|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for ANKAR |
 Gene summary |
| Gene information | Gene symbol | ANKAR | Gene ID | 150709 |
| Gene name | ankyrin and armadillo repeat containing | |
| Synonyms | - | |
| Cytomap | 2q32.2 | |
| Type of gene | protein-coding | |
| Description | ankyrin and armadillo repeat-containing protein | |
| Modification date | 20180522 | |
| UniProtAcc | Q7Z5J8 | |
| Context | PubMed: ANKAR [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for ANKAR from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for ANKAR |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for ANKAR |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_331803 | 2 | 190561026:190561095:190569748:190569950:190571663:190571868 | 190569748:190569950 | ENSG00000151687.10 | ENST00000431575.2,ENST00000441800.1,ENST00000281412.6,ENST00000313581.4,ENST00000520309.1,ENST00000438402.2,ENST00000433782.2 |
| exon_skip_331806 | 2 | 190571663:190571872:190575774:190575879:190584297:190584539 | 190575774:190575879 | ENSG00000151687.10 | ENST00000431575.2,ENST00000441800.1,ENST00000281412.6,ENST00000313581.4,ENST00000520309.1,ENST00000438402.2,ENST00000433782.2 |
| exon_skip_331807 | 2 | 190584297:190584539:190585344:190585513:190592581:190592823 | 190585344:190585513 | ENSG00000151687.10 | ENST00000431575.2,ENST00000313581.4,ENST00000520309.1,ENST00000438402.2,ENST00000433782.2 |
| exon_skip_331814 | 2 | 190592581:190592823:190592992:190593146:190602408:190602567 | 190592992:190593146 | ENSG00000151687.10 | ENST00000441800.1,ENST00000281412.6 |
| exon_skip_331816 | 2 | 190593078:190593146:190593385:190593547:190602408:190602567 | 190593385:190593547 | ENSG00000151687.10 | ENST00000438402.2,ENST00000433782.2 |
| exon_skip_331822 | 2 | 190593078:190593146:190602408:190602567:190603290:190603408 | 190602408:190602567 | ENSG00000151687.10 | ENST00000441800.1,ENST00000281412.6 |
| exon_skip_331826 | 2 | 190593385:190593547:190595220:190595327:190597832:190597955 | 190595220:190595327 | ENSG00000151687.10 | ENST00000431575.2,ENST00000313581.4,ENST00000520309.1 |
| exon_skip_331832 | 2 | 190593385:190593547:190602408:190602567:190603290:190603408 | 190602408:190602567 | ENSG00000151687.10 | ENST00000438402.2,ENST00000433782.2 |
| exon_skip_331835 | 2 | 190597832:190597955:190602408:190602567:190603290:190603408 | 190602408:190602567 | ENSG00000151687.10 | ENST00000431575.2,ENST00000313581.4,ENST00000520309.1 |
| exon_skip_331838 | 2 | 190602408:190602567:190603290:190603408:190606067:190606177 | 190603290:190603408 | ENSG00000151687.10 | ENST00000431575.2,ENST00000441800.1,ENST00000281412.6,ENST00000313581.4,ENST00000520309.1,ENST00000438402.2,ENST00000433782.2 |
| exon_skip_331839 | 2 | 190606067:190606177:190608000:190608200:190609467:190609514 | 190608000:190608200 | ENSG00000151687.10 | ENST00000431575.2,ENST00000441800.1,ENST00000281412.6,ENST00000313581.4,ENST00000520309.1,ENST00000438402.2 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for ANKAR |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_331795 | 2 | 190554252:190554690:190556980:190557144:190557799:190557903 | 190556980:190557144 | ENSG00000151687.10 | ENST00000441800.1,ENST00000520309.1,ENST00000433782.2,ENST00000313581.4,ENST00000438402.2,ENST00000431575.2,ENST00000281412.6 |
| exon_skip_331802 | 2 | 190557799:190557903:190559706:190559887:190560875:190560926 | 190559706:190559887 | ENSG00000151687.10 | ENST00000441800.1,ENST00000520309.1,ENST00000433782.2,ENST00000313581.4,ENST00000438402.2,ENST00000431575.2,ENST00000281412.6 |
| exon_skip_331803 | 2 | 190561026:190561095:190569748:190569950:190571663:190571868 | 190569748:190569950 | ENSG00000151687.10 | ENST00000441800.1,ENST00000520309.1,ENST00000433782.2,ENST00000313581.4,ENST00000438402.2,ENST00000431575.2,ENST00000281412.6 |
| exon_skip_331806 | 2 | 190571663:190571872:190575774:190575879:190584297:190584539 | 190575774:190575879 | ENSG00000151687.10 | ENST00000441800.1,ENST00000520309.1,ENST00000433782.2,ENST00000313581.4,ENST00000438402.2,ENST00000431575.2,ENST00000281412.6 |
| exon_skip_331807 | 2 | 190584297:190584539:190585344:190585513:190592581:190592823 | 190585344:190585513 | ENSG00000151687.10 | ENST00000520309.1,ENST00000433782.2,ENST00000313581.4,ENST00000438402.2,ENST00000431575.2 |
| exon_skip_331814 | 2 | 190592581:190592823:190592992:190593146:190602408:190602567 | 190592992:190593146 | ENSG00000151687.10 | ENST00000441800.1,ENST00000281412.6 |
| exon_skip_331816 | 2 | 190593078:190593146:190593385:190593547:190602408:190602567 | 190593385:190593547 | ENSG00000151687.10 | ENST00000433782.2,ENST00000438402.2 |
| exon_skip_331822 | 2 | 190593078:190593146:190602408:190602567:190603290:190603408 | 190602408:190602567 | ENSG00000151687.10 | ENST00000441800.1,ENST00000281412.6 |
| exon_skip_331826 | 2 | 190593385:190593547:190595220:190595327:190597832:190597955 | 190595220:190595327 | ENSG00000151687.10 | ENST00000520309.1,ENST00000313581.4,ENST00000431575.2 |
| exon_skip_331832 | 2 | 190593385:190593547:190602408:190602567:190603290:190603408 | 190602408:190602567 | ENSG00000151687.10 | ENST00000433782.2,ENST00000438402.2 |
| exon_skip_331835 | 2 | 190597832:190597955:190602408:190602567:190603290:190603408 | 190602408:190602567 | ENSG00000151687.10 | ENST00000520309.1,ENST00000313581.4,ENST00000431575.2 |
| exon_skip_331838 | 2 | 190602408:190602567:190603290:190603408:190606067:190606177 | 190603290:190603408 | ENSG00000151687.10 | ENST00000441800.1,ENST00000520309.1,ENST00000433782.2,ENST00000313581.4,ENST00000438402.2,ENST00000431575.2,ENST00000281412.6 |
| exon_skip_331839 | 2 | 190606067:190606177:190608000:190608200:190609467:190609514 | 190608000:190608200 | ENSG00000151687.10 | ENST00000441800.1,ENST00000520309.1,ENST00000313581.4,ENST00000438402.2,ENST00000431575.2,ENST00000281412.6 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for ANKAR |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000313581 | 190569748 | 190569950 | Frame-shift |
| ENST00000520309 | 190569748 | 190569950 | Frame-shift |
| ENST00000313581 | 190585344 | 190585513 | Frame-shift |
| ENST00000520309 | 190585344 | 190585513 | Frame-shift |
| ENST00000313581 | 190595220 | 190595327 | Frame-shift |
| ENST00000520309 | 190595220 | 190595327 | Frame-shift |
| ENST00000313581 | 190603290 | 190603408 | Frame-shift |
| ENST00000520309 | 190603290 | 190603408 | Frame-shift |
| ENST00000313581 | 190608000 | 190608200 | Frame-shift |
| ENST00000520309 | 190608000 | 190608200 | Frame-shift |
| ENST00000313581 | 190575774 | 190575879 | In-frame |
| ENST00000520309 | 190575774 | 190575879 | In-frame |
| ENST00000313581 | 190602408 | 190602567 | In-frame |
| ENST00000520309 | 190602408 | 190602567 | In-frame |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| ENST00000313581 | 190556980 | 190557144 | Frame-shift |
| ENST00000520309 | 190556980 | 190557144 | Frame-shift |
| ENST00000313581 | 190559706 | 190559887 | Frame-shift |
| ENST00000520309 | 190559706 | 190559887 | Frame-shift |
| ENST00000313581 | 190569748 | 190569950 | Frame-shift |
| ENST00000520309 | 190569748 | 190569950 | Frame-shift |
| ENST00000313581 | 190585344 | 190585513 | Frame-shift |
| ENST00000520309 | 190585344 | 190585513 | Frame-shift |
| ENST00000313581 | 190595220 | 190595327 | Frame-shift |
| ENST00000520309 | 190595220 | 190595327 | Frame-shift |
| ENST00000313581 | 190603290 | 190603408 | Frame-shift |
| ENST00000520309 | 190603290 | 190603408 | Frame-shift |
| ENST00000313581 | 190608000 | 190608200 | Frame-shift |
| ENST00000520309 | 190608000 | 190608200 | Frame-shift |
| ENST00000313581 | 190575774 | 190575879 | In-frame |
| ENST00000520309 | 190575774 | 190575879 | In-frame |
| ENST00000313581 | 190602408 | 190602567 | In-frame |
| ENST00000520309 | 190602408 | 190602567 | In-frame |
Top |
Infer the effects of exon skipping event on protein functional features for ANKAR |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000313581 | 4408 | 1434 | 190575774 | 190575879 | 2184 | 2288 | 706 | 741 |
| ENST00000520309 | 4427 | 1434 | 190575774 | 190575879 | 2208 | 2312 | 706 | 741 |
| ENST00000313581 | 4408 | 1434 | 190602408 | 190602567 | 3488 | 3646 | 1141 | 1194 |
| ENST00000520309 | 4427 | 1434 | 190602408 | 190602567 | 3512 | 3670 | 1141 | 1194 |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| ENST00000313581 | 4408 | 1434 | 190575774 | 190575879 | 2184 | 2288 | 706 | 741 |
| ENST00000520309 | 4427 | 1434 | 190575774 | 190575879 | 2208 | 2312 | 706 | 741 |
| ENST00000313581 | 4408 | 1434 | 190602408 | 190602567 | 3488 | 3646 | 1141 | 1194 |
| ENST00000520309 | 4427 | 1434 | 190602408 | 190602567 | 3512 | 3670 | 1141 | 1194 |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q7Z5J8 | 706 | 741 | 706 | 716 | Alternative sequence | ID=VSP_025168;Note=In isoform 4. VEMLQCESYKR->KCYSVKAINEG;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 706 | 716 | Alternative sequence | ID=VSP_025168;Note=In isoform 4. VEMLQCESYKR->KCYSVKAINEG;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
| Q7Z5J8 | 706 | 741 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
| Q7Z5J8 | 706 | 741 | 732 | 771 | Repeat | Note=ARM 1 |
| Q7Z5J8 | 706 | 741 | 732 | 771 | Repeat | Note=ARM 1 |
| Q7Z5J8 | 1141 | 1194 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 1027 | 1434 | Alternative sequence | ID=VSP_025172;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 1027 | 1434 | Alternative sequence | ID=VSP_025172;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 1081 | 1434 | Alternative sequence | ID=VSP_025174;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| Q7Z5J8 | 1141 | 1194 | 1081 | 1434 | Alternative sequence | ID=VSP_025174;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| Q7Z5J8 | 1141 | 1194 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
| Q7Z5J8 | 1141 | 1194 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Q7Z5J8 | 706 | 741 | 706 | 716 | Alternative sequence | ID=VSP_025168;Note=In isoform 4. VEMLQCESYKR->KCYSVKAINEG;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 706 | 716 | Alternative sequence | ID=VSP_025168;Note=In isoform 4. VEMLQCESYKR->KCYSVKAINEG;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 706 | 741 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
| Q7Z5J8 | 706 | 741 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
| Q7Z5J8 | 706 | 741 | 732 | 771 | Repeat | Note=ARM 1 |
| Q7Z5J8 | 706 | 741 | 732 | 771 | Repeat | Note=ARM 1 |
| Q7Z5J8 | 1141 | 1194 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 717 | 1434 | Alternative sequence | ID=VSP_025169;Note=In isoform 4. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 1027 | 1434 | Alternative sequence | ID=VSP_025172;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 1027 | 1434 | Alternative sequence | ID=VSP_025172;Note=In isoform 3. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:15489334;Dbxref=PMID:15489334 |
| Q7Z5J8 | 1141 | 1194 | 1081 | 1434 | Alternative sequence | ID=VSP_025174;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| Q7Z5J8 | 1141 | 1194 | 1081 | 1434 | Alternative sequence | ID=VSP_025174;Note=In isoform 2. Missing;Ontology_term=ECO:0000303;evidence=ECO:0000303|PubMed:14702039;Dbxref=PMID:14702039 |
| Q7Z5J8 | 1141 | 1194 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
| Q7Z5J8 | 1141 | 1194 | 1 | 1434 | Chain | ID=PRO_0000286806;Note=Ankyrin and armadillo repeat-containing protein |
Top |
SNVs in the skipped exons for ANKAR |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_331803 | 190569749 | 190569950 | 190569800 | 190569800 | Frame_Shift_Del | T | - | p.V587fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_331803 | 190569749 | 190569950 | 190569839 | 190569839 | Frame_Shift_Del | A | - | p.E600fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_331803 | 190569749 | 190569950 | 190569839 | 190569839 | Frame_Shift_Del | A | - | p.E600fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_331803 | 190569749 | 190569950 | 190569839 | 190569839 | Frame_Shift_Del | A | - | p.E600fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_331803 | 190569749 | 190569950 | 190569865 | 190569865 | Frame_Shift_Del | T | - | p.F609fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_331814 | 190592993 | 190593146 | 190593036 | 190593036 | Frame_Shift_Del | G | - | p.W974fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_331814 | 190592993 | 190593146 | 190593066 | 190593066 | Frame_Shift_Del | A | - | p.Q984fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_331814 | 190592993 | 190593146 | 190593066 | 190593066 | Frame_Shift_Del | A | - | p.Q984fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_331816 | 190593386 | 190593547 | 190593509 | 190593509 | Frame_Shift_Del | T | - | p.L1053fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_331835 exon_skip_331832 exon_skip_331822 | 190602409 | 190602567 | 190602413 | 190602413 | Frame_Shift_Del | T | - | p.I1143fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_331838 | 190603291 | 190603408 | 190603323 | 190603323 | Frame_Shift_Del | G | - | p.M1205fs |
| COAD | TCGA-G4-6588-01 | exon_skip_331839 | 190608001 | 190608200 | 190608108 | 190608108 | Frame_Shift_Del | A | - | p.I1306fs |
| LIHC | TCGA-DD-A1EG-01 | exon_skip_331839 | 190608001 | 190608200 | 190608148 | 190608148 | Frame_Shift_Del | T | - | p.F1320fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_331839 | 190608001 | 190608200 | 190608160 | 190608160 | Frame_Shift_Del | T | - | p.F1324fs |
| BRCA | TCGA-BH-A0AW-01 | exon_skip_331803 | 190569749 | 190569950 | 190569785 | 190569785 | Nonsense_Mutation | C | G | p.S511* |
| STAD | TCGA-BR-4184-01 | exon_skip_331814 | 190592993 | 190593146 | 190593148 | 190593148 | Splice_Site | T | A | p.G1011_splice |
| COAD | TCGA-AD-6964-01 | exon_skip_331816 | 190593386 | 190593547 | 190593549 | 190593549 | Splice_Site | T | C | . |
| ACC | TCGA-OR-A5JE-01 | exon_skip_331826 | 190595221 | 190595327 | 190595328 | 190595328 | Splice_Site | G | T | . |
| COAD | TCGA-F4-6461-01 | exon_skip_331838 | 190603291 | 190603408 | 190603410 | 190603410 | Splice_Site | T | C | . |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| JHH7_LIVER | 190569749 | 190569950 | 190569854 | 190569866 | Frame_Shift_Del | TGCCGATTCACTT | - | p.MPIHF605fs |
| FTC238_THYROID | 190593386 | 190593547 | 190593466 | 190593488 | Frame_Shift_Del | TTGGTTCGCTTACTAAGAATTAG | - | p.LVRLLRIS1038fs |
| SKES1_BONE | 190602409 | 190602567 | 190602442 | 190602449 | Frame_Shift_Del | CTTTTTGC | - | p.LFA1153fs |
| EN_ENDOMETRIUM | 190608001 | 190608200 | 190608107 | 190608108 | Frame_Shift_Ins | - | A | p.IK1306fs |
| HS852T_SKIN | 190569749 | 190569950 | 190569845 | 190569845 | Missense_Mutation | G | T | p.R602I |
| KATOIII_STOMACH | 190569749 | 190569950 | 190569845 | 190569845 | Missense_Mutation | G | T | p.R602I |
| OVCA420_OVARY | 190569749 | 190569950 | 190569886 | 190569886 | Missense_Mutation | G | C | p.V616L |
| SIMA_AUTONOMIC_GANGLIA | 190575775 | 190575879 | 190575856 | 190575856 | Missense_Mutation | A | C | p.Y734S |
| HCT15_LARGE_INTESTINE | 190575775 | 190575879 | 190575877 | 190575877 | Missense_Mutation | C | T | p.A741V |
| KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 190585345 | 190585513 | 190585408 | 190585408 | Missense_Mutation | A | G | p.M844V |
| HEC108_ENDOMETRIUM | 190585345 | 190585513 | 190585475 | 190585475 | Missense_Mutation | G | A | p.G866D |
| KNS81FD_CENTRAL_NERVOUS_SYSTEM | 190585345 | 190585513 | 190585493 | 190585493 | Missense_Mutation | G | T | p.R872I |
| NB17_AUTONOMIC_GANGLIA | 190585345 | 190585513 | 190585493 | 190585493 | Missense_Mutation | G | T | p.R872I |
| MM426_SKIN | 190592993 | 190593146 | 190593021 | 190593021 | Missense_Mutation | G | A | p.G969E |
| HCT15_LARGE_INTESTINE | 190593386 | 190593547 | 190593419 | 190593419 | Missense_Mutation | G | A | p.S1022N |
| CW2_LARGE_INTESTINE | 190602409 | 190602567 | 190602461 | 190602461 | Missense_Mutation | G | A | p.R1159H |
| DU145_PROSTATE | 190602409 | 190602567 | 190602517 | 190602517 | Missense_Mutation | C | T | p.R1178C |
| CHLA99_BONE | 190602409 | 190602567 | 190602555 | 190602555 | Missense_Mutation | G | T | p.M1190I |
| SNU175_LARGE_INTESTINE | 190603291 | 190603408 | 190603298 | 190603298 | Missense_Mutation | T | C | p.V1197A |
| EFE184_ENDOMETRIUM | 190603291 | 190603408 | 190603386 | 190603386 | Missense_Mutation | G | C | p.Q1226H |
| NTERA2CLD1_TESTIS | 190608001 | 190608200 | 190608059 | 190608059 | Missense_Mutation | G | A | p.R1290H |
| DSH1_URINARY_TRACT | 190608001 | 190608200 | 190608073 | 190608073 | Missense_Mutation | G | C | p.E1295Q |
| DU145_PROSTATE | 190608001 | 190608200 | 190608122 | 190608122 | Missense_Mutation | G | C | p.S1311T |
| NCIH1155_LUNG | 190608001 | 190608200 | 190608122 | 190608122 | Missense_Mutation | G | A | p.S1311N |
| HEPG2_LIVER | 190575775 | 190575879 | 190575801 | 190575801 | Nonsense_Mutation | C | T | p.R716* |
| C3A_LIVER | 190575775 | 190575879 | 190575801 | 190575801 | Nonsense_Mutation | C | T | p.R716* |
| OVK18_OVARY | 190575775 | 190575879 | 190575859 | 190575859 | Nonsense_Mutation | G | A | p.W735* |
| SNU1040_LARGE_INTESTINE | 190592993 | 190593146 | 190592994 | 190592994 | Splice_Site | C | T | p.A960V |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for ANKAR |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ANKAR |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for ANKAR |
Top |
RelatedDrugs for ANKAR |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for ANKAR |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|