|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for EPHA1 |
 Gene summary |
| Gene information | Gene symbol | EPHA1 | Gene ID | 2041 |
| Gene name | EPH receptor A1 | |
| Synonyms | EPH|EPHT|EPHT1 | |
| Cytomap | 7q34-q35 | |
| Type of gene | protein-coding | |
| Description | ephrin type-A receptor 1eph tyrosine kinase 1erythropoietin-producing hepatoma amplified sequenceerythropoietin-producing hepatoma receptorhEpha1oncogene EPHsoluble EPHA1 variant 1soluble EPHA1 variant 2tyrosine-protein kinase receptor EPH | |
| Modification date | 20180523 | |
| UniProtAcc | P21709 | |
| Context | PubMed: EPHA1 [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
| EPHA1 | GO:0001954 | positive regulation of cell-matrix adhesion | 19118217 |
| EPHA1 | GO:0006469 | negative regulation of protein kinase activity | 19118217 |
| EPHA1 | GO:0007166 | cell surface receptor signaling pathway | 19118217 |
| EPHA1 | GO:0018108 | peptidyl-tyrosine phosphorylation | 12775584 |
| EPHA1 | GO:0030336 | negative regulation of cell migration | 19118217 |
| EPHA1 | GO:0034446 | substrate adhesion-dependent cell spreading | 19118217 |
| EPHA1 | GO:0043087 | regulation of GTPase activity | 19118217 |
| EPHA1 | GO:0046777 | protein autophosphorylation | 19118217 |
| EPHA1 | GO:0090630 | activation of GTPase activity | 19118217 |
Top |
Exon skipping events across known transcript of Ensembl for EPHA1 from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for EPHA1 |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for EPHA1 |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_480050 | 7 | 143091302:143091436:143091900:143092107:143092213:143092275 | 143091900:143092107 | ENSG00000146904.4 | ENST00000465208.1,ENST00000275815.3 |
| exon_skip_480054 | 7 | 143094653:143094750:143095012:143095163:143095413:143095541 | 143095012:143095163 | ENSG00000146904.4 | ENST00000488068.1,ENST00000479459.1,ENST00000275815.3 |
| exon_skip_480057 | 7 | 143095413:143095541:143095693:143096038:143096350:143096506 | 143095693:143096038 | ENSG00000146904.4 | ENST00000275815.3 |
| exon_skip_480064 | 7 | 143096743:143097146:143098416:143098698:143104703:143104743 | 143098416:143098698 | ENSG00000146904.4 | ENST00000488068.1,ENST00000275815.3 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for EPHA1 |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_480050 | 7 | 143091302:143091436:143091900:143092107:143092213:143092275 | 143091900:143092107 | ENSG00000146904.4 | ENST00000275815.3,ENST00000465208.1 |
| exon_skip_480057 | 7 | 143095413:143095541:143095693:143096038:143096350:143096506 | 143095693:143096038 | ENSG00000146904.4 | ENST00000275815.3 |
| exon_skip_480064 | 7 | 143096743:143097146:143098416:143098698:143104703:143104743 | 143098416:143098698 | ENSG00000146904.4 | ENST00000275815.3,ENST00000488068.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for EPHA1 |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
Top |
Infer the effects of exon skipping event on protein functional features for EPHA1 |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for EPHA1 |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
EPHA1_ESCA_exon_skip_480057_psi_boxplot.png |
EPHA1_HNSC_exon_skip_480057_psi_boxplot.png |
EPHA1_LUAD_exon_skip_480057_psi_boxplot.png |
EPHA1_STAD_exon_skip_480057_psi_boxplot.png |
EPHA1_UCEC_exon_skip_480057_psi_boxplot.png |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LUAD | TCGA-55-7994-01 | exon_skip_480057 | 143095694 | 143096038 | 143095772 | 143095772 | Frame_Shift_Del | C | - | p.E420fs |
| UCEC | TCGA-B5-A0JR-01 | exon_skip_480057 | 143095694 | 143096038 | 143095887 | 143095887 | Frame_Shift_Del | C | - | p.G381fs |
| UCEC | TCGA-B5-A0JZ-01 | exon_skip_480057 | 143095694 | 143096038 | 143095887 | 143095887 | Frame_Shift_Del | C | - | p.G381fs |
| THYM | TCGA-XU-A933-01 | exon_skip_480057 | 143095694 | 143096038 | 143096021 | 143096021 | Frame_Shift_Del | G | - | p.R337fs |
| HNSC | TCGA-CV-7440-01 | exon_skip_480057 | 143095694 | 143096038 | 143095840 | 143095841 | Frame_Shift_Ins | - | G | p.G397fs |
| HNSC | TCGA-CV-7440-01 | exon_skip_480057 | 143095694 | 143096038 | 143095840 | 143095841 | Frame_Shift_Ins | - | G | p.R397fs |
| ESCA | TCGA-S8-A6BW-01 | exon_skip_480057 | 143095694 | 143096038 | 143096030 | 143096031 | Frame_Shift_Ins | - | G | p.G334fs |
| SKCM | TCGA-FR-A8YC-06 | exon_skip_480057 | 143095694 | 143096038 | 143095974 | 143095974 | Nonsense_Mutation | C | T | p.W352* |
| GBM | TCGA-28-5218-01 | exon_skip_480064 | 143098417 | 143098698 | 143098437 | 143098437 | Nonsense_Mutation | G | A | p.R138* |
| KICH | TCGA-KL-8335-01 | exon_skip_480057 | 143095694 | 143096038 | 143095693 | 143095693 | Splice_Site | C | - | . |
| KICH | TCGA-KL-8335-01 | exon_skip_480057 | 143095694 | 143096038 | 143095693 | 143095693 | Splice_Site | C | - | p.E446_splice |
| STAD | TCGA-HU-A4GU-01 | exon_skip_480057 | 143095694 | 143096038 | 143096040 | 143096040 | Splice_Site | T | C | p.G331_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
 | Sample: TCGA-HU-A4GU-01 |
| Cancer type: STAD | |
| ESID: exon_skip_480057 | |
| Skipped exon start: 143095694 | |
| Skipped exon end: 143096038 | |
| Mutation start: 143096040 | |
| Mutation end: 143096040 | |
| Mutation type: Splice_Site | |
| Reference seq: T | |
| Mutation seq: C | |
| AAchange: p.G331_splice | |
exon_skip_109771_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_133402_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_133403_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_146776_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_147024_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_149455_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_335090_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_382354_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_433982_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_433985_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_437417_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_437418_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_454428_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_454431_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_454433_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_465824_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_467518_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_480057_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_485377_STAD_TCGA-HU-A4GU-01.png | |
exon_skip_500520_STAD_TCGA-HU-A4GU-01.png | |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| CW2_LARGE_INTESTINE | 143095694 | 143096038 | 143095951 | 143095951 | Frame_Shift_Del | C | - | p.G360fs |
| MHHPREB1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 143091901 | 143092107 | 143091909 | 143091909 | Missense_Mutation | C | T | p.E782K |
| LC1F_LUNG | 143091901 | 143092107 | 143091921 | 143091921 | Missense_Mutation | C | T | p.D778N |
| HCT15_LARGE_INTESTINE | 143091901 | 143092107 | 143091961 | 143091961 | Missense_Mutation | C | A | p.K764N |
| HRT18_LARGE_INTESTINE | 143091901 | 143092107 | 143091961 | 143091961 | Missense_Mutation | C | A | p.K764N |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 143091901 | 143092107 | 143092010 | 143092010 | Missense_Mutation | C | T | p.R748Q |
| TUHR10TKB_KIDNEY | 143091901 | 143092107 | 143092078 | 143092078 | Missense_Mutation | C | G | p.Q725H |
| JHH7_LIVER | 143091901 | 143092107 | 143092098 | 143092098 | Missense_Mutation | C | A | p.D719Y |
| MCC26_SKIN | 143095013 | 143095163 | 143095057 | 143095057 | Missense_Mutation | G | A | p.P524L |
| SNU601_STOMACH | 143095013 | 143095163 | 143095103 | 143095103 | Missense_Mutation | C | T | p.D509N |
| HCT15_LARGE_INTESTINE | 143095013 | 143095163 | 143095114 | 143095114 | Missense_Mutation | T | G | p.E505A |
| HRT18_LARGE_INTESTINE | 143095013 | 143095163 | 143095114 | 143095114 | Missense_Mutation | T | G | p.E505A |
| HEC151_ENDOMETRIUM | 143095013 | 143095163 | 143095154 | 143095154 | Missense_Mutation | G | A | p.R492W |
| HARA_LUNG | 143095694 | 143096038 | 143095723 | 143095723 | Missense_Mutation | G | T | p.T436N |
| SNUC1_LARGE_INTESTINE | 143095694 | 143096038 | 143095855 | 143095855 | Missense_Mutation | A | T | p.F392Y |
| HEC1B_ENDOMETRIUM | 143095694 | 143096038 | 143095936 | 143095936 | Missense_Mutation | C | T | p.R365K |
| ES1_BONE | 143095694 | 143096038 | 143095952 | 143095952 | Missense_Mutation | C | T | p.G360R |
| HEC59_ENDOMETRIUM | 143095694 | 143096038 | 143095955 | 143095955 | Missense_Mutation | C | T | p.G359R |
| DMS79_LUNG | 143098417 | 143098698 | 143098449 | 143098449 | Missense_Mutation | C | A | p.G134C |
| SNUC2A_LARGE_INTESTINE | 143098417 | 143098698 | 143098512 | 143098512 | Missense_Mutation | C | A | p.A113S |
| SNUC2B_LARGE_INTESTINE | 143098417 | 143098698 | 143098512 | 143098512 | Missense_Mutation | C | A | p.A113S |
| NCIH1975_LUNG | 143098417 | 143098698 | 143098542 | 143098542 | Missense_Mutation | C | T | p.V103M |
| HDMYZ_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 143098417 | 143098698 | 143098566 | 143098566 | Missense_Mutation | C | T | p.V95I |
| TT_THYROID | 143098417 | 143098698 | 143098586 | 143098586 | Missense_Mutation | C | T | p.R88H |
| ES7_BONE | 143098417 | 143098698 | 143098629 | 143098629 | Missense_Mutation | G | A | p.R74C |
| NUGC2_STOMACH | 143091901 | 143092107 | 143092107 | 143092212 | Splice_Site | CCTGCAGCAGGGTGAGTGGGTGAGTCAGGGGATGGGCCAGGTCTCCTCCCAGTGCCCAGGGTACCATGGTGCATCCCCCTCCCCAGCTAGTCCTCTGCCCTCCTCA | - | p.*716fs |
| IGR1_SKIN | 143095694 | 143096038 | 143096037 | 143096037 | Splice_Site | A | - | p.G331fs |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for EPHA1 |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EPHA1 |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for EPHA1 |
Top |
RelatedDrugs for EPHA1 |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
| P21709 | DB12010 | Fostamatinib | Ephrin type-A receptor 1 | small molecule | approved|investigational |
Top |
RelatedDiseases for EPHA1 |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| EPHA1 | C0002395 | Alzheimer's Disease | 2 | CTD_human |
| EPHA1 | C0009404 | Colorectal Neoplasms | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|