|
||||||
|
 | |
| |
| |
| |
| Open reading frame (ORF) annotation in the exon skipping event |
| |
| |
| Splicing Quantitative Trait Loci (sQTLs) in the skipped exons |
| Splicing Quantitative Trait Methylation (sQTM) in the skipped exon |
| |
|
Gene summary for VWA3A |
 Gene summary |
| Gene information | Gene symbol | VWA3A | Gene ID | 146177 |
| Gene name | von Willebrand factor A domain containing 3A | |
| Synonyms | - | |
| Cytomap | 16p12.2 | |
| Type of gene | protein-coding | |
| Description | von Willebrand factor A domain-containing protein 3A | |
| Modification date | 20180331 | |
| UniProtAcc | A6NCI4 | |
| Context | PubMed: VWA3A [Title/Abstract] AND exon [Title/Abstract] AND skip [Title/Abstract] - Title (PMID) |
| Gene ontology of each this gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Gene | GO ID | GO term | PubMed ID |
Top |
Exon skipping events across known transcript of Ensembl for VWA3A from UCSC genome browser |
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Gene isoform structures and expression levels for VWA3A |
| Expression levels of gene isoforms across TCGA. |
 |
| Expression levels of gene isoforms across GTEx. |
 |
Top |
Exon skipping events with PSIs in TCGA for VWA3A |
| Information of exkip skipping event in TCGA. |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_134516 | 16 | 22103862:22103972:22108179:22108266:22108892:22109016 | 22108179:22108266 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134517 | 16 | 22103862:22103972:22108179:22108266:22111514:22111639 | 22108179:22108266 | ENSG00000175267.10 | ENST00000567131.1 |
| exon_skip_134519 | 16 | 22108179:22108266:22108892:22109016:22111514:22111639 | 22108892:22109016 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134520 | 16 | 22111736:22111814:22114795:22114850:22120802:22120901 | 22114795:22114850 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134521 | 16 | 22114795:22114850:22120802:22120901:22122208:22122233 | 22120802:22120901 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134523 | 16 | 22128079:22128188:22128431:22128497:22130222:22130348 | 22128431:22128497 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134524 | 16 | 22130222:22130348:22132288:22132424:22132834:22132938 | 22132288:22132424 | ENSG00000175267.10 | ENST00000568328.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134528 | 16 | 22134405:22134486:22134794:22134857:22134933:22135028 | 22134794:22134857 | ENSG00000175267.10 | ENST00000568328.1 |
| exon_skip_134531 | 16 | 22134405:22134486:22134933:22135028:22137498:22137618 | 22134933:22135028 | ENSG00000175267.10 | ENST00000299840.6,ENST00000566668.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134533 | 16 | 22143032:22143050:22144104:22144416:22145688:22145759 | 22144104:22144416 | ENSG00000175267.10 | ENST00000566668.1 |
| exon_skip_134534 | 16 | 22143032:22143050:22144220:22144416:22145688:22145759 | 22144220:22144416 | ENSG00000175267.10 | ENST00000299840.6,ENST00000563389.1,ENST00000568328.1,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134535 | 16 | 22145688:22145759:22149680:22149833:22151474:22151565 | 22149680:22149833 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134536 | 16 | 22151474:22151565:22152523:22152570:22152902:22153013 | 22152523:22152570 | ENSG00000175267.10 | ENST00000299840.6 |
| exon_skip_134538 | 16 | 22152902:22153013:22153988:22154086:22155567:22155705 | 22153988:22154086 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134544 | 16 | 22153988:22154086:22155567:22155705:22157556:22157665 | 22155567:22155705 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389397.4,ENST00000389398.5 |
| exon_skip_134547 | 16 | 22155567:22155705:22157556:22157665:22159482:22159627 | 22157556:22157665 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389398.5 |
| exon_skip_134548 | 16 | 22157592:22157665:22158891:22158963:22159482:22159627 | 22158891:22158963 | ENSG00000175267.10 | ENST00000389397.4,ENST00000563755.1 |
| exon_skip_134549 | 16 | 22157592:22157665:22159482:22159627:22161107:22161252 | 22159482:22159627 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389398.5 |
| exon_skip_134550 | 16 | 22159482:22159627:22161107:22161252:22162015:22162167 | 22161107:22161252 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389397.4,ENST00000563755.1,ENST00000389398.5 |
| exon_skip_134553 | 16 | 22161107:22161252:22162015:22162167:22163831:22163955 | 22162015:22162167 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389397.4,ENST00000563755.1,ENST00000389398.5 |
| exon_skip_134555 | 16 | 22162015:22162167:22163831:22163955:22166887:22166985 | 22163831:22163955 | ENSG00000175267.10 | ENST00000299840.6,ENST00000389397.4,ENST00000563755.1,ENST00000389398.5 |
| PSI values of skipped exons in TCGA. |
 |
Top |
Exon skipping events with PSIs in GTEx for VWA3A |
| Information of exkip skipping event in GTEx |
| Exon skip ID | chr | Exons involved in exon skipping | Skipped exon | ENSG | ENSTs |
| exon_skip_134516 | 16 | 22103862:22103972:22108179:22108266:22108892:22109016 | 22108179:22108266 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389398.5,ENST00000389397.4 |
| exon_skip_134517 | 16 | 22103862:22103972:22108179:22108266:22111514:22111639 | 22108179:22108266 | ENSG00000175267.10 | ENST00000567131.1 |
| exon_skip_134519 | 16 | 22108179:22108266:22108892:22109016:22111514:22111639 | 22108892:22109016 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389398.5,ENST00000389397.4 |
| exon_skip_134520 | 16 | 22111736:22111814:22114795:22114850:22120802:22120901 | 22114795:22114850 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389398.5,ENST00000389397.4 |
| exon_skip_134521 | 16 | 22114795:22114850:22120802:22120901:22122208:22122233 | 22120802:22120901 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389398.5,ENST00000389397.4 |
| exon_skip_134523 | 16 | 22128079:22128188:22128431:22128497:22130222:22130348 | 22128431:22128497 | ENSG00000175267.10 | ENST00000566668.1,ENST00000568328.1,ENST00000389398.5,ENST00000389397.4 |
| exon_skip_134524 | 16 | 22130222:22130348:22132288:22132424:22132834:22132938 | 22132288:22132424 | ENSG00000175267.10 | ENST00000568328.1,ENST00000389398.5,ENST00000389397.4 |
| exon_skip_134528 | 16 | 22134405:22134486:22134794:22134857:22134933:22135028 | 22134794:22134857 | ENSG00000175267.10 | ENST00000568328.1 |
| exon_skip_134531 | 16 | 22134405:22134486:22134933:22135028:22137498:22137618 | 22134933:22135028 | ENSG00000175267.10 | ENST00000566668.1,ENST00000389398.5,ENST00000389397.4,ENST00000299840.6 |
| exon_skip_134533 | 16 | 22143032:22143050:22144104:22144416:22145688:22145759 | 22144104:22144416 | ENSG00000175267.10 | ENST00000566668.1 |
| exon_skip_134534 | 16 | 22143032:22143050:22144220:22144416:22145688:22145759 | 22144220:22144416 | ENSG00000175267.10 | ENST00000568328.1,ENST00000389398.5,ENST00000389397.4,ENST00000299840.6,ENST00000563389.1 |
| exon_skip_134535 | 16 | 22145688:22145759:22149680:22149833:22151474:22151565 | 22149680:22149833 | ENSG00000175267.10 | ENST00000389398.5,ENST00000389397.4,ENST00000299840.6 |
| exon_skip_134536 | 16 | 22151474:22151565:22152523:22152570:22152902:22153013 | 22152523:22152570 | ENSG00000175267.10 | ENST00000299840.6 |
| exon_skip_134538 | 16 | 22152902:22153013:22153988:22154086:22155567:22155705 | 22153988:22154086 | ENSG00000175267.10 | ENST00000389398.5,ENST00000389397.4,ENST00000299840.6 |
| exon_skip_134544 | 16 | 22153988:22154086:22155567:22155705:22157556:22157665 | 22155567:22155705 | ENSG00000175267.10 | ENST00000389398.5,ENST00000389397.4,ENST00000299840.6 |
| exon_skip_134547 | 16 | 22155567:22155705:22157556:22157665:22159482:22159627 | 22157556:22157665 | ENSG00000175267.10 | ENST00000389398.5,ENST00000299840.6 |
| exon_skip_134548 | 16 | 22157592:22157665:22158891:22158963:22159482:22159627 | 22158891:22158963 | ENSG00000175267.10 | ENST00000389397.4,ENST00000563755.1 |
| exon_skip_134549 | 16 | 22157592:22157665:22159482:22159627:22161107:22161252 | 22159482:22159627 | ENSG00000175267.10 | ENST00000389398.5,ENST00000299840.6 |
| exon_skip_134550 | 16 | 22159482:22159627:22161107:22161252:22162015:22162167 | 22161107:22161252 | ENSG00000175267.10 | ENST00000389398.5,ENST00000389397.4,ENST00000299840.6,ENST00000563755.1 |
| exon_skip_134553 | 16 | 22161107:22161252:22162015:22162167:22163831:22163955 | 22162015:22162167 | ENSG00000175267.10 | ENST00000389398.5,ENST00000389397.4,ENST00000299840.6,ENST00000563755.1 |
| exon_skip_134555 | 16 | 22162015:22162167:22163831:22163955:22166887:22166985 | 22163831:22163955 | ENSG00000175267.10 | ENST00000389398.5,ENST00000389397.4,ENST00000299840.6,ENST00000563755.1 |
| PSI values of skipped exons in GTEx. |
 |
| * Skipped exon sequences. |
Top |
Open reading frame (ORF) annotation in the exon skipping event for VWA3A |
| Open reading frame (ORF) of individual exon skipping events in TCGA based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
| Open reading frame (ORF) of individual exon skipping events in GTEx based on the Ensembl gene structure combined from isoforms. |
| ENST | Start of skipped exon | End of skipped exon | ORF |
Top |
Infer the effects of exon skipping event on protein functional features for VWA3A |
| Exon skipping at the protein sequence level and followed lost functional features. * Click on the image to enlarge it in a new window. |
 |
| Loci of skipped exons in TCGA across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Loci of skipped exons in GTEx across genomic, transcript, and protein sequence levels of In-frame cases. |
| ENST | Length of mRNA | Length of AA seq. | Genomic start | Genomic end | mRNA start | mRNA end | AA start | AA end |
| Lost protein functional features of individual exon skipping events in TCGA. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
| Lost protein functional features of individual exon skipping events in GTEx. |
| UniProt acc. | Start of exon skipping (AA) | End of exon skipping (AA) | Protein feature start (AA) | Protein feature end (AA) | Category of protein feature | Description of feature |
Top |
SNVs in the skipped exons for VWA3A |
| - Lollipop plot for presenting exon skipping associated SNVs. * Click on the image to enlarge it in a new window. |
 |
| - Differential PSIs between mutated versus non-mutated samples. |
| - Non-synonymous mutations located in the skipped exons in TCGA. |
| Cancer type | Sample | ESID | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_134531 | 22134934 | 22135028 | 22134990 | 22134990 | Frame_Shift_Del | G | - | p.L498fs |
| ACC | TCGA-PK-A5HB-01 | exon_skip_134531 | 22134934 | 22135028 | 22135022 | 22135022 | Frame_Shift_Del | A | - | p.E509fs |
| LIHC | TCGA-G3-A3CJ-01 | exon_skip_134531 | 22134934 | 22135028 | 22135022 | 22135022 | Frame_Shift_Del | A | - | p.E509fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_134533 | 22144105 | 22144416 | 22144315 | 22144315 | Frame_Shift_Del | C | - | p.T657fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_134534 | 22144221 | 22144416 | 22144315 | 22144315 | Frame_Shift_Del | C | - | p.T657fs |
| DLBC | TCGA-G8-6909-01 | exon_skip_134533 | 22144105 | 22144416 | 22144375 | 22144375 | Frame_Shift_Del | C | - | p.T676fs |
| DLBC | TCGA-G8-6909-01 | exon_skip_134534 | 22144221 | 22144416 | 22144375 | 22144375 | Frame_Shift_Del | C | - | p.T676fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_134544 | 22155568 | 22155705 | 22155589 | 22155589 | Frame_Shift_Del | A | - | p.K873fs |
| LIHC | TCGA-DD-A39Y-01 | exon_skip_134544 | 22155568 | 22155705 | 22155641 | 22155641 | Frame_Shift_Del | A | - | p.Q889fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_134549 | 22159483 | 22159627 | 22159588 | 22159588 | Frame_Shift_Del | T | - | p.V84fs |
| LIHC | TCGA-DD-A3A0-01 | exon_skip_134550 | 22161108 | 22161252 | 22161222 | 22161222 | Frame_Shift_Del | G | - | p.Q135fs |
| LUSC | TCGA-34-5239-01 | exon_skip_134555 | 22163832 | 22163955 | 22163889 | 22163889 | Frame_Shift_Del | C | - | p.C1113fs |
| COAD | TCGA-G4-6628-01 | exon_skip_134517 exon_skip_134516 | 22108180 | 22108266 | 22108214 | 22108214 | Nonsense_Mutation | C | T | p.Q17X |
| UCEC | TCGA-B5-A0JY-01 | exon_skip_134517 exon_skip_134516 | 22108180 | 22108266 | 22108241 | 22108241 | Nonsense_Mutation | G | T | p.E26* |
| UCEC | TCGA-AP-A059-01 | exon_skip_134535 | 22149681 | 22149833 | 22149729 | 22149729 | Nonsense_Mutation | G | T | p.G730* |
| STAD | TCGA-BR-8680-01 | exon_skip_134535 | 22149681 | 22149833 | 22149750 | 22149750 | Nonsense_Mutation | G | T | p.E737* |
| UCEC | TCGA-D1-A16X-01 | exon_skip_134535 | 22149681 | 22149833 | 22149750 | 22149750 | Nonsense_Mutation | G | T | p.E737* |
| ESCA | TCGA-LN-A49M-01 | exon_skip_134535 | 22149681 | 22149833 | 22149768 | 22149768 | Nonsense_Mutation | C | T | p.Q743* |
| ESCA | TCGA-LN-A49M-01 | exon_skip_134535 | 22149681 | 22149833 | 22149768 | 22149768 | Nonsense_Mutation | C | T | p.Q743X |
| ESCA | TCGA-R6-A6Y0-01 | exon_skip_134549 | 22159483 | 22159627 | 22159581 | 22159581 | Nonsense_Mutation | G | T | p.E980* |
| HNSC | TCGA-CV-6962-01 | exon_skip_134531 | 22134934 | 22135028 | 22134933 | 22134933 | Splice_Site | G | T | p.Q480_splice |
| - Depth of coverage in the three exons composing exon skipping event |
| Depth of coverage in three exons | Mutation description |
| - Non-synonymous mutations located in the skipped exons in CCLE. |
| Sample | Skipped exon start | Skipped exon end | Mutation start | Mutation end | Mutation type | Reference seq | Mutation seq | AAchange |
| IGROV1_OVARY | 22108180 | 22108266 | 22108215 | 22108215 | Frame_Shift_Del | A | - | p.Q17fs |
| SNU466_CENTRAL_NERVOUS_SYSTEM | 22155568 | 22155705 | 22155687 | 22155687 | Frame_Shift_Del | C | - | p.F904fs |
| NOS1_BONE | 22155568 | 22155705 | 22155687 | 22155687 | Frame_Shift_Del | C | - | p.F904fs |
| DU145_PROSTATE | 22108180 | 22108266 | 22108238 | 22108238 | Missense_Mutation | C | A | p.Q25K |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22108893 | 22109016 | 22108984 | 22108984 | Missense_Mutation | G | A | p.V65I |
| NCIH650_LUNG | 22114796 | 22114850 | 22114819 | 22114819 | Missense_Mutation | G | A | p.R151K |
| SF126_CENTRAL_NERVOUS_SYSTEM | 22120803 | 22120901 | 22120845 | 22120845 | Missense_Mutation | G | A | p.D176N |
| HCC2450_LUNG | 22128432 | 22128497 | 22128491 | 22128491 | Missense_Mutation | G | C | p.K328N |
| FTC133_THYROID | 22132289 | 22132424 | 22132307 | 22132307 | Missense_Mutation | A | G | p.N379D |
| NCIH1339_LUNG | 22132289 | 22132424 | 22132332 | 22132332 | Missense_Mutation | C | T | p.P387L |
| SNU1040_LARGE_INTESTINE | 22132289 | 22132424 | 22132352 | 22132352 | Missense_Mutation | G | A | p.A394T |
| NCIH2803_PLEURA | 22132289 | 22132424 | 22132371 | 22132371 | Missense_Mutation | T | C | p.F400S |
| IPC298_SKIN | 22132289 | 22132424 | 22132403 | 22132403 | Missense_Mutation | C | T | p.L411F |
| SNU1040_LARGE_INTESTINE | 22134934 | 22135028 | 22135015 | 22135015 | Missense_Mutation | G | A | p.V507I |
| A172_CENTRAL_NERVOUS_SYSTEM | 22149681 | 22149833 | 22149707 | 22149707 | Missense_Mutation | G | T | p.K722N |
| MCC13_SKIN | 22149681 | 22149833 | 22149739 | 22149740 | Missense_Mutation | CC | TT | p.A733V |
| MCC13_SKIN | 22149681 | 22149833 | 22149739 | 22149739 | Missense_Mutation | C | T | p.A733V |
| JHUEM7_ENDOMETRIUM | 22149681 | 22149833 | 22149754 | 22149754 | Missense_Mutation | A | G | p.K738R |
| SNU81_LARGE_INTESTINE | 22149681 | 22149833 | 22149775 | 22149775 | Missense_Mutation | G | T | p.R745I |
| C33A_CERVIX | 22149681 | 22149833 | 22149804 | 22149804 | Missense_Mutation | A | G | p.R755G |
| MM415_SKIN | 22153989 | 22154086 | 22154021 | 22154021 | Missense_Mutation | G | A | p.G843S |
| LAN2_AUTONOMIC_GANGLIA | 22153989 | 22154086 | 22154038 | 22154038 | Missense_Mutation | C | A | p.S848R |
| JHUEM2_ENDOMETRIUM | 22157557 | 22157665 | 22157605 | 22157605 | Missense_Mutation | A | C | p.I927L |
| SNU1040_LARGE_INTESTINE | 22159483 | 22159627 | 22159540 | 22159540 | Missense_Mutation | C | T | p.T966M |
| FADU_UPPER_AERODIGESTIVE_TRACT | 22161108 | 22161252 | 22161187 | 22161187 | Missense_Mutation | G | A | p.E1022K |
| TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22162016 | 22162167 | 22162064 | 22162064 | Missense_Mutation | G | A | p.G1060R |
| JEG3_PLACENTA | 22162016 | 22162167 | 22162064 | 22162064 | Missense_Mutation | G | A | p.G1060R |
| SCC9_UPPER_AERODIGESTIVE_TRACT | 22162016 | 22162167 | 22162087 | 22162087 | Missense_Mutation | C | A | p.S1067R |
| MDAMB453_BREAST | 22162016 | 22162167 | 22162100 | 22162100 | Missense_Mutation | G | A | p.E1072K |
| HCC2998_LARGE_INTESTINE | 22162016 | 22162167 | 22162108 | 22162108 | Missense_Mutation | A | C | p.Q1074H |
| EN_ENDOMETRIUM | 22162016 | 22162167 | 22162164 | 22162164 | Missense_Mutation | A | T | p.D1093V |
| LK2_LUNG | 22163832 | 22163955 | 22163848 | 22163848 | Missense_Mutation | C | A | p.L1100M |
| YMB1E_BREAST | 22163832 | 22163955 | 22163909 | 22163909 | Missense_Mutation | T | C | p.L1120P |
| JURKAT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22161108 | 22161252 | 22161148 | 22161148 | Nonsense_Mutation | C | T | p.Q1009* |
| NCIH1435_LUNG | 22120803 | 22120901 | 22120901 | 22120901 | Splice_Site | G | C | p.M194I |
| SARC9371_BONE | 22134934 | 22135028 | 22134923 | 22134979 | Splice_Site | CACTTCTGCAGCAACAGCTCAGCAGAGCTATGCGGATGTATGAGAGGCGGATTGAGT | - | p.TSAATAQQSYADV*EA480del |
| HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE | 22149681 | 22149833 | 22149681 | 22149681 | Splice_Site | T | C | p.C714R |
Top |
Splicing Quantitative Trait Loci (sQTL) in the exon skipping event for VWA3A |
| sQTL information located at the skipped exons. |
| Exon skip ID | Chromosome | Three exons | Skippped exon | ENST | Cancer type | SNP id | Location | DNA change (ref/var) | P-value |
Top |
Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for VWA3A |
Top |
Survival analysis of Splicing Quantitative Trait Methylation (sQTM) in the skipped exon for VWA3A |
Top |
RelatedDrugs for VWA3A |
| Approved drugs targeting this gene. (DrugBank Version 5.1.0 2018-04-02) |
| Gene | UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
RelatedDiseases for VWA3A |
| Diseases associated with this gene. (DisGeNet 4.0) |
| Gene | Disease ID | Disease name | # pubmeds | Source |
| VWA3A | C0005695 | Bladder Neoplasm | 1 | CTD_human |
Copyright 2018-Present -The University of Texas Health Science Center at Houston (UTHealth)
|