protein functional features of individual exon skipping events in TCGA.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q9UIF8	48	111	1	196	Alternative sequence	ID=VSP_037114;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:10662543;Dbxref=PMID:10662543
Q9UIF8	48	111	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	48	111	71	71	Natural variant	ID=VAR_055549;Note=M->T;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:17974005;Dbxref=dbSNP:rs10202670,PMID:17974005
Q9UIF8	48	111	95	95	Sequence conflict	Note=L->G;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q9UIF8	111	167	1	196	Alternative sequence	ID=VSP_037114;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:10662543;Dbxref=PMID:10662543
Q9UIF8	111	167	112	113	Alternative sequence	ID=VSP_037115;Note=In isoform 2 and isoform 5. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303\|PubMed:10819331,ECO:0000303\|PubMed:15489334;Dbxref=PMID:10819331,PMID:15489334
Q9UIF8	111	167	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	111	167	149	265	Compositional bias	Note=Ser-rich
Q9UIF8	633	731	633	730	Alternative sequence	ID=VSP_000553;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:15489334;Dbxref=PMID:15489334
Q9UIF8	633	731	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	633	731	595	666	Compositional bias	Note=Asp/Glu-rich (acidic)
Q9UIF8	633	731	702	702	Natural variant	ID=VAR_055552;Note=G->V;Dbxref=dbSNP:rs2302924
Q9UIF8	788	822	789	822	Alternative sequence	ID=VSP_000554;Note=In isoform 3 and isoform 5. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303\|PubMed:10819331,ECO:0000303\|PubMed:14702039;Dbxref=PMID:10819331,PMID:14702039
Q9UIF8	788	822	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	788	822	739	810	Domain	Note=MBD;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00338
Q9UIF8	944	966	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	944	966	883	1061	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q9UIF8	944	966	902	1061	Compositional bias	Note=Lys-rich
Q9UIF8	966	988	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	966	988	883	1061	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q9UIF8	966	988	902	1061	Compositional bias	Note=Lys-rich
Q9UIF8	966	988	986	986	Sequence conflict	Note=R->Q;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q9UIF8	2070	2117	2094	2096	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2E7O
Q9UIF8	2070	2117	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	2070	2117	2077	2147	Domain	Note=Bromo;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00035
Q9UIF8	2070	2117	2065	2078	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2080	2082	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PE8
Q9UIF8	2070	2117	2083	2085	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2097	2100	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2107	2115	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2091	2093	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1

Lost protein functional features of individual exon skipping events in GTEx.

UniProt acc.	Start of exon skipping (AA)	End of exon skipping (AA)	Protein feature start (AA)	Protein feature end (AA)	Category of protein feature	Description of feature
Q9UIF8	48	111	1	196	Alternative sequence	ID=VSP_037114;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:10662543;Dbxref=PMID:10662543
Q9UIF8	48	111	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	48	111	71	71	Natural variant	ID=VAR_055549;Note=M->T;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:17974005;Dbxref=dbSNP:rs10202670,PMID:17974005
Q9UIF8	48	111	95	95	Sequence conflict	Note=L->G;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q9UIF8	111	167	1	196	Alternative sequence	ID=VSP_037114;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:10662543;Dbxref=PMID:10662543
Q9UIF8	111	167	112	113	Alternative sequence	ID=VSP_037115;Note=In isoform 2 and isoform 5. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303\|PubMed:10819331,ECO:0000303\|PubMed:15489334;Dbxref=PMID:10819331,PMID:15489334
Q9UIF8	111	167	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	111	167	149	265	Compositional bias	Note=Ser-rich
Q9UIF8	633	731	633	730	Alternative sequence	ID=VSP_000553;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303\|PubMed:15489334;Dbxref=PMID:15489334
Q9UIF8	633	731	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	633	731	595	666	Compositional bias	Note=Asp/Glu-rich (acidic)
Q9UIF8	633	731	702	702	Natural variant	ID=VAR_055552;Note=G->V;Dbxref=dbSNP:rs2302924
Q9UIF8	788	822	789	822	Alternative sequence	ID=VSP_000554;Note=In isoform 3 and isoform 5. Missing;Ontology_term=ECO:0000303,ECO:0000303;evidence=ECO:0000303\|PubMed:10819331,ECO:0000303\|PubMed:14702039;Dbxref=PMID:10819331,PMID:14702039
Q9UIF8	788	822	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	788	822	739	810	Domain	Note=MBD;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00338
Q9UIF8	944	966	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	944	966	883	1061	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q9UIF8	944	966	902	1061	Compositional bias	Note=Lys-rich
Q9UIF8	966	988	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	966	988	883	1061	Coiled coil	Ontology_term=ECO:0000255;evidence=ECO:0000255
Q9UIF8	966	988	902	1061	Compositional bias	Note=Lys-rich
Q9UIF8	966	988	986	986	Sequence conflict	Note=R->Q;Ontology_term=ECO:0000305;evidence=ECO:0000305
Q9UIF8	2070	2117	2094	2096	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:2E7O
Q9UIF8	2070	2117	1	2168	Chain	ID=PRO_0000211174;Note=Bromodomain adjacent to zinc finger domain protein 2B
Q9UIF8	2070	2117	2077	2147	Domain	Note=Bromo;Ontology_term=ECO:0000255;evidence=ECO:0000255\|PROSITE-ProRule:PRU00035
Q9UIF8	2070	2117	2065	2078	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2080	2082	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PE8
Q9UIF8	2070	2117	2083	2085	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2097	2100	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2107	2115	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1
Q9UIF8	2070	2117	2091	2093	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5PG1

Top

SNVs in the skipped exons for BAZ2B

- Lollipop plot for presenting exon skipping associated SNVs.
* Click on the image to enlarge it in a new window.

- Differential PSIs between mutated versus non-mutated samples.

BAZ2B_HNSC_exon_skip_344274_psi_boxplot.png
boxplot

BAZ2B_SKCM_exon_skip_344274_psi_boxplot.png
boxplot

- Non-synonymous mutations located in the skipped exons in TCGA.

Cancer type	Sample	ESID	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
UCEC	TCGA-B5-A11G-01	exon_skip_344262	160181322	160181465	160181443	160181481	Frame_Shift_Del	TTTCCATTTCAGTCAGAATCATACTAAAGAAAATAATGT	-	p.M2071fs
LIHC	TCGA-DD-A39Y-01	exon_skip_344263	160182164	160182429	160182380	160182380	Frame_Shift_Del	T	-	p.K1998fs
LIHC	TCGA-DD-A3A0-01	exon_skip_344263	160182164	160182429	160182380	160182380	Frame_Shift_Del	T	-	p.K1998fs
LIHC	TCGA-DD-A1EG-01	exon_skip_344274	160257110	160257175	160257151	160257151	Frame_Shift_Del	T	-	p.I953fs
LIHC	TCGA-DD-A39Y-01	exon_skip_344274	160257110	160257175	160257151	160257151	Frame_Shift_Del	T	-	p.I953fs
LIHC	TCGA-DD-A3A0-01	exon_skip_344274	160257110	160257175	160257160	160257160	Frame_Shift_Del	T	-	p.I950fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_344274	160257110	160257175	160257169	160257169	Frame_Shift_Del	T	-	p.I947fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_344276	160284452	160284553	160284493	160284493	Frame_Shift_Del	T	-	p.I809fs
LIHC	TCGA-DD-A1EG-01	exon_skip_344277	160287374	160287667	160287417	160287417	Frame_Shift_Del	A	-	p.F717fs
LIHC	TCGA-DD-A3A0-01	exon_skip_344288 exon_skip_344289	160310124	160310312	160310128	160310128	Frame_Shift_Del	A	-	p.F110fs
LIHC	TCGA-G3-A3CJ-01	exon_skip_344288 exon_skip_344289	160310124	160310312	160310203	160310203	Frame_Shift_Del	C	-	p.G85fs
BRCA	TCGA-AR-A1AR-01	exon_skip_344262	160181322	160181465	160181323	160181323	Nonsense_Mutation	G	A	p.Q2118*
CESC	TCGA-IR-A3LA-01	exon_skip_344262	160181322	160181465	160181437	160181437	Nonsense_Mutation	C	A	p.E2080*
STAD	TCGA-HU-A4H3-01	exon_skip_344263	160182164	160182429	160182228	160182228	Nonsense_Mutation	G	A	p.Q2049*
STAD	TCGA-HU-A4H3-01	exon_skip_344263	160182164	160182429	160182228	160182228	Nonsense_Mutation	G	A	p.Q2049X
UCEC	TCGA-AX-A05Z-01	exon_skip_344266	160193453	160193588	160193466	160193466	Nonsense_Mutation	G	T	p.S1928*
UCEC	TCGA-BS-A0TC-01	exon_skip_344271	160255340	160255405	160255348	160255348	Nonsense_Mutation	G	A	p.R986*
BLCA	TCGA-BT-A2LB-01	exon_skip_344274	160257110	160257175	160257124	160257124	Nonsense_Mutation	G	A	p.Q962*
HNSC	TCGA-CR-7370-01	exon_skip_344274	160257110	160257175	160257124	160257124	Nonsense_Mutation	G	A	p.Q962*
SKCM	TCGA-OD-A75X-06	exon_skip_344274	160257110	160257175	160257130	160257130	Nonsense_Mutation	G	A	p.R960*
LUSC	TCGA-33-4566-01	exon_skip_344281	160304753	160304914	160304783	160304783	Nonsense_Mutation	C	A	p.G158*
LUSC	TCGA-33-4566-01	exon_skip_344284 exon_skip_344283	160304753	160304920	160304783	160304783	Nonsense_Mutation	C	A	p.G158*
STAD	TCGA-BR-4184-01	exon_skip_344281	160304753	160304914	160304907	160304907	Nonsense_Mutation	C	T	p.W116*
STAD	TCGA-BR-4184-01	exon_skip_344284 exon_skip_344283	160304753	160304920	160304907	160304907	Nonsense_Mutation	C	T	p.W116*
BLCA	TCGA-ZF-A9R4-01	exon_skip_344288 exon_skip_344289	160310124	160310312	160310286	160310286	Nonsense_Mutation	G	A	p.Q58*
LIHC	TCGA-DD-AAD0-01	exon_skip_344274	160257110	160257175	160257109	160257109	Splice_Site	C	A	.

- Depth of coverage in the three exons composing exon skipping event

Depth of coverage in three exons	Mutation description
	Sample: TCGA-CR-7370-01
	Cancer type: HNSC
	ESID: exon_skip_344274
	Skipped exon start: 160257110
	Skipped exon end: 160257175
	Mutation start: 160257124
	Mutation end: 160257124
	Mutation type: Nonsense_Mutation
	Reference seq: G
	Mutation seq: A
	AAchange: p.Q962*
exon_skip_344274_HNSC_TCGA-CR-7370-01.png
exon_skip_367235_HNSC_TCGA-CR-7370-01.png
exon_skip_389215_HNSC_TCGA-CR-7370-01.png
	Sample: TCGA-OD-A75X-06
	Cancer type: SKCM
	ESID: exon_skip_344274
	Skipped exon start: 160257110
	Skipped exon end: 160257175
	Mutation start: 160257130
	Mutation end: 160257130
	Mutation type: Nonsense_Mutation
	Reference seq: G
	Mutation seq: A
	AAchange: p.R960*
exon_skip_344274_SKCM_TCGA-OD-A75X-06.png
exon_skip_346524_SKCM_TCGA-OD-A75X-06.png

- Non-synonymous mutations located in the skipped exons in CCLE.

Sample	Skipped exon start	Skipped exon end	Mutation start	Mutation end	Mutation type	Reference seq	Mutation seq	AAchange
SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160182164	160182429	160182261	160182262	Frame_Shift_Del	TT	-	p.KM2037fs
TM31_CENTRAL_NERVOUS_SYSTEM	160181322	160181465	160181369	160181369	Missense_Mutation	C	A	p.K2102N
CROAP2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160181322	160181465	160181377	160181377	Missense_Mutation	C	T	p.V2100I
NCIH510_LUNG	160182164	160182429	160182195	160182195	Missense_Mutation	T	C	p.R2060G
HS934T_FIBROBLAST	160182164	160182429	160182231	160182231	Missense_Mutation	T	C	p.K2048E
MDAMB453_BREAST	160182164	160182429	160182317	160182317	Missense_Mutation	G	C	p.S2019C
SNU81_LARGE_INTESTINE	160182164	160182429	160182401	160182401	Missense_Mutation	T	G	p.K1991T
JHUEM7_ENDOMETRIUM	160193453	160193588	160193479	160193479	Missense_Mutation	C	G	p.A1924P
BICR18_UPPER_AERODIGESTIVE_TRACT	160193453	160193588	160193487	160193487	Missense_Mutation	T	C	p.K1921R
NCIH1299_LUNG	160255340	160255405	160255364	160255364	Missense_Mutation	T	A	p.L980F
A388_SKIN	160255340	160255405	160255391	160255391	Missense_Mutation	C	G	p.K971N
TC205_BONE	160257110	160257175	160257142	160257142	Missense_Mutation	C	G	p.E956Q
RMUGS_OVARY	160284452	160284553	160284486	160284486	Missense_Mutation	A	G	p.V811A
HEC6_ENDOMETRIUM	160284452	160284553	160284507	160284507	Missense_Mutation	C	T	p.S804N
GMEL_SKIN	160287374	160287667	160287455	160287455	Missense_Mutation	G	A	p.P705S
MDAMB415_BREAST	160287374	160287667	160287458	160287458	Missense_Mutation	C	T	p.A704T
HCT15_LARGE_INTESTINE	160287374	160287667	160287464	160287464	Missense_Mutation	C	A	p.G702C
GCT_SOFT_TISSUE	160287374	160287667	160287562	160287562	Missense_Mutation	G	A	p.S669L
HEC265_ENDOMETRIUM	160287374	160287667	160287618	160287618	Missense_Mutation	A	T	p.D650E
NCIH661_LUNG	160304753	160304920	160304813	160304813	Missense_Mutation	C	A	p.D148Y
NCIH661_LUNG	160304753	160304914	160304813	160304813	Missense_Mutation	C	A	p.D148Y
HCC2998_LARGE_INTESTINE	160304753	160304920	160304836	160304836	Missense_Mutation	A	C	p.F140C
HCC2998_LARGE_INTESTINE	160304753	160304914	160304836	160304836	Missense_Mutation	A	C	p.F140C
OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160304753	160304920	160304846	160304846	Missense_Mutation	G	A	p.P137S
OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160304753	160304914	160304846	160304846	Missense_Mutation	G	A	p.P137S
MET2B	160304753	160304920	160304863	160304863	Missense_Mutation	G	A	p.P131L
MET2B	160304753	160304914	160304863	160304863	Missense_Mutation	G	A	p.P131L
K562_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160304753	160304920	160304865	160304865	Missense_Mutation	A	C	p.F130L
K562_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160304753	160304914	160304865	160304865	Missense_Mutation	A	C	p.F130L
HEC59_ENDOMETRIUM	160304753	160304920	160304884	160304884	Missense_Mutation	C	T	p.R124H
HEC59_ENDOMETRIUM	160304753	160304914	160304884	160304884	Missense_Mutation	C	T	p.R124H
BICR18_UPPER_AERODIGESTIVE_TRACT	160310124	160310312	160310136	160310136	Missense_Mutation	C	T	p.A108T
OC316_OVARY	160310124	160310312	160310214	160310214	Missense_Mutation	C	T	p.A82T
OC314_OVARY	160310124	160310312	160310214	160310214	Missense_Mutation	C	T	p.A82T
BICR18_UPPER_AERODIGESTIVE_TRACT	160310124	160310312	160310231	160310231	Missense_Mutation	A	C	p.V76G
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160310124	160310312	160310231	160310231	Missense_Mutation	A	C	p.V76G
S117_SOFT_TISSUE	160310124	160310312	160310231	160310231	Missense_Mutation	A	C	p.V76G
DG75_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160310124	160310312	160310237	160310237	Missense_Mutation	T	C	p.H74R
BICR18_UPPER_AERODIGESTIVE_TRACT	160310124	160310312	160310244	160310244	Missense_Mutation	C	G	p.V72L
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160310124	160310312	160310244	160310244	Missense_Mutation	C	G	p.V72L
S117_SOFT_TISSUE	160310124	160310312	160310244	160310244	Missense_Mutation	C	G	p.V72L
BICR18_UPPER_AERODIGESTIVE_TRACT	160310124	160310312	160310262	160310262	Missense_Mutation	A	G	p.S66P
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160310124	160310312	160310262	160310262	Missense_Mutation	A	G	p.S66P
KYSE410_OESOPHAGUS	160310124	160310312	160310270	160310270	Missense_Mutation	G	C	p.S63C
BICR18_UPPER_AERODIGESTIVE_TRACT	160310124	160310312	160310298	160310298	Missense_Mutation	T	C	p.T54A
DAUDI_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE	160310124	160310312	160310298	160310298	Missense_Mutation	T	C	p.T54A
JHOS2_OVARY	160335086	160335232	160335098	160335098	Missense_Mutation	T	C	p.I45V
MIAPACA2_PANCREAS	160335086	160335232	160335136	160335136	Missense_Mutation	C	G	p.G32A
HS172T_FIBROBLAST	160335086	160335232	160335149	160335149	Missense_Mutation	C	T	p.V28I
TC106_BONE	160335086	160335232	160335154	160335154	Missense_Mutation	G	C	p.A26G
SNU1040_LARGE_INTESTINE	160335086	160335232	160335163	160335163	Missense_Mutation	G	T	p.P23H
NCIH69_LUNG	160257110	160257175	160257130	160257130	Nonsense_Mutation	G	A	p.R960*
CW2_LARGE_INTESTINE	160304753	160304920	160304879	160304879	Nonsense_Mutation	C	A	p.G126*
CW2_LARGE_INTESTINE	160304753	160304914	160304879	160304879	Nonsense_Mutation	C	A	p.G126*
HEC108_ENDOMETRIUM	160181322	160181465	160181323	160181323	Splice_Site	G	A	p.Q2118*
RKO_LARGE_INTESTINE	160284452	160284553	160284553	160284553	Splice_Site	A	G	p.Y789H

Top

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for BAZ2B

sQTL information located at the skipped exons.

Exon skip ID

Chromosome

Three exons

Skippped exon

ENST

Cancer type

SNP id

Location

DNA change (ref/var)

P-value

Top

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BAZ2B

Top

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BAZ2B

Top

RelatedDrugs for BAZ2B

Approved drugs targeting this gene.
(DrugBank Version 5.1.0 2018-04-02)

Gene

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

RelatedDiseases for BAZ2B

Diseases associated with this gene.
(DisGeNet 4.0)

Gene

Disease ID

Disease name

# pubmeds

Source

	Gene summary
	Gene structures and expression levels
	Exon skipping events with PSIs in TCGA
	Exon skipping events with PSIs in GTEx
	Open reading frame (ORF) annotation in the exon skipping event
	Exon skipping events in the canonical protein sequence
	SNVs in the skipped exons with depth of coverage
	Splicing Quantitative Trait Loci (sQTLs) in the skipped exons
	Splicing Quantitative Trait Methylation (sQTM) in the skipped exon
	Related drugs with this gene
	Related diseases with this gene

Home

Download

Statistics

Landscape

Help

Contact

Gene summary for BAZ2B

Exon skipping events across known transcript of Ensembl for BAZ2B from UCSC genome browser

Gene isoform structures and expression levels for BAZ2B

Exon skipping events with PSIs in TCGA for BAZ2B

Exon skipping events with PSIs in GTEx for BAZ2B

Open reading frame (ORF) annotation in the exon skipping event for BAZ2B

Infer the effects of exon skipping event on protein functional features for BAZ2B

SNVs in the skipped exons for BAZ2B

Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for BAZ2B

Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BAZ2B

Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for BAZ2B

RelatedDrugs for BAZ2B

RelatedDiseases for BAZ2B