|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for DONSON |
 Gene summary |
| Gene information | Gene symbol | DONSON | Gene ID | 29980 |
| Gene name | downstream neighbor of SON | |
| Synonyms | B17|C21orf60|MIMIS|MISSLA | |
| Cytomap | 21q22.11 | |
| Type of gene | protein-coding | |
| Description | protein downstream neighbor of Son | |
| Modification date | 20180523 | |
| UniProtAcc | Q9NYP3 | |
| Context | PubMed: DONSON [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for DONSON from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for DONSON |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for DONSON |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_361723 | 21 | 34950547:34950750:34951655:34951723:34953607:34953693 | 34951655:34951723 | ENSG00000159147.13 | ENST00000453626.1 |
| exon_skip_361725 | 21 | 34950547:34950750:34951655:34951868:34953607:34953693 | 34951655:34951868 | ENSG00000159147.13 | ENST00000457359.1,ENST00000442660.1,ENST00000303071.5,ENST00000303113.6,ENST00000417871.1,ENST00000437395.1 |
| exon_skip_361727 | 21 | 34954256:34954361:34954470:34954552:34955793:34955972 | 34954470:34954552 | ENSG00000159147.13 | ENST00000453626.1,ENST00000457359.1,ENST00000303071.5,ENST00000303113.6,ENST00000432378.1,ENST00000437395.1 |
| exon_skip_361728 | 21 | 34954256:34954361:34954470:34954552:34956895:34957074 | 34954470:34954552 | ENSG00000159147.13 | ENST00000442660.1,ENST00000417871.1 |
| exon_skip_361730 | 21 | 34954470:34954552:34955793:34955972:34956895:34957074 | 34955793:34955972 | ENSG00000159147.13 | ENST00000453626.1,ENST00000303071.5,ENST00000303113.6,ENST00000432378.1,ENST00000437395.1 |
| exon_skip_361731 | 21 | 34955793:34955972:34956895:34957032:34958283:34958487 | 34956895:34957032 | ENSG00000159147.13 | ENST00000303113.6 |
| exon_skip_361732 | 21 | 34955793:34955972:34956895:34957074:34958283:34958487 | 34956895:34957074 | ENSG00000159147.13 | ENST00000453626.1,ENST00000303071.5,ENST00000432378.1,ENST00000437395.1 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for DONSON |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_361723 | 21 | 34950547:34950750:34951655:34951723:34953607:34953693 | 34951655:34951723 | ENSG00000159147.13 | ENST00000453626.1 |
| exon_skip_361725 | 21 | 34950547:34950750:34951655:34951868:34953607:34953693 | 34951655:34951868 | ENSG00000159147.13 | ENST00000303113.6,ENST00000457359.1,ENST00000303071.5,ENST00000417871.1,ENST00000442660.1,ENST00000437395.1 |
| exon_skip_361727 | 21 | 34954256:34954361:34954470:34954552:34955793:34955972 | 34954470:34954552 | ENSG00000159147.13 | ENST00000303113.6,ENST00000453626.1,ENST00000457359.1,ENST00000303071.5,ENST00000437395.1,ENST00000432378.1 |
| exon_skip_361728 | 21 | 34954256:34954361:34954470:34954552:34956895:34957074 | 34954470:34954552 | ENSG00000159147.13 | ENST00000417871.1,ENST00000442660.1 |
| exon_skip_361730 | 21 | 34954470:34954552:34955793:34955972:34956895:34957074 | 34955793:34955972 | ENSG00000159147.13 | ENST00000303113.6,ENST00000453626.1,ENST00000303071.5,ENST00000437395.1,ENST00000432378.1 |
| exon_skip_361731 | 21 | 34955793:34955972:34956895:34957032:34958283:34958487 | 34956895:34957032 | ENSG00000159147.13 | ENST00000303113.6 |
| exon_skip_361732 | 21 | 34955793:34955972:34956895:34957074:34958283:34958487 | 34956895:34957074 | ENSG00000159147.13 | ENST00000453626.1,ENST00000303071.5,ENST00000437395.1,ENST00000432378.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for DONSON |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000303071 | 34954470 | 34954552 | Frame-shift |
| ENST00000303071 | 34955793 | 34955972 | Frame-shift |
| ENST00000303071 | 34956895 | 34957074 | Frame-shift |
| ENST00000303071 | 34951655 | 34951868 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000303071 | 34954470 | 34954552 | Frame-shift |
| ENST00000303071 | 34955793 | 34955972 | Frame-shift |
| ENST00000303071 | 34956895 | 34957074 | Frame-shift |
| ENST00000303071 | 34951655 | 34951868 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for DONSON |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000303071 | 2187 | 566 | 34951655 | 34951868 | 1418 | 1630 | 450 | 521 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000303071 | 2187 | 566 | 34951655 | 34951868 | 1418 | 1630 | 450 | 521 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9NYP3 | 450 | 521 | 264 | 566 | Alternative sequence | ID=VSP_004193;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:10773462;Dbxref=PMID:10773462 |
| Q9NYP3 | 450 | 521 | 266 | 566 | Alternative sequence | ID=VSP_004195;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:10773462;Dbxref=PMID:10773462 |
| Q9NYP3 | 450 | 521 | 1 | 566 | Chain | ID=PRO_0000079979;Note=Protein downstream neighbor of Son |
| Q9NYP3 | 450 | 521 | 293 | 566 | Natural variant | ID=VAR_079334;Note=In MISSLA. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=PMID:28191891 |
| Q9NYP3 | 450 | 521 | 419 | 566 | Natural variant | ID=VAR_079336;Note=In MISSLA. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=PMID:28191891 |
| Q9NYP3 | 450 | 521 | 428 | 566 | Natural variant | ID=VAR_079337;Note=In MISSLA. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=PMID:28191891 |
| Q9NYP3 | 450 | 521 | 489 | 489 | Natural variant | ID=VAR_079340;Note=In MISSLA%3B unknown pathological significance%3B reduced protein level%3B no effect on nuclear localization%3B does not complement loss of endogenous DONSON when tested for the rescue of the spontaneous fork stalling observed after DON |
| Q9NYP3 | 450 | 521 | 504 | 504 | Natural variant | ID=VAR_079341;Note=In MISSLA. E->K;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=dbSNP:rs374688527,PMID:28191891 |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q9NYP3 | 450 | 521 | 264 | 566 | Alternative sequence | ID=VSP_004193;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:10773462;Dbxref=PMID:10773462 |
| Q9NYP3 | 450 | 521 | 266 | 566 | Alternative sequence | ID=VSP_004195;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:10773462;Dbxref=PMID:10773462 |
| Q9NYP3 | 450 | 521 | 1 | 566 | Chain | ID=PRO_0000079979;Note=Protein downstream neighbor of Son |
| Q9NYP3 | 450 | 521 | 293 | 566 | Natural variant | ID=VAR_079334;Note=In MISSLA. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=PMID:28191891 |
| Q9NYP3 | 450 | 521 | 419 | 566 | Natural variant | ID=VAR_079336;Note=In MISSLA. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=PMID:28191891 |
| Q9NYP3 | 450 | 521 | 428 | 566 | Natural variant | ID=VAR_079337;Note=In MISSLA. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=PMID:28191891 |
| Q9NYP3 | 450 | 521 | 489 | 489 | Natural variant | ID=VAR_079340;Note=In MISSLA%3B unknown pathological significance%3B reduced protein level%3B no effect on nuclear localization%3B does not complement loss of endogenous DONSON when tested for the rescue of the spontaneous fork stalling observed after DON |
| Q9NYP3 | 450 | 521 | 504 | 504 | Natural variant | ID=VAR_079341;Note=In MISSLA. E->K;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28191891;Dbxref=dbSNP:rs374688527,PMID:28191891 |
Top |
SNVs in the skipped exons for DONSON |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| ESCA | TCGA-L5-A88W-01 | exon_skip_361723 | 34951656 | 34951723 | 34951684 | 34951718 | Frame_Shift_Del | CAGATGTTAAATACAGCAGTTGGCTCGTGTGGATA | - | p.501_512del |
| ESCA | TCGA-L5-A88W-01 | exon_skip_361723 | 34951656 | 34951723 | 34951684 | 34951718 | Frame_Shift_Del | CAGATGTTAAATACAGCAGTTGGCTCGTGTGGATA | - | p.CIHTSQLLYLTSA452fs |
| ESCA | TCGA-L5-A88W-01 | exon_skip_361725 | 34951656 | 34951868 | 34951684 | 34951718 | Frame_Shift_Del | CAGATGTTAAATACAGCAGTTGGCTCGTGTGGATA | - | p.501_512del |
| ESCA | TCGA-L5-A88W-01 | exon_skip_361725 | 34951656 | 34951868 | 34951684 | 34951718 | Frame_Shift_Del | CAGATGTTAAATACAGCAGTTGGCTCGTGTGGATA | - | p.CIHTSQLLYLTSA452fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_361725 | 34951656 | 34951868 | 34951815 | 34951815 | Frame_Shift_Del | A | - | p.F468fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_361730 | 34955794 | 34955972 | 34955930 | 34955930 | Frame_Shift_Del | T | - | p.K276fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_361731 | 34956896 | 34957032 | 34956960 | 34956960 | Frame_Shift_Del | T | - | p.M241fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_361732 | 34956896 | 34957074 | 34956960 | 34956960 | Frame_Shift_Del | T | - | p.M241fs |
| LIHC | TCGA-DD-A1EH-01 | exon_skip_361731 | 34956896 | 34957032 | 34956952 | 34956953 | Frame_Shift_Ins | - | C | p.G243fs |
| LIHC | TCGA-DD-A1EH-01 | exon_skip_361732 | 34956896 | 34957074 | 34956952 | 34956953 | Frame_Shift_Ins | - | C | p.G243fs |
| THYM | TCGA-X7-A8D9-01 | exon_skip_361725 | 34951656 | 34951868 | 34951771 | 34951771 | Nonsense_Mutation | G | T | p.S483X |
| BRCA | TCGA-EW-A1J5-01 | exon_skip_361725 | 34951656 | 34951868 | 34951791 | 34951791 | Nonsense_Mutation | G | C | p.S447* |
| KIRP | TCGA-SX-A7SS-01 | exon_skip_361725 | 34951656 | 34951868 | 34951869 | 34951869 | Splice_Site | C | A | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| ML1_THYROID | 34954471 | 34954552 | 34954486 | 34954486 | Missense_Mutation | C | G | p.S344T |
| MM386_SKIN | 34955794 | 34955972 | 34955832 | 34955832 | Missense_Mutation | G | A | p.P309L |
| SNU1040_LARGE_INTESTINE | 34956896 | 34957074 | 34956980 | 34956980 | Missense_Mutation | C | T | p.R234H |
| SNU1040_LARGE_INTESTINE | 34956896 | 34957032 | 34956980 | 34956980 | Missense_Mutation | C | T | p.R234H |
| SNU1040_LARGE_INTESTINE | 34956896 | 34957074 | 34956995 | 34956995 | Missense_Mutation | A | G | p.L229P |
| SNU1040_LARGE_INTESTINE | 34956896 | 34957032 | 34956995 | 34956995 | Missense_Mutation | A | G | p.L229P |
| PATU8902_PANCREAS | 34955794 | 34955972 | 34955812 | 34955812 | Nonsense_Mutation | C | A | p.E316* |
| HEC59_ENDOMETRIUM | 34956896 | 34957074 | 34956938 | 34956938 | Nonsense_Mutation | C | T | p.W248* |
| HEC59_ENDOMETRIUM | 34956896 | 34957032 | 34956938 | 34956938 | Nonsense_Mutation | C | T | p.W248* |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for DONSON |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DONSON |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for DONSON |
Top |
RelatedDrugs for DONSON |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for DONSON |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|